|
| 1 | +/* |
| 2 | + * To change this license header, choose License Headers in Project Properties. |
| 3 | + * To change this template file, choose Tools | Templates |
| 4 | + * and open the template in the editor. |
| 5 | + */ |
| 6 | +package org.biojava.nbio.core.search.io; |
| 7 | + |
| 8 | +import org.biojava.nbio.alignment.template.SequencePair; |
| 9 | +import org.biojava.nbio.core.search.io.blast.BlastHspBuilder; |
| 10 | +import org.biojava.nbio.core.sequence.DNASequence; |
| 11 | +import org.biojava.nbio.core.sequence.compound.NucleotideCompound; |
| 12 | +import org.junit.After; |
| 13 | +import org.junit.AfterClass; |
| 14 | +import org.junit.Before; |
| 15 | +import org.junit.BeforeClass; |
| 16 | +import org.junit.Test; |
| 17 | +import static org.junit.Assert.*; |
| 18 | +import org.junit.Ignore; |
| 19 | + |
| 20 | +/** |
| 21 | + * |
| 22 | + * @author pavanpa |
| 23 | + */ |
| 24 | +public class HspTest { |
| 25 | + |
| 26 | + Hsp hspImpl = new BlastHspBuilder() |
| 27 | + .setHspNum(1) |
| 28 | + .setHspBitScore(377.211) |
| 29 | + .setHspEvalue(8.04143e-093) |
| 30 | + .setHspQueryFrom(1) |
| 31 | + .setHspQueryTo(224) |
| 32 | + .setHspHitFrom(1035) |
| 33 | + .setHspHitTo(811) |
| 34 | + .setHspQueryFrame(-1) |
| 35 | + .setHspIdentity(213) |
| 36 | + .setHspPositive(213) |
| 37 | + .setHspGaps(5) |
| 38 | + .setHspAlignLen(227) |
| 39 | + .setHspQseq("CTGACGACAGCCATGCACCACCTGTCTCGACTTTCCCCCGAAGGGCACCTAATGTATCTCTACCTCGTTAGTCGGATGTCAAGACCTGGTAAGGTTTTTTCGCGTATCTTCGAATTAAACCACATACTCCACTGCTTGTGCGG-CCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGCCGTACTCCC-AGGTGGA-TACTTATTGTGTTAACTCCGGCACGGAAGG") |
| 40 | + .setHspHseq("CTGACGACAACCATGCACCACCTGTCTCAACTTTCCCC-GAAGGGCACCTAATGTATCTCTACTTCGTTAGTTGGATGTCAAGACCTGGTAAGGTT-CTTCGCGTTGCTTCGAATTAAACCACATACTCCACTGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGTGGATTACTTATTGTGTTAACTCCGGCACAGAAGG") |
| 41 | + .setHspIdentityString("||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||| |||||") |
| 42 | + .createBlastHsp(); |
| 43 | + |
| 44 | + public HspTest() { |
| 45 | + } |
| 46 | + |
| 47 | + @BeforeClass |
| 48 | + public static void setUpClass() { |
| 49 | + } |
| 50 | + |
| 51 | + @AfterClass |
| 52 | + public static void tearDownClass() { |
| 53 | + } |
| 54 | + |
| 55 | + @Before |
| 56 | + public void setUp() { |
| 57 | + } |
| 58 | + |
| 59 | + @After |
| 60 | + public void tearDown() { |
| 61 | + } |
| 62 | + |
| 63 | + /** |
| 64 | + * Test of hashCode method, of class Hsp. |
| 65 | + */ |
| 66 | + @Test |
| 67 | + @Ignore public void testHashCode() { |
| 68 | + System.out.println("hashCode"); |
| 69 | + Hsp instance = null; |
| 70 | + int expResult = 0; |
| 71 | + int result = instance.hashCode(); |
| 72 | + assertEquals(expResult, result); |
| 73 | + // TODO review the generated test code and remove the default call to fail. |
| 74 | + fail("The test case is a prototype."); |
| 75 | + } |
| 76 | + |
| 77 | + /** |
| 78 | + * Test of equals method, of class Hsp. |
| 79 | + */ |
| 80 | + @Test |
| 81 | + @Ignore public void testEquals() { |
| 82 | + System.out.println("equals"); |
| 83 | + Object o = null; |
| 84 | + Hsp instance = null; |
| 85 | + boolean expResult = false; |
| 86 | + boolean result = instance.equals(o); |
| 87 | + assertEquals(expResult, result); |
| 88 | + // TODO review the generated test code and remove the default call to fail. |
| 89 | + fail("The test case is a prototype."); |
| 90 | + } |
| 91 | + |
| 92 | + /** |
| 93 | + * Test of getAlignment method, of class Hsp. |
| 94 | + */ |
| 95 | + @Test |
| 96 | + public void testGetAlignment() { |
| 97 | + System.out.println("getAlignment"); |
| 98 | + |
| 99 | + SequencePair<DNASequence, NucleotideCompound> aln = hspImpl.getAlignment(); |
| 100 | + |
| 101 | + StringBuilder s = new StringBuilder(); |
| 102 | + s.append(hspImpl.getHspQseq()); |
| 103 | + s.append(String.format("%n")); |
| 104 | + s.append(hspImpl.getHspHseq()); |
| 105 | + s.append(String.format("%n")); |
| 106 | + |
| 107 | + String expResult = s.toString(); |
| 108 | + |
| 109 | + String result = aln.toString(); |
| 110 | + |
| 111 | + assertEquals(expResult, result); |
| 112 | + } |
| 113 | + |
| 114 | +} |
0 commit comments