From dad3a52b56a2c3c1cfaf68a6e3cb0787d3610ee6 Mon Sep 17 00:00:00 2001 From: Rak Laptudirm Date: Tue, 7 Jun 2022 23:39:33 +0530 Subject: [PATCH 001/156] chore: fix typo in filename (#947) --- greedy_approach/{djikstra.c => dijkstra.c} | 0 1 file changed, 0 insertions(+), 0 deletions(-) rename greedy_approach/{djikstra.c => dijkstra.c} (100%) diff --git a/greedy_approach/djikstra.c b/greedy_approach/dijkstra.c similarity index 100% rename from greedy_approach/djikstra.c rename to greedy_approach/dijkstra.c From b0a41bb38c67ddebb31d3fe06d11e171410c3379 Mon Sep 17 00:00:00 2001 From: David Leal Date: Wed, 7 Sep 2022 19:13:07 -0500 Subject: [PATCH 002/156] chore: update copyright notices to 2022 --- LICENSE | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/LICENSE b/LICENSE index 055562a218..ecc818272d 100644 --- a/LICENSE +++ b/LICENSE @@ -1,4 +1,4 @@ -Copyright (C) 2016-2021 TheAlgorithms and contributors +Copyright (C) 2016-2022 TheAlgorithms and contributors GNU GENERAL PUBLIC LICENSE Version 3, 29 June 2007 From 889931acc887f0b06e817dbe51743bee9c3167bb Mon Sep 17 00:00:00 2001 From: Shuangchi He <34329208+Yulv-git@users.noreply.github.com> Date: Tue, 27 Sep 2022 23:58:15 +0800 Subject: [PATCH 003/156] chore: fix various spelling typos (#945) --- client_server/tcp_full_duplex_client.c | 2 +- client_server/tcp_full_duplex_server.c | 2 +- data_structures/binary_trees/words_alphabetical.c | 4 ++-- data_structures/linked_list/circular_linked_list.c | 2 +- data_structures/linked_list/stack_using_linked_lists.c | 2 +- developer_tools/min_printf.h | 2 +- exercism/word_count/word_count.c | 4 ++-- graphics/spirograph.c | 2 +- machine_learning/kohonen_som_trace.c | 2 +- searching/floyd_cycle_detection_algorithm.c | 2 +- sorting/radix_sort_2.c | 2 +- 11 files changed, 13 insertions(+), 13 deletions(-) diff --git a/client_server/tcp_full_duplex_client.c b/client_server/tcp_full_duplex_client.c index 2fb2bb79eb..25c21b4684 100644 --- a/client_server/tcp_full_duplex_client.c +++ b/client_server/tcp_full_duplex_client.c @@ -10,7 +10,7 @@ * instead of the server only sending and the client only receiving data, * The server and client can both send and receive data simultaneously. This is * implemented by using the `fork` function call so that in the server the child - * process can recieve data and parent process can send data, and in the client + * process can receive data and parent process can send data, and in the client * the child process can send data and the parent process can receive data. It * runs an infinite loop and can send and receive messages indefinitely until * the user exits the loop. In this way, the Full Duplex Form of communication diff --git a/client_server/tcp_full_duplex_server.c b/client_server/tcp_full_duplex_server.c index 29a7ca302e..da3635c6d2 100644 --- a/client_server/tcp_full_duplex_server.c +++ b/client_server/tcp_full_duplex_server.c @@ -10,7 +10,7 @@ * instead of the server only sending and the client only receiving data, * The server and client can both send and receive data simultaneously. This is * implemented by using the `fork` function call so that in the server the child - * process can recieve data and parent process can send data, and in the client + * process can receive data and parent process can send data, and in the client * the child process can send data and the parent process can receive data. It * runs an infinite loop and can send and receive messages indefinitely until * the user exits the loop. In this way, the Full Duplex Form of communication diff --git a/data_structures/binary_trees/words_alphabetical.c b/data_structures/binary_trees/words_alphabetical.c index 1b0c42e551..46508f48c2 100644 --- a/data_structures/binary_trees/words_alphabetical.c +++ b/data_structures/binary_trees/words_alphabetical.c @@ -9,7 +9,7 @@ * where words are separated by a space, newline, or underscore. * This program prints (writes or outputs) to another file (`wordcount.txt`), * the individual words contained in 'file.txt' with their frequencies (number - * of occurences) each on a newline and in alphabetical order. This program uses + * of occurrences) each on a newline and in alphabetical order. This program uses * the binary tree data structure to accomplish this task. * @author [Randy Kwalar](https://github.com/RandyKdev) */ @@ -28,7 +28,7 @@ struct Node { char *word; ///< the word (value) of the node - uint64_t frequency; ///< number of occurences of the word + uint64_t frequency; ///< number of occurrences of the word struct Node *left; ///< pointer to the left child node struct Node *right; ///< pointer to the right child node }; diff --git a/data_structures/linked_list/circular_linked_list.c b/data_structures/linked_list/circular_linked_list.c index 7297217a25..6d923ae705 100644 --- a/data_structures/linked_list/circular_linked_list.c +++ b/data_structures/linked_list/circular_linked_list.c @@ -16,7 +16,7 @@ struct node *first=NULL ; struct node *last=NULL ; /* first and last are global variables and need not be passed to any function. Any changes made to variables first and last by any of the functions in the program will be reflected in the entire program */ -/* This function is responsible for creating the Circularly Linked List right from the BEGINING. */ +/* This function is responsible for creating the Circularly Linked List right from the BEGINNING. */ void create() { int i , n ; diff --git a/data_structures/linked_list/stack_using_linked_lists.c b/data_structures/linked_list/stack_using_linked_lists.c index bf16ec2fab..a3c473a72c 100644 --- a/data_structures/linked_list/stack_using_linked_lists.c +++ b/data_structures/linked_list/stack_using_linked_lists.c @@ -48,7 +48,7 @@ void push(struct node *p) temp->link = top; top = temp; - printf("Inserted succesfully.\n"); + printf("Inserted successfully.\n"); } void pop(struct node *p) { diff --git a/developer_tools/min_printf.h b/developer_tools/min_printf.h index 69dec7a61b..b58db13d26 100644 --- a/developer_tools/min_printf.h +++ b/developer_tools/min_printf.h @@ -159,7 +159,7 @@ void print_int_value(int n, int width, int precision) while (n > 0) { *s++ = n % 10 + '0'; // Converts last digit of number to character and store it in p - ++size; // Increment size variable as one more digit is occured + ++size; // Increment size variable as one more digit is occurred n /= 10; // Removes the last digit from the number n as we have successfully stored it in p } *s = '\0'; diff --git a/exercism/word_count/word_count.c b/exercism/word_count/word_count.c index 206a16dc6c..ac2ceea479 100644 --- a/exercism/word_count/word_count.c +++ b/exercism/word_count/word_count.c @@ -70,7 +70,7 @@ int word_count(const char *input_text, word_count_word_t *words) words->count = 0; - /* make sure none error is occured */ + /* make sure none error is occurred */ if (loop) { /* collects the last word up to the \0-character. and counts it.