| 1 | /* |
| 2 | Copyright (c) Marshall Clow 2010-2012. |
| 3 | |
| 4 | Distributed under the Boost Software License, Version 1.0. (See accompanying |
| 5 | file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt) |
| 6 | |
| 7 | For more information, see http://www.boost.org |
| 8 | */ |
| 9 | |
| 10 | #include <boost/algorithm/searching/boyer_moore.hpp> |
| 11 | #include <boost/algorithm/searching/boyer_moore_horspool.hpp> |
| 12 | #include <boost/algorithm/searching/knuth_morris_pratt.hpp> |
| 13 | |
| 14 | #define BOOST_TEST_MAIN |
| 15 | #include <boost/test/unit_test.hpp> |
| 16 | |
| 17 | #include <iostream> |
| 18 | #include <string> |
| 19 | #include <vector> |
| 20 | |
| 21 | |
| 22 | namespace ba = boost::algorithm; |
| 23 | |
| 24 | template <typename Iter> |
| 25 | std::string make_str ( Iter first, std::size_t len ) { |
| 26 | std::string retVal ( len + 2, '\'' ); |
| 27 | std::copy ( first, first+len, retVal.begin () + 1); |
| 28 | return retVal; |
| 29 | } |
| 30 | |
| 31 | namespace { |
| 32 | |
| 33 | // Check using iterators |
| 34 | template<typename Container> |
| 35 | void check_one_iter ( const Container &haystack, const std::string &needle, std::ptrdiff_t expected ) { |
| 36 | typedef typename Container::const_iterator iter_type; |
| 37 | typedef typename std::pair<iter_type, iter_type> ret_type; |
| 38 | typedef std::string::const_iterator pattern_type; |
| 39 | |
| 40 | iter_type hBeg = haystack.begin (); |
| 41 | iter_type hEnd = haystack.end (); |
| 42 | pattern_type nBeg = needle.begin (); |
| 43 | pattern_type nEnd = needle.end (); |
| 44 | |
| 45 | // iter_type ret0 = std::search (hBeg, hEnd, nBeg, nEnd); |
| 46 | ret_type ret1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd); |
| 47 | ret_type ret1r = ba::boyer_moore_search (haystack, nBeg, nEnd); |
| 48 | ret_type ret2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd); |
| 49 | ret_type ret3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd); |
| 50 | |
| 51 | iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd); |
| 52 | // iter_type it1 = ret1.first; |
| 53 | // iter_type it1r = ret1r.first; |
| 54 | // iter_type it2 = ret2.first; |
| 55 | // iter_type it3 = ret3.first; |
| 56 | const std::ptrdiff_t dist = ret1.first == hEnd ? -1 : std::distance ( hBeg, ret1.first ); |
| 57 | |
| 58 | std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl; |
| 59 | try { |
| 60 | if ( it0 != ret1.first ) { |
| 61 | throw std::runtime_error ( |
| 62 | std::string ( "results mismatch between std::search and boyer-moore search" )); |
| 63 | } |
| 64 | |
| 65 | if ( ret1.first != ret1r.first || ret1.second != ret1r.second ) { |
| 66 | throw std::runtime_error ( |
| 67 | std::string ( "results mismatch between iterator and range boyer_moore search" )); |
| 68 | } |
| 69 | |
| 70 | if ( ret1.first != ret2.first || ret1.second != ret2.second ) { |
| 71 | throw std::runtime_error ( |
| 72 | std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" )); |
| 73 | } |
| 74 | |
| 75 | if ( ret1.first != ret3.first || ret1.second != ret3.second ) { |
| 76 | throw std::runtime_error ( |
| 77 | std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" )); |
| 78 | } |
| 79 | |
| 80 | } |
| 81 | |
| 82 | catch ( ... ) { |
| 83 | std::cout << "Searching for: " << needle << std::endl; |
| 84 | std::cout << "Expected: " << expected << "\n" ; |
| 85 | std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n" ; |
| 86 | std::cout << " bm: " << std::distance ( hBeg, ret1.first ) << "\n" ; |
| 87 | std::cout << " bm(r): " << std::distance ( hBeg, ret1r.first ) << "\n" ; |
| 88 | std::cout << " bmh: " << std::distance ( hBeg, ret2.first ) << "\n" ; |
| 89 | std::cout << " kpm: " << std::distance ( hBeg, ret3.first )<< "\n" ; |
| 90 | std::cout << std::flush; |
| 91 | throw ; |
| 92 | } |
| 93 | |
| 94 | BOOST_CHECK_EQUAL ( dist, expected ); |
| 95 | } |
| 96 | |
| 97 | // Check using pointers |
| 98 | // We're assuming that the container implements contiguous storage here. |
| 99 | template<typename Container> |
| 100 | void check_one_pointer ( const Container &haystack, const std::string &needle, std::ptrdiff_t expected ) { |
| 101 | typedef const typename Container::value_type *ptr_type; |
| 102 | typedef typename std::pair<ptr_type, ptr_type> ret_type; |
| 103 | |
