Added __examples__ to each codec for automated tests

dhondta · dhondta · commit 0b70b83bcaff · 2020-07-13T12:45:17.000+02:00
diff --git a/codext/base/ascii85.py b/codext/base/ascii85.py
@@ -14,6 +14,9 @@
 from ..__common__ import *
 
 
+__examples__ = {'enc(ascii85|ascii-85|ascii_85)': {'this is a test': "FD,B0+DGm>@3BZ'F*%"}}
+
+
 if PY3:
     def ascii85_encode(input, errors='strict'):
         return base64.a85encode(b(input)), len(input)
diff --git a/codext/crypto/bacon.py b/codext/crypto/bacon.py
@@ -12,6 +12,14 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(bacon|bacon_cipher|baconian-cipher|bacon-ab|bacon-AB)': {
+        'this is a test': "baaba aabbb abaaa baaab  abaaa baaab  aaaaa  baaba aabaa baaab baaba",
+    },
+    'enc(bacon-01)': {'this is a test': "10010 00111 01000 10001  01000 10001  00000  10010 00100 10001 10010"},
+}
+
+
 ENCMAP = {
     'A': "aaaaa", 'B': "aaaab", 'C': "aaaba", 'D': "aaabb", 'E': "aabaa", 'F': "aabab", 'G': "aabba", 'H': "aabbb",
     'I': "abaaa", 'J': "abaaa", 'K': "abaab", 'L': "ababa", 'M': "ababb", 'N': "abbaa", 'O': "abbab", 'P': "abbba",
@@ -20,5 +28,5 @@
 }
 
 
-add_map("bacon", ENCMAP, sep=" ", ignore_case="encode", pattern=r"bacon(?:(?:ian)?[-_]cipher)?([\-_].{2})?$")
+add_map("bacon", ENCMAP, sep=" ", ignore_case="both", pattern=r"bacon(?:(?:ian)?[-_]cipher)?([\-_].{2})?$")
 
diff --git a/codext/crypto/barbie.py b/codext/crypto/barbie.py
@@ -15,6 +15,16 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(barbie)':  None,
+    'enc(barbie1)': {'\r': None},
+    'enc(barbie1|barbie_1|barbie-1)': {'this is a test': "hstf tf i hafh"},
+    'enc(barbie2|barbie_2|barbie-2)': {'this is a test': "sfhp hp t sips"},
+    'enc(barbie3|barbie_3|barbie-3)': {'this is a test': "fpsu su h ftuf"},
+    'enc(barbie4|barbie_4|barbie-4)': {'this is a test': "pufq fq s phqp"},
+}
+
+
 STD = [
     "abcdefghijklmnopqrstuvABCDEFGHIJKLMNOPQRSTUVWXYZ0123456 \n\t",
     "icolapxstvybjeruknfhqg>FAUTCYOLVJDZINQKSEHG<.1PB5234067 \n\t",
diff --git a/codext/crypto/rot.py b/codext/crypto/rot.py
@@ -12,6 +12,13 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(rot0|rot--10|rot100)':               None,
+    'enc(rot1|rot-1|rot_1|ROT1|ROT-1|ROT_1)': {'this is a test': "uijt jt b uftu"},
+    'enc(rot3)':                              {'this is a test': "wklv lv d whvw"},
+}
+
+
 def _rotn(text, n=13):
     n = n % 26
     t = maketrans(LC + UC, LC[n:] + LC[:n] + UC[n:] + UC[:n])
diff --git a/codext/crypto/scytale.py b/codext/crypto/scytale.py
@@ -12,6 +12,13 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(scytale0|scytale--10|scytale01)': None,
+    'enc(scytale2|scytale-2|scytale_2)':   {'this is a test': "ti satshsi  et"},
+    'enc(scytale5|scytale-5|scytale_5)':   {'this is a test': "tithsei ssat  "},
+}
+
+
 PADDING_CHAR = ""
 
 
diff --git a/codext/crypto/shift.py b/codext/crypto/shift.py
@@ -10,6 +10,13 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(shift0|shift--10|shift256)': None,
+    'enc(shift1|SHIFT_1|shift-1)':    {'this is a test': "uijt!jt!b!uftu"},
+    'enc(shift9|shift_9|SHIFT-9)':    {'this is a test': "}qr|)r|)j)}n|}"},
+}
+
+
 def ord_shift_decode(i):
     return ord_shift_encode(-i)
 