*/ @@ -88,4 +88,4 @@ int word_count(const char *input_text, word_count_word_t *words) /* returns the number of words or an error code */ return count_all; -} \ No newline at end of file +} diff --git a/graphics/spirograph.c b/graphics/spirograph.c index 2a4aebc15f..2615bf7d5b 100644 --- a/graphics/spirograph.c +++ b/graphics/spirograph.c @@ -131,7 +131,7 @@ static inline void glutBitmapString(void *font, char *string) * * @param x array containing absicca of points (must be pre-allocated) * @param y array containing ordinates of points (must be pre-allocated) - * @param N number of points in the the arrays + * @param N number of points in the arrays */ void display_graph(const double *x, const double *y, size_t N, double l, double k) diff --git a/machine_learning/kohonen_som_trace.c b/machine_learning/kohonen_som_trace.c index c893bd02d2..8ca54218ba 100644 --- a/machine_learning/kohonen_som_trace.c +++ b/machine_learning/kohonen_som_trace.c @@ -6,7 +6,7 @@ * \details * This example implements a powerful self organizing map algorithm. * The algorithm creates a connected network of weights that closely - * follows the given data points. This this creates a chain of nodes that + * follows the given data points. This creates a chain of nodes that * resembles the given input shape. * \author [Krishna Vedala](https://github.com/kvedala) * \see kohonen_som_topology.c diff --git a/searching/floyd_cycle_detection_algorithm.c b/searching/floyd_cycle_detection_algorithm.c index 44c48177f7..285a72c637 100644 --- a/searching/floyd_cycle_detection_algorithm.c +++ b/searching/floyd_cycle_detection_algorithm.c @@ -24,7 +24,7 @@ */ uint32_t duplicateNumber(const uint32_t *in_arr, size_t n) { - if (n <= 1) { // to find duplicate in an array its size should be atleast 2 + if (n <= 1) { // to find duplicate in an array its size should be at least 2 return -1; } uint32_t tortoise = in_arr[0]; ///< variable tortoise is used for the longer diff --git a/sorting/radix_sort_2.c b/sorting/radix_sort_2.c index 9d6cabb2f2..e527e92fba 100644 --- a/sorting/radix_sort_2.c +++ b/sorting/radix_sort_2.c @@ -22,7 +22,7 @@ void countSort(int *arr, int n, int place) int i, freq[range] = {0}; int *output = (int *)malloc(n * sizeof(int)); - // Store count of occurences in freq[] + // Store count of occurrences in freq[] for (i = 0; i < n; i++) freq[(arr[i] / place) % range]++; // Change freq[i] so that it contains the actual position of the digit in From 7e6276b730679b7e8c89d2d748b1ebce7e4a21b5 Mon Sep 17 00:00:00 2001 From: flyinghu <48802940+flyinghu123@users.noreply.github.com> Date: Fri, 30 Sep 2022 16:50:08 +0800 Subject: [PATCH 004/156] Return success status (#957) --- data_structures/array/carray.c | 1 + 1 file changed, 1 insertion(+) diff --git a/data_structures/array/carray.c b/data_structures/array/carray.c index 58840f41b6..7b812eb7ac 100644 --- a/data_structures/array/carray.c +++ b/data_structures/array/carray.c @@ -128,6 +128,7 @@ int switchValuesCArray(CArray *array, int position1, int position2) int temp = array->array[position1]; array->array[position1] = array->array[position2]; array->array[position2] = temp; + return SUCCESS; } return INVALID_POSITION; } From 6121ab5c20204cbbf14ee2b5d129b239168b0a3b Mon Sep 17 00:00:00 2001 From: GrandSir <69051988+GrandSir@users.noreply.github.com> Date: Fri, 30 Sep 2022 11:51:43 +0300 Subject: [PATCH 005/156] Create fibonacci_formula.c (#961) --- DIRECTORY.md | 3 +- misc/fibonacci_formula.c | 59 ++++++++++++++++++++++++++++++++++++++++ 2 files changed, 61 insertions(+), 1 deletion(-) create mode 100644 misc/fibonacci_formula.c diff --git a/DIRECTORY.md b/DIRECTORY.md index b5a7be6641..477ccf63e0 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -149,7 +149,7 @@ * [Spirograph](https://github.com/TheAlgorithms/C/blob/master/graphics/spirograph.c) ## Greedy Approach - * [Djikstra](https://github.com/TheAlgorithms/C/blob/master/greedy_approach/djikstra.c) + * [Dijkstra](https://github.com/TheAlgorithms/C/blob/master/greedy_approach/dijkstra.c) * [Prim](https://github.com/TheAlgorithms/C/blob/master/greedy_approach/prim.c) ## Hash @@ -267,6 +267,7 @@ * [Fibonacci](https://github.com/TheAlgorithms/C/blob/master/misc/fibonacci.c) * [Fibonacci