| 104 | ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin (); |
| 105 | ptr_type hEnd = hBeg + haystack.size (); |
| 106 | ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin (); |
| 107 | ptr_type nEnd = nBeg + needle.size (); |
| 108 | |
| 109 | ptr_type it0 = std::search (hBeg, hEnd, nBeg, nEnd); |
| 110 | ret_type ret1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd); |
| 111 | ret_type ret2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd); |
| 112 | ret_type ret3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd); |
| 113 | const std::ptrdiff_t dist = ret1.first == hEnd ? -1 : std::distance ( hBeg, ret1.first ); |
| 114 | |
| 115 | std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl; |
| 116 | try { |
| 117 | if ( it0 != ret1.first ) { |
| 118 | throw std::runtime_error ( |
| 119 | std::string ( "results mismatch between std::search and boyer-moore search" )); |
| 120 | } |
| 121 | |
| 122 | if ( ret1.first != ret2.first || ret1.second != ret2.second ) { |
| 123 | throw std::runtime_error ( |
| 124 | std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" )); |
| 125 | } |
| 126 | |
| 127 | if ( ret1.first != ret3.first || ret1.second != ret3.second ) { |
| 128 | throw std::runtime_error ( |
| 129 | std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" )); |
| 130 | } |
| 131 | |
| 132 | } |
| 133 | |
| 134 | catch ( ... ) { |
| 135 | std::cout << "Searching for: " << needle << std::endl; |
| 136 | std::cout << "Expected: " << expected << "\n" ; |
| 137 | std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n" ; |
| 138 | std::cout << " bm: " << std::distance ( hBeg, ret1.first ) << "\n" ; |
| 139 | std::cout << " bmh: " << std::distance ( hBeg, ret2.first ) << "\n" ; |
| 140 | std::cout << " kpm: " << std::distance ( hBeg, ret3.first )<< "\n" ; |
| 141 | std::cout << std::flush; |
| 142 | throw ; |
| 143 | } |
| 144 | |
| 145 | BOOST_CHECK_EQUAL ( dist, expected ); |
| 146 | } |
| 147 | |
| 148 | // Check using objects |
| 149 | template<typename Container> |
| 150 | void check_one_object ( const Container &haystack, const std::string &needle, std::ptrdiff_t expected ) { |
| 151 | typedef typename Container::const_iterator iter_type; |
| 152 | typedef typename std::pair<iter_type, iter_type> ret_type; |
| 153 | typedef std::string::const_iterator pattern_type; |
| 154 | |
| 155 | iter_type hBeg = haystack.begin (); |
| 156 | iter_type hEnd = haystack.end (); |
| 157 | pattern_type nBeg = needle.begin (); |
| 158 | pattern_type nEnd = needle.end (); |
| 159 | |
| 160 | ba::boyer_moore<pattern_type> bm_r = ba::make_boyer_moore ( r: needle ); |
| 161 | ba::boyer_moore<pattern_type> bm ( nBeg, nEnd ); |
| 162 | ba::boyer_moore_horspool<pattern_type> bmh ( nBeg, nEnd ); |
| 163 | ba::knuth_morris_pratt<pattern_type> kmp ( nBeg, nEnd ); |
| 164 | |
| 165 | iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd); |
| 166 | ret_type ret1 = bm (hBeg, hEnd); |
| 167 | ret_type ret1r = bm (haystack); |
| 168 | ret_type retr1 = bm_r (hBeg, hEnd); |
| 169 | ret_type retr1r = bm_r (haystack); |
| 170 | ret_type ret2 = bmh (hBeg, hEnd); |
| 171 | ret_type ret3 = kmp (hBeg, hEnd); |
| 172 | const std::ptrdiff_t dist = ret1.first == hEnd ? -1 : std::distance ( hBeg, ret1.first ); |
| 173 | |
| 174 | std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl; |
| 175 | try { |
| 176 | if ( it0 != ret1.first ) { |
| 177 | throw std::runtime_error ( |
| 178 | std::string ( "results mismatch between std::search and boyer-moore search" )); |
| 179 | } |
| 180 | |
| 181 | if ( ret1.first != ret1r.first || ret1.second != ret1r.second ) { |
| 182 | throw std::runtime_error ( |
| 183 | std::string ( "results mismatch between iterator and range boyer_moore search(1)" )); |
| 184 | } |
| 185 | |
| 186 | if ( ret1.first != retr1.first || ret1.second != retr1.second ) { |
| 187 | throw std::runtime_error ( |
| 188 | std::string ( "results mismatch between iterator and range boyer_moore search(2)" )); |
| 189 | } |
| 190 | |
| 191 | if ( ret1.first != retr1r.first || ret1.second != retr1r.second ) { |
| 192 | throw std::runtime_error ( |
| 193 | std::string ( "results mismatch between iterator and range boyer_moore search(3)" )); |
| 194 | } |
| 195 | |
| 196 | if ( ret1.first != ret2.first || ret1.second != ret2.second ) { |
