Skip to content

adding raw reads for west-nile #6

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Merged
maverbiest merged 1 commit into from
Sep 18, 2026
Merged

adding raw reads for west-nile #6

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
24 changes: 12 additions & 12 deletions example_files/west_nile_metadata.tsv
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,12 +1,12 @@
submissionId versionComment authors authorAffiliations specimenCollectorSampleId Geo_Location geoLocCountry geoLocAdmin1 geoLocAdmin2 geoLocCity hostNameScientific anatomicalMaterial sampleCollectionDate
test_INYO_2_2011 KR348976 "Duggal, N.K.; Reisen, W.K.; Fang, Y.; Newman,R.M.; Yang, X.; Ebel, G.D.; Brault,A.C.; Brault,A." "Centers for Disease Control and Prevention, Division of Vector-Borne Infectious Diseases" INYO_2_2011 USA Hogwarts Culex tarsalis 2011-07-18
test_WNV/mosquito/Bakersfield_CA_USA/2010-07-08/W417 MH508004 "Grubaugh,N.; Fang,Y.; Matteson,N.L.; Gangavarapu,K.; Coffey,L.; Barker,C.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Bakersfield,California" USA California Hogwarts Bakersfield Culex quinquefasciatus pooled insects 2010-07-08
test_WNV/mosquito/Larimer-CO-USA/2016-06-27/W1819 OQ721426 "Grubaugh,N.; Matteson,N.; Gangavarupa,K.; Ebel,G.; Murrieta,R.; Fauver,J.; Young,M.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Larimer, Colorado" USA Colorado Hogwarts Larimer Culex tarsalis pooled insects 2016-06-27
test_AVA1305539 MF175822 "Aroh,C.; D'Anton,M.; Liang,C.; Raj,P.; Wakeland,B.; Yan,N.; Wakeland,E." "UT Southwestern Medical Center, Department of Immunology" AVA1305539 USA: Dallas Co. TX USA texas Hogwarts Dallas Co Culex quinquefasciatus 2013-08-20
test_WNV/mosquito/Polk-IA-USA/2017-07-17/W1959 OQ721462 "Grubaugh,N.; Matteson,N.; Gangavarupa,K.; Smith,R.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Polk, Iowa" USA Iowa Hogwarts Polk Culex restuans pooled insects 2017-07-17
test_WNV/mosquito/San_Diego_CA_USA/2014-10-31/W014 MH507621 "Grubaugh,N.; Grewal,S.; Matteson,N.L.; Gangavarapu,K.; Gurfield,N.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: San_Diego,California" USA California Hogwarts San Diego Culex quinquefasciatus pooled insects 2014-10-31
test_WNV/bird/Valley_Center_CA_USA/2008-09-18/W037 MH507637 "Grubaugh,N.; Grewal,S.; Matteson,N.L.; Gangavarapu,K.; Gurfield,N.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Valley_Center,California" USA California Hogwarts Valey Center Corvus brachyrhynchos tissue 2008-09-18
test_WNV-1/Cyanocitta cristata /USA/03003243/2003 KX547593 "Shabman,R.; Das,S.R.; Halpin,R.A.; Shilts,M.; Fedorova,N.; Puri,V.; Amedeo,P.; Shrivastava,S.; Maffei,J.; Dupuis,A.; Jones,S.; Backenson,B.; Zink,S.; Ciota,A.; Kramer,L." J. Craig Venter Institute "USA: Washington Co., NY" USA New York Hogwarts Washington Co Cyanocitta cristata 2003-09-28
test_WNV/mosquito/Parlier_CA_USA/2010-08-12/W188 MH507768 "Grubaugh,N.; Fang,Y.; Matteson,N.L.; Gangavarapu,K.; Coffey,L.; Barker,C.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Parlier,California" USA California Hogwarts Parlier Culex tarsalis pooled insects 2010-08-12
test_WNV/mosquito/Yolo-CA-USA/2015-07-16/W0706 OQ721464 "Grubaugh,N.; Matteson,N.; Gangavarupa,K.; Barker,C.; Wheeler,S.; Fang,Y.; Coffey,L.; Reisen,W.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Yolo, California" USA California Hogwarts Yolo Culex tarsalis pooled insects 2015-07-16
test_AZ10-91 KF704147 "Plante,J.A.; Burkhalter,K.L.; Mann,B.R.; Godsey,M.S. Jr.; Mutebi,J.P.; Beasley,D.W.; Mutebi,J.-P." Centers for Disease Control and Prevention "USA: Glendale, Maricopa Co., AZ" USA Arizona Hogwarts Glendale Culex quinquefasciatus 2010-08-01
submissionId versionComment authors authorAffiliations specimenCollectorSampleId Geo_Location geoLocCountry geoLocAdmin1 geoLocAdmin2 geoLocCity hostNameScientific anatomicalMaterial sampleCollectionDate sequencingInstrument files.rawReads
test_INYO_2_2011 KR348976 "Duggal, N.K.; Reisen, W.K.; Fang, Y.; Newman,R.M.; Yang, X.; Ebel, G.D.; Brault,A.C.; Brault,A." "Centers for Disease Control and Prevention, Division of Vector-Borne Infectious Diseases" INYO_2_2011 USA Hogwarts Culex tarsalis 2011-07-18 ILLUMINA raw_reads_1.fq.gz