Dp](https://github.com/TheAlgorithms/C/blob/master/misc/fibonacci_dp.c) * [Fibonacci Fast](https://github.com/TheAlgorithms/C/blob/master/misc/fibonacci_fast.c) + * [Fibonacci Formula](https://github.com/TheAlgorithms/C/blob/master/misc/fibonacci_formula.c) * [Gcd](https://github.com/TheAlgorithms/C/blob/master/misc/gcd.c) * [Is Armstrong](https://github.com/TheAlgorithms/C/blob/master/misc/is_armstrong.c) * [Large Factorials](https://github.com/TheAlgorithms/C/blob/master/misc/large_factorials.c) diff --git a/misc/fibonacci_formula.c b/misc/fibonacci_formula.c new file mode 100644 index 0000000000..cf86d0ed55 --- /dev/null +++ b/misc/fibonacci_formula.c @@ -0,0 +1,59 @@ +/** + * @file + * @brief Finding Fibonacci number of any `n` number using [Binet's closed form formula](https://en.wikipedia.org/wiki/Fibonacci_number#Binet's_formula) + * compute \f$f_{nth}\f$ Fibonacci number using the binet's formula: + * Fn = 1√5 * (1+√5 / 2)^n+1 − 1√5 * (1−√5 / 2)^n+1 + * @author [GrandSir](https://github.com/GrandSir/) + */ + +#include /// for pow and sqrt +#include /// for printf +#include /// for assert + +/** + * @param n index of number in Fibonacci sequence + * @returns nth value of fibonacci sequence for all n >= 0 + */ +int fib(unsigned int n) { + float seq = (1 / sqrt(5) * pow(((1 + sqrt(5)) / 2), n + 1)) - (1 / sqrt(5) * pow(((1 - sqrt(5)) / 2), n + 1)); + + // removing unnecessary fractional part by implicitly converting float to int + return seq; +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test () { + /* this ensures that the first 10 number of fibonacci sequence + * (1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89) + * matches with algorithm + */ + assert(fib(0) == 1); + assert(fib(1) == 1); + assert(fib(2) == 2); + assert(fib(3) == 3); + assert(fib(4) == 5); + assert(fib(5) == 8); + assert(fib(6) == 13); + assert(fib(7) == 21); + assert(fib(8) == 34); + assert(fib(9) == 55); + assert(fib(10) == 89); + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() { + test(); // run self-test implementations + + for(int i = 0; i <= 10; i++){ + printf("%d. fibonacci number is: %d\n", i, fib(i)); + } + return 0; +} From 52d3b3ee4da8cedaa87f8e45083d995ad8a8aa81 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 30 Sep 2022 11:56:31 -0500 Subject: [PATCH 006/156] docs: improve the contributing guidelines (#966) * docs: improve the contributing guidelines * updating DIRECTORY.md Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> --- CONTRIBUTING.md | 23 +++++++++++++---------- 1 file changed, 13 insertions(+), 10 deletions(-) diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index aeb000ca8a..56f7d99068 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -2,7 +2,7 @@ ## Before contributing -Welcome to [TheAlgorithms/C](https://github.com/TheAlgorithms/C)! Before submitting pull requests, please make sure that you have **read the whole guidelines**. If you have any doubts about this contribution guide, please open [an issue](https://github.com/TheAlgorithms/C/issues/new/choose) or ask in our [Discord server](https://discord.gg/c7MnfGFGa6), and clearly state your concerns. +Welcome to [TheAlgorithms/C](https://github.com/TheAlgorithms/C)! Before submitting pull requests, please make sure that you have **read the whole guidelines**. If you have any doubts about this contribution guide, please open [an issue](https://github.com/TheAlgorithms/C/issues/new/choose) or ask on our [Discord server](https://discord.gg/c7MnfGFGa6), and clearly state your concerns. ## Contributing @@ -15,13 +15,13 @@ Welcome to [TheAlgorithms/C](https://github.com/TheAlgorithms/C)! Before submitt Being a contributor at The Algorithms, we