| 197 | throw std::runtime_error ( |
| 198 | std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" )); |
| 199 | } |
| 200 | |
| 201 | if ( ret1.first != ret3.first || ret1.second != ret3.second ) { |
| 202 | throw std::runtime_error ( |
| 203 | std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" )); |
| 204 | } |
| 205 | |
| 206 | } |
| 207 | |
| 208 | catch ( ... ) { |
| 209 | std::cout << "Searching for: " << needle << std::endl; |
| 210 | std::cout << "Expected: " << expected << "\n" ; |
| 211 | std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n" ; |
| 212 | std::cout << " bm: " << std::distance ( hBeg, ret1.first ) << "\n" ; |
| 213 | std::cout << " bm(r1): " << std::distance ( hBeg, ret1r.first ) << "\n" ; |
| 214 | std::cout << " bm(r2): " << std::distance ( hBeg, retr1.first ) << "\n" ; |
| 215 | std::cout << " bm(r3): " << std::distance ( hBeg, retr1r.first ) << "\n" ; |
| 216 | std::cout << " bmh: " << std::distance ( hBeg, ret2.first ) << "\n" ; |
| 217 | std::cout << " kpm: " << std::distance ( hBeg, ret3.first )<< "\n" ; |
| 218 | std::cout << std::flush; |
| 219 | throw ; |
| 220 | } |
| 221 | |
| 222 | BOOST_CHECK_EQUAL ( dist, expected ); |
| 223 | } |
| 224 | |
| 225 | |
| 226 | template<typename Container> |
| 227 | void check_one ( const Container &haystack, const std::string &needle, std::ptrdiff_t expected ) { |
| 228 | check_one_iter ( haystack, needle, expected ); |
| 229 | check_one_pointer ( haystack, needle, expected ); |
| 230 | check_one_object ( haystack, needle, expected ); |
| 231 | } |
| 232 | } |
| 233 | |
| 234 | |
| 235 | BOOST_AUTO_TEST_CASE( test_main ) |
| 236 | { |
| 237 | std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" ); |
| 238 | std::string needle1 ( "ANPANMAN" ); |
| 239 | std::string needle2 ( "MAN THE" ); |
| 240 | std::string needle3 ( "WE\220ER" ); |
| 241 | std::string needle4 ( "NOW " ); // At the beginning |
| 242 | std::string needle5 ( "NEND" ); // At the end |
| 243 | std::string needle6 ( "NOT FOUND" ); // Nowhere |
| 244 | std::string needle7 ( "NOT FO\340ND" ); // Nowhere |
| 245 | |
| 246 | std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" ); |
| 247 | std::string needle11 ( "ABCDABD" ); |
| 248 | |
| 249 | std::string haystack3 ( "abra abracad abracadabra" ); |
| 250 | std::string needle12 ( "abracadabra" ); |
| 251 | |
| 252 | std::string needle13 ( "" ); |
| 253 | std::string haystack4 ( "" ); |
| 254 | |
| 255 | check_one ( haystack: haystack1, needle: needle1, expected: 26 ); |
| 256 | check_one ( haystack: haystack1, needle: needle2, expected: 18 ); |
| 257 | check_one ( haystack: haystack1, needle: needle3, expected: 9 ); |
| 258 | check_one ( haystack: haystack1, needle: needle4, expected: 0 ); |
| 259 | check_one ( haystack: haystack1, needle: needle5, expected: 33 ); |
| 260 | check_one ( haystack: haystack1, needle: needle6, expected: -1 ); |
| 261 | check_one ( haystack: haystack1, needle: needle7, expected: -1 ); |
| 262 | |
| 263 | check_one ( haystack: needle1, needle: haystack1, expected: -1 ); // cant find long pattern in short corpus |
| 264 | check_one ( haystack: haystack1, needle: haystack1, expected: 0 ); // find something in itself |
| 265 | check_one ( haystack: haystack2, needle: haystack2, expected: 0 ); // find something in itself |
| 266 | |
| 267 | check_one ( haystack: haystack2, needle: needle11, expected: 15 ); |
| 268 | check_one ( haystack: haystack3, needle: needle12, expected: 13 ); |
| 269 | |
| 270 | check_one ( haystack: haystack1, needle: needle13, expected: 0 ); // find the empty string |
| 271 | check_one ( haystack: haystack4, needle: needle1, expected: -1 ); // can't find in an empty haystack |
| 272 | |
| 273 | // Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test |
| 274 | // that triggered it. |
| 275 | |
| 276 | const std::string mikhail_pattern = |
| 277 | "GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA" |
| 278 | "TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG" |
| 279 | "CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT" |
| 280 | "TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG" |
| 281 | ; |
| 282 | const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern; |
| 283 | |
| 284 | check_one ( haystack: mikhail_corpus, needle: mikhail_pattern, expected: 8 ); |
| 285 | } |
| 286 | |