@@ -21,6 +28,5 @@ def encode(text, errors="strict"):
     return encode
 
 
-add("shift", ord_shift_encode, ord_shift_decode,
-    r"(?i)(?:ord(?:inal)?[-_]?)?shift[-_]?([1-9]|[1-9][0-9]|1[0-9][0-9]|2[0-4][0-9]|25[0-5])$")
+add("shift", ord_shift_encode, ord_shift_decode, r"(?i)shift[-_]?([1-9]|[1-9][0-9]|1[0-9][0-9]|2[0-4][0-9]|25[0-5])$")
 
diff --git a/codext/crypto/xor.py b/codext/crypto/xor.py
@@ -10,6 +10,14 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(xor0|xor--10|xor256|xor300)': None,
+    'enc(xor3|xor-3|xor_3)':           {'this is a test': "wkjp#jp#b#wfpw"},
+    'enc(xor3|xor-3|xor_3)':           {'wkjp#jp#b#wfpw': "this is a test"},
+    'enc(XOR6|XOR-6|XOR_6)':           {'this is a test': "rnou&ou&g&rcur"},
+}
+
+
 def _xorn(text, n=1):
     return "".join(chr(ord(c) ^ (n % 256)) for c in text)
 
diff --git a/codext/languages/braille.py b/codext/languages/braille.py
@@ -10,6 +10,11 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(braille)': {'this is a test': "⠞⠓⠊⠎⠀⠊⠎⠀⠁⠀⠞⠑⠎⠞"},
+}
+
+
 ENCMAP = {
     # digits
     '0': '⠴', '1': '⠂', '2': '⠆', '3': '⠒', '4': '⠲', '5': '⠢', '6': '⠖', '7': '⠶', '8': '⠦', '9': '⠔',
diff --git a/codext/languages/morse.py b/codext/languages/morse.py
@@ -10,6 +10,13 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(morse|morse/-.)': {'this is a test': "- .... .. ... / .. ... / .- / - . ... -"},
+    'enc(morse-/AB)':      {'this is a test': "A BBBB BB BBB / BB BBB / BA / A B BBB A"},
+    'enc(morse-01)':       {'this is a test': "0 1111 11 111 - 11 111 - 10 - 0 1 111 0"},
+}
+
+
 ENCMAP = {
     # letters
     'a': ".-", 'b': "-...", 'c': "-.-.", 'd': "-..", 'e': ".", 'f': "..-.", 'g': "--.", 'h': "....",  'i': "..",
diff --git a/codext/languages/radio.py b/codext/languages/radio.py
@@ -10,6 +10,12 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(radio|military-alphabet)':      {'test':   "Tango Echo Sierra Tango"},
+    'enc(nato-alphabet|radio-phonetic)': {'string': "Sierra Tango Romeo India November Golf"},
+}
+
+
 ENCMAP = {
     'A': "Alpha", 'B': "Bravo", 'C': "Charlie", 'D': "Delta", 'E': "Echo", 'F': "Foxtrot", 'G': "Golf", 'H': "Hotel",
     'I': "India", 'J': "Juliett", 'K': "Kilo", 'L': "Lima", 'M': "Mike", 'N': "November", 'O': "Oscar", 'P': "Papa",
@@ -19,5 +25,5 @@
 
 
 add_map("radio", ENCMAP, sep=" ", ignore_case="both",
-        pattern=r"^(?:military|nato|radio)(?:[-_]phonetic)?[-_]alphabet?$")
+        pattern=r"^(?:military|nato|radio)(?:(?:[-_]phonetic)?(?:[-_]alphabet)?)?$")
 
diff --git a/codext/others/baudot.py b/codext/others/baudot.py
@@ -10,6 +10,42 @@
 from ..__common__ import *
 