request you to follow the points mentioned below: - You did your own work. - - No plagiarism allowed. Any plagiarized work will not be merged. + - No plagiarism is allowed. Any plagiarized work will not be merged. - Your work will be distributed under the [GNU General Public License v3.0](https://github.com/TheAlgorithms/C/blob/master/LICENSE) once your pull request has been merged. - Please follow the repository guidelines and standards mentioned below. **New implementation** New implementations are welcome! -You can add new algorithms or data structures which are **not present in the repository** or that can **improve** the old implementations (**documentation**, **improving test cases**, removing bugs or in any other resonable sense) +You can add new algorithms or data structures that are **not present in the repository** or that can **improve** the old implementations (**documentation**, **improving test cases**, removing bugs, or in any other reasonable sense) **Issues** Please avoid opening issues asking to be "assigned” to a particular algorithm. This merely creates unnecessary noise for maintainers. Instead, please submit your implementation in a pull request, and it will be evaluated by project maintainers. @@ -36,8 +36,8 @@ You can add new algorithms or data structures which are **not present in the rep - You can suggest reasonable changes to existing algorithms. - Strictly use snake_case (underscore_separated) in filenames. - If you have added or modified code, please make sure the code compiles before submitting. -- Our automated testing runs [__CMake__](https://cmake.org/) on all the pull requests, so please be sure that your code passes before submitting. -- Please conform to [Doxygen](https://www.doxygen.nl/manual/docblocks.html) standard and document the code as much as possible. This not only facilitates the readers but also generates the correct info on website. +- Our automated testing runs [**CMake**](https://cmake.org/) on all the pull requests, so please be sure that your code passes before submitting. +- Please conform to [Doxygen](https://www.doxygen.nl/manual/docblocks.html) standards and document the code as much as possible. This not only facilitates the readers but also generates the correct info on the website. - **Be consistent in the use of these guidelines.** #### Documentation @@ -59,7 +59,8 @@ You can add new algorithms or data structures which are **not present in the rep ```c /** * @file - * @brief Add one line description here + * @brief Add one line description here. Should contain a Wikipedia + * link or another source explaining the algorithm/implementation. * @details * This is a multi-line * description containing links, references, @@ -129,7 +130,7 @@ my_new_c_struct.c is correct format - It will be used to dynamically create a directory of files and implementation. - File name validation will run on Docker to ensure validity. -- If an implementation of the algorithm already exists and your version is different from that implemented, please use incremental numeric digit as a suffix. For example: if `median_search.c` already exists in the `search` folder, and you are contributing a new implementation, the filename should be `median_search2.c` and for a third implementation, `median_search3.c`. +- If an implementation of the algorithm already exists and your version is different from that implemented, please use an incremental numeric digit as a suffix. For example: if `median_search.c` already exists in the `search` folder, and you are contributing a new implementation, the filename should be `median_search2.c`. For a third implementation, `median_search3.c`, and so on. #### Directory guidelines @@ -161,6 +162,7 @@ fix: xyz algorithm bug feat: add xyx algorithm, struct xyz test: add test for xyz algorithm docs: add comments and explanation to xyz algorithm +chore: update Gitpod badge ``` Common prefixes: @@ -169,6 +171,7 @@ Common prefixes: - feat: A new feature - docs: Documentation changes - test: Correct existing tests or add new ones +- chore: Miscellaneous changes that do not match any of the above. ### Pull Requests @@ -184,7 +187,7 @@ cmake -B build -S . #### Static Code Analyzer -We use [clang-tidy](https://clang.llvm.org/extra/clang-tidy/) as a static code analyzer with a configuration in [.clang-tidy](.clang-tidy). +We use [`clang-tidy`](https://clang.llvm.org/extra/clang-tidy/) as a static code analyzer with a configuration in [`.clang-tidy`](.clang-tidy). ```bash clang-tidy --fix --quiet -p build subfolder/file_to_check.c -- @@ -192,7 +195,7 @@ clang-tidy --fix --quiet -p build subfolder/file_to_check.c -- #### Code Formatter -[__clang-format__](https://clang.llvm.org/docs/ClangFormat.html) is used for code forrmating. +[**`clang-format`**](https://clang.llvm.org/docs/ClangFormat.html) is used for code formatting. - Installation (only needs to be installed once.) - Mac (using home-brew): `brew install clang-format` @@ -204,7 +207,7 @@ clang-tidy --fix --quiet -p build subfolder/file_to_check.c -- #### GitHub Actions - Enable GitHub Actions on your fork of the repository. -After enabling, it will execute `clang-tidy` and `clang-format` after every a push (not a commit). +After enabling, it will execute `clang-tidy` and `clang-format` after every push (not a commit). - Click on the tab "Actions", then click on the big green button to enable it. ![GitHub Actions](https://user-images.githubusercontent.com/51391473/94609466-6e925100-0264-11eb-9d6f-3706190eab2b.png) From 82ca460a9cc6c450e2cbdbfbef07d2d609d4ab96 Mon Sep 17 00:00:00 2001 From: Adhiraj Date: Wed, 5 Oct 2022 23:01:51 +0530 Subject: [PATCH 007/156] feat: add LeetCode problem 118 (#996) * added 118 to list * added 118.c --- leetcode/README.md | 1 + leetcode/src/118.c | 26 ++++++++++++++++++++++++++ 2 files changed, 27 insertions(+) create mode 100644 leetcode/src/118.c diff --git a/leetcode/README.md b/leetcode/README.md index 0cd07e3d96..cdb81b469a 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -37,6 +37,7 @@ LeetCode |109|[Convert Sorted List to Binary Search Tree](https://leetcode.com/problems/convert-sorted-list-to-binary-search-tree/) | [C](./src/109.c)|Medium| |110|[Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree/) | [C](./src/110.c)|Easy| |112|[Path Sum](https://leetcode.com/problems/path-sum/) | [C](./src/112.c)|Easy| +|118|[Pascal's Triangle](https://leetcode.com/problems/pascals-triangle/) | [C](./src/118.c)|Easy| |121|[Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock/) | [C](./src/121.c)|Easy| |125|[Valid Palindrome](https://leetcode.com/problems/valid-palindrome/) | [C](./src/125.c)|Easy| |136|[Single Number](https://leetcode.com/problems/single-number/) | [C](./src/136.c)|Easy| diff --git a/leetcode/src/118.c b/leetcode/src/118.c new file mode 100644 index 0000000000..a926efdcb1 --- /dev/null +++ b/leetcode/src/118.c @@ -0,0 +1,26 @@ +/** + * Return an array of arrays of size *returnSize. + * The sizes of the arrays are returned as *returnColumnSizes array. + * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free(). + */ +int** generate(int numRows, int* returnSize, int** returnColumnSizes){ + *returnSize = numRows; + int **ans = (int**)malloc(numRows*sizeof(int*)); + *returnColumnSizes = (int*)malloc(numRows*sizeof(int)); + + for (int i=0; i Date: Sun, 9 Oct 2022 00:02:15 -0700 Subject: [PATCH 008/156] feat: leetcode Maximum Twin