test_WNV/mosquito/Bakersfield_CA_USA/2010-07-08/W417 MH508004 "Grubaugh,N.; Fang,Y.; Matteson,N.L.; Gangavarapu,K.; Coffey,L.; Barker,C.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Bakersfield,California" USA California Hogwarts Bakersfield Culex quinquefasciatus pooled insects 2010-07-08 PacBio RS raw_reads_contaminated.fq.gz
test_WNV/mosquito/Larimer-CO-USA/2016-06-27/W1819 OQ721426 "Grubaugh,N.; Matteson,N.; Gangavarupa,K.; Ebel,G.; Murrieta,R.; Fauver,J.; Young,M.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Larimer, Colorado" USA Colorado Hogwarts Larimer Culex tarsalis pooled insects 2016-06-27
test_AVA1305539 MF175822 "Aroh,C.; D'Anton,M.; Liang,C.; Raj,P.; Wakeland,B.; Yan,N.; Wakeland,E." "UT Southwestern Medical Center, Department of Immunology" AVA1305539 USA: Dallas Co. TX USA texas Hogwarts Dallas Co Culex quinquefasciatus 2013-08-20
test_WNV/mosquito/Polk-IA-USA/2017-07-17/W1959 OQ721462 "Grubaugh,N.; Matteson,N.; Gangavarupa,K.; Smith,R.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Polk, Iowa" USA Iowa Hogwarts Polk Culex restuans pooled insects 2017-07-17
test_WNV/mosquito/San_Diego_CA_USA/2014-10-31/W014 MH507621 "Grubaugh,N.; Grewal,S.; Matteson,N.L.; Gangavarapu,K.; Gurfield,N.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: San_Diego,California" USA California Hogwarts San Diego Culex quinquefasciatus pooled insects 2014-10-31
test_WNV/bird/Valley_Center_CA_USA/2008-09-18/W037 MH507637 "Grubaugh,N.; Grewal,S.; Matteson,N.L.; Gangavarapu,K.; Gurfield,N.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Valley_Center,California" USA California Hogwarts Valey Center Corvus brachyrhynchos tissue 2008-09-18
test_WNV-1/Cyanocitta_cristata/USA/03003243/2003 KX547593 "Shabman,R.; Das,S.R.; Halpin,R.A.; Shilts,M.; Fedorova,N.; Puri,V.; Amedeo,P.; Shrivastava,S.; Maffei,J.; Dupuis,A.; Jones,S.; Backenson,B.; Zink,S.; Ciota,A.; Kramer,L." J. Craig Venter Institute "USA: Washington Co., NY" USA New York Hogwarts Washington Co Cyanocitta cristata 2003-09-28
test_WNV/mosquito/Parlier_CA_USA/2010-08-12/W188 MH507768 "Grubaugh,N.; Fang,Y.; Matteson,N.L.; Gangavarapu,K.; Coffey,L.; Barker,C.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Parlier,California" USA California Hogwarts Parlier Culex tarsalis pooled insects 2010-08-12
test_WNV/mosquito/Yolo-CA-USA/2015-07-16/W0706 OQ721464 "Grubaugh,N.; Matteson,N.; Gangavarupa,K.; Barker,C.; Wheeler,S.; Fang,Y.; Coffey,L.; Reisen,W.; Andersen,K." "The Scripps Research Institute, Department of Immunology and Microbiology" "USA: Yolo, California" USA California Hogwarts Yolo Culex tarsalis pooled insects 2015-07-16
test_AZ10-91 KF704147 "Plante,J.A.; Burkhalter,K.L.; Mann,B.R.; Godsey,M.S. Jr.; Mutebi,J.P.; Beasley,D.W.; Mutebi,J.-P." Centers for Disease Control and Prevention "USA: Glendale, Maricopa Co., AZ" USA Arizona Hogwarts Glendale Culex quinquefasciatus 2010-08-01
Binary file modified example_files/west_nile_metadata.xls
View file
Open in desktop
Binary file not shown.
Binary file modified example_files/west_nile_metadata.xlsx
View file
Open in desktop
Binary file not shown.
Binary file added example_files/west_nile_raw_reads/raw_reads_1.fq.gz
View file
Open in desktop
Binary file not shown.
Binary file added example_files/west_nile_raw_reads/raw_reads_contaminated.fq.gz
View file
Open in desktop
Binary file not shown.
2 changes: 1 addition & 1 deletion example_files/west_nile_sequences.fasta
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -1389,7 +1389,7 @@ TCTGGTGTGGCAGCCTGATCGGCACAAGAGCCCGAGCCACGTGGGCAGAAAACATCCAGG
TGGCTATCAACCAAGTCAGAGCAATCATTGGAGATGAGAAGTATGTGGATTACATGAGTT
CACTAAAGAGATATGAAGACACAACTTTGGTTGAGGATACAGTACTGTAG

>test_WNV-1/Cyanocitta cristata /USA/03003243/2003
>test_WNV-1/Cyanocitta_cristata/USA/03003243/2003
AGTGTTTGTGAGGATTAACAACGATTAACACAGTGCGAGCTGTTTCTTAGCACGAAGATC
TCGATGTCTAAGAAACCAGGAGGGCCCGGCAAGAGCCGGGCTGTCAATATGCTAAAACGC
GGAATGCCCCGCGTGTTGTCCTTGATTGGACTGAAGAGGGCTATGTTGAGCCTGATCGAC
Expand Down