 
+__examples1__ = {
+    'enc(baudot-BAD_ALPHABET)': None,
+    'enc(baudot_ccitt2_lsb)':   {'TEST 1234': "00001100001010000001001001101111101110011000001010"},
+    'enc(baudot-ita1)':         {'TEST 1234': "10101000101010010101100000100000001000100010000101"},
+    'enc(baudot_ita2_msb)':     {'TEST 1234': "10000000010010110000001001101110111100110000101010"},
+    'enc(baudot-ita2-us)':      {'TEST 1234': "10000000010010110000001001101110111100110000101010"},
+    'enc(baudot)':              {'abc': None},
+    'enc(baudot_ccitt1-lsb)':   {'TEST ': None},
+}
+__examples2__ = {
+    'enc(baudot_spaced-BAD_ALPHABET)': None,
+    'enc(baudot-spaced_ccitt2_lsb)':   {'TEST 1234': "00001 10000 10100 00001 00100 11011 11101 11001 10000 01010"},
+    'enc(baudot_spaced-ita1)':         {'TEST 1234': "10101 00010 10100 10101 10000 01000 00001 00010 00100 00101"},
+    'enc(baudot-spaced_ita2_msb)':     {'TEST 1234': "10000 00001 00101 10000 00100 11011 10111 10011 00001 01010"},
+    'enc(baudot_spaced-ita2-us)':      {'TEST 1234': "10000 00001 00101 10000 00100 11011 10111 10011 00001 01010"},
+}
+__examples3__ = {
+    'enc(baudot_tape-BAD_ALPHABET)': None,
+    'enc(baudot_tape-ita1)': {
+        'TEST 1234': "***.**\n* *. *\n   .* \n* *.  \n* *. *\n*  .  \n * .  \n   . *\n   .* \n  *.  \n  *. *",
+    },
+    'dec(baudot-tape_ita2)':       {'BAD_HEADER\n   .* \n': None},
+    'dec(baudot-tape_ita2-us)':    {'***.**\nBAD_TAPE\n': None},
+    'dec(baudot_tape-ccitt1_lsb)': {'***.**\n   .* \n*  . *\n*  .  \n': None},
+}
+if PY3:
+    __examples1__.update({
+        'enc(baudot_ccitt1_lsb)': {'TEST1234':  "101010001010001101010100000100000100000100101"},
+        'enc(baudot-fr)':         {'TEST 1234': "10101000101010010101100000100000001000100010000101"},
+    })
+    __examples2__.update({
+        'enc(baudot-spaced_ccitt1_lsb)': {'TEST1234':  "10101 00010 10001 10101 01000 00100 00010 00001 00101"},
+        'enc(baudot_spaced-fr)':         {'TEST 1234': "10101 00010 10100 10101 10000 01000 00001 00010 00100 00101"},
+    })
+
+
 PATTERN = r"^baudot%s([-_](?:ccitt1|ccitt2|eu|fr|ita1|ita2|ita2[-_](?:us" + (r"|meteo" if PY3 else r"") + r")" + \
           (r"|mtk2" if PY3 else r"") + r"|murray|uk|us_tty)(?:[-_](?:lsb|msb))?)?$"
 # reserved character
@@ -154,7 +190,7 @@ def baudot_encode(alphabet=None, spaced=False, tape=False):
     ename = "baudot" + ("-spaced" if spaced else "-tape" if tape else "")
     alphabet, states, func = _handle_alphabet(alphabet)
     def encode(text, errors="strict"):
-        s, state, seen_states = "", None, []
+        s, l, state, seen_states = "", len(text), None, []
         for i, c in enumerate(text):
             # if the state is undefined yet, find the relevant alphabet
             if state is None:
@@ -184,16 +220,16 @@ def encode(text, errors="strict"):
                     if state not in seen_states:
                         seen_states.append(state)
                 except KeyError as e:
-                    s += handle_error(ename, errors, BaudotEncodeError, "?", 5)(c, i)
                     state = list(set(states.keys()) - {state})[0]  # reset the state
+                    s += handle_error(ename, errors, BaudotEncodeError, "?", 5)(c, i)
         # by default, if no state is specified, the encoded string is handled as letters ; so if figures are used only,
         #  it is necessary to include the groups of bits for figures at the beginning of the encoded string
         s = (states['figures'] if seen_states == ["figures"] else "") + s
         if spaced:
             s = " ".join(s[i:i+5] for i in range(0, len(s), 5))
         elif tape:
             s = _bits_to_tape(s)
-        return s, len(s)
+        return s, l
     return encode
 