Sum of a Linked List solution (2130) (#988) --- leetcode/README.md | 1 + leetcode/src/2130.c | 30 ++++++++++++++++++++++++++++++ 2 files changed, 31 insertions(+) create mode 100644 leetcode/src/2130.c diff --git a/leetcode/README.md b/leetcode/README.md index cdb81b469a..b20037394d 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -93,3 +93,4 @@ LeetCode |1184|[Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c)|Easy| |1189|[Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c)|Easy| |1207|[Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c)|Easy| +|2130|[Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c)|Medium| diff --git a/leetcode/src/2130.c b/leetcode/src/2130.c new file mode 100644 index 0000000000..6dbacc1d20 --- /dev/null +++ b/leetcode/src/2130.c @@ -0,0 +1,30 @@ +/** + * Definition for singly-linked list. + * struct ListNode { + * int val; + * struct ListNode *next; + * }; + */ + +int pairSum(struct ListNode* head) +{ + struct ListNode* dup = head; + int count = 0, i = 0, max = 0; + while (head != NULL) + { + count++; + head = head->next; + } + int* arr = malloc(count * sizeof(int)); + while (dup != NULL) + { + arr[i++] = dup->val; + dup = dup->next; + } + for (i = 0; i < count / 2; ++i) + { + if (arr[i] + arr[count - i - 1] > max) + max = arr[i] + arr[count - i - 1]; + } + return max; +} From f8e43ac88f90f1b011b3ec3c15d3af0c5a20325e Mon Sep 17 00:00:00 2001 From: serturx Date: Sun, 2 Oct 2022 17:50:34 +0200 Subject: [PATCH 009/156] Add run length encoding --- misc/run_length_encoding | Bin 0 -> 16472 bytes misc/run_length_encoding.c | 75 +++++++++++++++++++++++++++++++++++++ 2 files changed, 75 insertions(+) create mode 100755 misc/run_length_encoding create mode 100644 misc/run_length_encoding.c diff --git a/misc/run_length_encoding b/misc/run_length_encoding new file mode 100755 index 0000000000000000000000000000000000000000..b3229343ac1b7b04a606aad1bdd9d6e3109431e6 GIT binary patch literal 16472 zcmeHO4Qw366`r#bFeQndkU)M4xw;8TN^{92CJE4h6K9h(a(-~^(o}`@-rd@FaDTbm ziyZ{5k%7iFmK>?HR4r0KNJOPoQ>j7$g1C@02@(ZIR453wO`@i?%TJ9d)U+kn_h#N( z?=5!)Ra8~08*A^)``+)q{qgMX%(t|bO;tXh;8rbe6v*|?R7fKU9$rfwAdO19eky{?$si*bcJ;E=4S{Sbuu`UgdHG?((`NJ5 zb^&hkh*23uRj=aNAIfHv9Q8A`wc)cr9q;N~_ttY$zS_~!c6ipSsDpW<4eDS+f0Ux+ zv0n=t>Zp3$D{;iIow8m|s9xz`4d7WNM2pMdH(gTKrnrkW3QGSKDgads>=9q&|k6ZVUJ--FY*T0B5} zZhq_%^t?}*3%+mi{i=fwS`Xb98TS)j)2Iv?Xa4j}3dd`Pb3^2e3&-n^+lULlltG|l zE_{XypK#%PEuwfY;TJ<6&lPS%E}ZWfD0|q2)4wEXvfqWP>t1;};KDHmw}UR6Yk{&u zE*uK&w7d)doP!E+(uGfR;lnN*4rrxSDp09Fr2>@-R4P!Z!2eJM-mAUpZ+hQbHTuBR z*Ov>S-=DXu3d4Hev6`cDFACST0z6(=yaPz>LV@~Gl#Gv_EffkvlE;C~_~(2S3o4vzzw@zGnD zhitEu*=`gvU*I1JVD^*zLmqz6!{6`W@A2?C51;VxmWRL1!?(Nn;M>jpr*7B#&*^=? zAKTuh1@pld^}%%yLD>p(R)OYUIs>%}?}MF$12nj9Cm{OZ)K(#zqTI9(hGY3n11A)oAe_S)w=Jve(Hif8yuX6*A3{Prf{ZH)`{)$ z`1Ysp|M=ABfcM=7woZJsAMFMqcG|%X zPPPuc|DFR8ePGJsCDNBR5zOlY+5x@)#K_&?tY15MLOTp1!DuI-x-X9kPhz)U8$O}s zQDgKa_&K2+!~TGl*Tcio#y4F1l-R31`{tBB?U-+%JwE_sxJbHId)7V&aNmf}r{xFQ zkLiQj8GUg2I1F?3{+A)vA#^%&GX_Kv1pn{)G z`(GIuLNQrBj+UtD8}8Q*OAE{tEMBO6N_%#1RUe4@w7d^?;s)(x?So68W^T3NxG(R+{tsmi+G%~D9UY$5`(HzN5yI#n`V;?r<=-14aWw)n}_(A8zqpkx} z2dC8s@U(+QEvn8F;ABD{oby)+OV{(j3{I6LpnSy)R6gA?N z=y4bJ2d7ra`kokhQzgy;7D!kII0T9m;Hl{yP^SVsN}}%+2T;dV z2Do)HKsyC!QUMk_0p24o3tRzy_IJ4BO;${uABW}nG4+DdSJ-QyD0{aZ1;1Efd5?AO zssL76r2>@-R4P!ZK&1ke3REgksX(Oy|Ah+hmzu>9VX77ig-kOHEn;<=W+Wrln5#l7 z&4zF=610MyD@~vok;x?u_#D+`M-3|(PDNtLu0R;_|AP90wZyiv_Lu$jrEKe$f?hlp zxg)wemX72y*6xrM%Y?dOY0He7>6Dd=cALO-=F;6UE7cjovIOJ77zDl}7!B@*UK;wj zU{chmU2GR#U4SWpxDd0l8&^a_u-v6<1a_1pl z)XqW6bmw--zg&*0|Cx|z7yMazPnn5ucywpVA{nsLm)#O=ZG8vUst2T#*5{r#zoL= zfUOZ?9z=Xb-KH6HZ?3(xyQWv%H2?Z9ty)x%Fxr0uwv(VI4H1NfxD6ZTydNkxjP)RF zLCE zDp09Fr2>@-R4P!Z!2eqXc>WsCSEJ#roFj+(I*oUj2BYwKLbk{pMduOE^Wqi|&tu2= z#Pj?