 
@@ -203,7 +239,7 @@ def baudot_decode(alphabet=None, spaced=False, tape=False):
     alphabet = {st: {v: k for k, v in alph.items()} for st, alph in alphabet.items()}
     states = {v: k for k, v in states.items()}
     def decode(text, errors="strict"):
-        s = ""
+        s, l = "", len(text)
         if spaced:
             text = text.replace(" ", "")
         elif tape:
@@ -239,19 +275,19 @@ def decode(text, errors="strict"):
                     state = states[bits]
                 else:
                     s += handle_error(ename, errors, BaudotDecodeError, decode=True, item="group")(bits, i//5)
-        return s, len(s)
+        return s, l
     return decode
 
 
-add("baudot", baudot_encode, baudot_decode, PATTERN % r"")
+add("baudot", baudot_encode, baudot_decode, PATTERN % r"", examples=__examples1__)
 
 
 baudot_spaced_encode = lambda a: baudot_encode(a, spaced=True)
 baudot_spaced_decode = lambda a: baudot_decode(a, spaced=True)
-add("baudot-spaced", baudot_spaced_encode, baudot_spaced_decode, PATTERN % r"[-_]spaced")
+add("baudot-spaced", baudot_spaced_encode, baudot_spaced_decode, PATTERN % r"[-_]spaced", examples=__examples2__)
 
 
 baudot_tape_encode = lambda a: baudot_encode(a, tape=True)
 baudot_tape_decode = lambda a: baudot_decode(a, tape=True)
-add("baudot-tape", baudot_tape_encode, baudot_tape_decode, PATTERN % r"[-_]tape")
+add("baudot-tape", baudot_tape_encode, baudot_tape_decode, PATTERN % r"[-_]tape", examples=__examples3__)
 
diff --git a/codext/others/dna.py b/codext/others/dna.py
@@ -13,6 +13,19 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(dna0|dna9)': None,
+    'enc(dna1)':      {'this is a test': "GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA"},
+    'enc(dna-2)':     {'this is a test': "CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA"},
+    'enc(dna_3)':     {'this is a test': "ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG"},
+    'enc(dna4)':      {'this is a test': "AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC"},
+    'enc(dna-5)':     {'this is a test': "TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG"},
+    'enc(dna_6)':     {'this is a test': "TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC"},
+    'enc(dna7)':      {'this is a test': "GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT"},
+    'enc(dna-8)':     {'this is a test': "CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT"},
+}
+
+
 SEQUENCES = {
     '00': "AAGCGCTT",
     '11': "TTCGCGAA",
diff --git a/codext/others/html.py b/codext/others/html.py
@@ -13,6 +13,18 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(html_entities|html-entity)': {'<This\tis\na test>': "&lt;This&Tab;is&NewLine;a test&gt;"},
+    'dec(html|html_entity)':          {'&DoesNotExist;': None},
+    'dec(html_entities|html-entity)': {
+        '&lt;This&Tab;is&NewLine;a test&gt;': "<This\tis\na test>",
+        '&lt;This&Tab;is&NewLine;a&nbsp;test&gt;': "<This\tis\na test>",
+    },
+}
+if PY3:
+    __examples__['enc(html)'] = {'\u1234': "&1234;"}
+
+
 # source: https://dev.w3.org/html5/html-author/charref
 ENCMAP = {
     '\t': "&Tab;", '\n': "&NewLine;", '!': "&excl;", '"': "&quot;", '#': "&num;", '$': "&dollar;", '%': "&percnt;",
@@ -248,11 +260,8 @@ def htmlentity_encode(text, errors="strict"):
             s += ENCMAP[c]
         except KeyError:
             i = ord(c)
-            if i > 0xff:
-                s += "&" + hex(i)[2:].zfill(0) + ";"
-            else:
-                s += c
-    return s, len(s)
+            s += "&" + hex(i)[2:].zfill(0) + ";" if i > 0xff else c
+    return s, len(text)
 
 
 def htmlentity_decode(text, errors="strict"):
@@ -262,10 +271,10 @@ def htmlentity_decode(text, errors="strict"):
         m = re.match(r"&(?:(?:[A-Za-z][A-Za-z0-9]{1,6}){1,4}|[0-9]{4});", text[i:i+30])
         if m:
             entity = m.group()
-            if entity[1:5].isdigit() and len(entity) == 6:
-                s += unichr(int(entity[1:5], 16))
-            elif entity == "&nbsp;":
-                s += " "
+            c = unichr(int(entity[1:5], 16)) if entity[1:5].isdigit() and len(entity) == 6 else \
+                " " if entity == "&nbsp;" else None
+            if c:
+                s += c
             else:
                 try:
                     s += DECMAP[entity]
@@ -275,7 +284,7 @@ def htmlentity_decode(text, errors="strict"):
         else:
             s += text[i]
             i += 1
-    return s, len(s)
+    return s, len(text)
 
 
 add("html", htmlentity_encode, htmlentity_decode, r"^html(?:[-_]?entit(?:y|ies))?$")
diff --git a/codext/others/octal.py b/codext/others/octal.py
@@ -10,12 +10,20 @@
 from ..__common__ import *
 
 
+__examples1__ = {
+    'enc(octal-spaced|octals_spaced)': {'this is a test': "164 150 151 163 40 151 163 40 141 40 164 145 163 164"},
+}
+__examples2__ = {
+    'enc(octal|octals)': {'this is a test': "164150151163040151163040141040164145163164"},
+}
+
+
 oct2 = lambda i: oct(i).lstrip("0").replace("o", "")
 
 ENCMAP1 = {chr(i): oct2(i) for i in range(256)}
 ENCMAP2 = {chr(i): oct2(i).zfill(3) for i in range(256)}
 
 
-add_map("octal-spaced", ENCMAP1, sep=" ", pattern=r"^octals?[-_]spaced$")
-add_map("octal", ENCMAP2, pattern=r"^octals?$")
+add_map("octal-spaced", ENCMAP1, sep=" ", pattern=r"^octals?[-_]spaced$", examples=__examples1__)
+add_map("octal", ENCMAP2, pattern=r"^octals?$", examples=__examples2__)
 
diff --git a/codext/others/ordinal.py b/codext/others/ordinal.py
@@ -10,10 +10,18 @@
 from ..__common__ import *
 
 
+__examples1__ = {
+    'enc(ordinal-spaced|ordinals_spaced)': {'this is a test': "116 104 105 115 32 105 115 32 97 32 116 101 115 116"},
+}
+__examples2__ = {
+    'enc(ordinal|ordinals)': {'this is a test': "116104105115032105115032097032116101115116"},
+}
+
+
 ENCMAP1 = {chr(i): str(i) for i in range(256)}
 ENCMAP2 = {chr(i): str(i).zfill(3) for i in range(256)}
 
 
-add_map("ordinal-spaced", ENCMAP1, sep=" ", pattern=r"^ordinals?[-_]spaced$")
-add_map("ordinal", ENCMAP2, pattern=r"^ordinals?$")
+add_map("ordinal-spaced", ENCMAP1, sep=" ", pattern=r"^ordinals?[-_]spaced$", examples=__examples1__)
+add_map("ordinal", ENCMAP2, pattern=r"^ordinals?$", examples=__examples2__)
 
diff --git a/codext/others/url.py b/codext/others/url.py
@@ -10,6 +10,12 @@
 from ..__common__ import *
 
 
+__examples__ = {
+    'enc(url|urlencode)': {'?=this/is-a_test/../': "%3F%3Dthis%2Fis-a_test%2F%2E%2E%2F"},
+    'dec(url|urlencode)': {'test/test%2etxt': "test/test.txt", 'test%2ftest.txt': "test/test.txt"}
+}
+
+
 SAFE = "ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789_-"
 ENCMAP = {}
 for i in range(256):
diff --git a/codext/stegano/leetspeak.py b/codext/stegano/leetspeak.py
diff --git a/codext/stegano/resistor.py b/codext/stegano/resistor.py
diff --git a/codext/stegano/sms.py b/codext/stegano/sms.py
diff --git a/codext/stegano/whitespace.py b/codext/stegano/whitespace.py