(9Is+y`TG|NDdZ1U<1fvL2KqIcY{qlTPLrJHf}NAvLcsSC+2#_Zw1`vlRgp>4 z{4o3!jBQL2Ij+Vo&sD?uoY*=DV0=F%!g=SV7Ca*m<@i?-&wB9TMeZNeRYLG_M)Dox z55B6gTw1~~UGmqH{6pet_sRQbM|d8$*W(I0-i<`J6YU_HCfZAMi0FQz2Z`p1di{SA z&+{ZVH#J@FU(z1RCGDI)7!0fotXLMjE+_fmQbPWPGd!QCh<6KK6+CV}kUU6*^^?M7 zKuhW4ajg<{;vlUhyi|$Ye5W6Hy3p-sJ_36xIXKvH}PCq;&!KUN^m`Slx=4 zwkc$RXn8`h+_OZ%5jMb1xz<5AxJnwGs`Urx6qZAH(9AKK7p6q8Foq z?4E>ehC~2%QPC*(V0nj?NsB--Wm|!+WG;}-q|&fvWRD99~XBm_WV4+v=@sD4RgdU?>~>rV}RjMkL~&S zg6TPsxf{82Ap9$Io$Ml;Z$FV>2JpO0eNcP_R2^NFU!J4u?KaViY zlOo6W?*I46ego-sU?6Br#}q5j9&6^ce-tpR3Hx{cU()|ge(nPm*}TX9M}WHR{ba}V zAlWe?u@mMAkNq$yFlGI6_UPXo{|p&0-Oq+Z*&oxVJ@&jFndw=2j$k)z$NcjidmcA3 z<>zYF_tx*1WY5Q6_(_xK?T$d_WYdGLjy(DL*Lk#XNu1oc<%CH;^!1z*Uame z>9TO_`8Ylawpc&5=l2Qeae|=^10(yT}uvo>4dowg!oL!`SAT0pSL-8xBa08#XawF W&T&~6AFoT +#include +#include +#include + +/** + * @brief Encodes a null-terminated string using run-length encoding + * @param str String to encode + * @return char* Encoded string + */ + +char* run_length_encode(char* str) { + int str_length = strlen(str); + int encoded_index = 0; + + //allocate space for worst-case scenario + char* encoded = malloc(2 * strlen(str)); + + //temp space for int to str conversion + char int_str[20]; + + for(int i = 0; i < str_length; ++i) { + int count = 0; + char current = str[i]; + + //count occurences + while(current == str[i + count]) count++; + + i += count - 1; + + //convert occurrence amount to string and write to encoded string + sprintf(int_str, "%d", count); + int int_str_length = strlen(int_str); + strncpy(&encoded[encoded_index], int_str, strlen(int_str)); + + //write current char to encoded string + encoded_index += strlen(int_str); + encoded[encoded_index] = current; + ++encoded_index; + } + + //null terminate string and move encoded string to compacted memory space + encoded[encoded_index] = '\0'; + char* compacted_string = malloc(strlen(encoded) + 1); + strcpy(compacted_string, encoded); + + free(encoded); + + return compacted_string; +} + +void test() { + char* test; + test = run_length_encode("aaaaaaabbbaaccccdefaadr"); + assert(!strcmp(test, "7a3b2a4c1d1e1f2a1d1r")); + free(test); + test = run_length_encode("lidjhvipdurevbeirbgipeahapoeuhwaipefupwieofb"); + assert(!strcmp(test, "1l1i1d1j1h1v1i1p1d1u1r1e1v1b1e1i1r1b1g1i1p1e1a1h1a1p1o1e1u1h1w1a1i1p1e1f1u1p1w1i1e1o1f1bq")); + free(test); + test = run_length_encode("htuuuurwuquququuuaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaahghghrw"); + assert(!strcmp(test, "1h1t4u1r1w1u1q1u1q1u1q3u76a1h1g1h1g1h1r1w")); + free(test); +} + +int main() { + test(); + printf("Tests passed."); + return 0; +} \ No newline at end of file From 597dc1972b6e8562dbb01e9caf1162de89f89964 Mon Sep 17 00:00:00 2001 From: serturx <56551721+serturx@users.noreply.github.com> Date: Mon, 3 Oct 2022 10:23:38 +0200 Subject: [PATCH 010/156] Apply suggestions from code review Co-authored-by: David Leal --- misc/run_length_encoding.c | 18 +++++++++++++----- 1 file changed, 13 insertions(+), 5 deletions(-) diff --git a/misc/run_length_encoding.c b/misc/run_length_encoding.c index ff82667f3d..9857f499f7 100644 --- a/misc/run_length_encoding.c +++ b/misc/run_length_encoding.c @@ -1,5 +1,5 @@ /** - * @file run_length_encoding.c + * @file * @author [serturx](https://github.com/serturx/) * @brief Encode a null terminated string using [Run-length encoding](https://en.wikipedia.org/wiki/Run-length_encoding) */ @@ -55,7 +55,11 @@ char* run_length_encode(char* str) { return compacted_string; } -void test() { +/** + * @brief Self-test implementations + * @returns void + */ +static void test() { char* test; test = run_length_encode("aaaaaaabbbaaccccdefaadr"); assert(!strcmp(test, "7a3b2a4c1d1e1f2a1d1r")); @@ -68,8 +72,12 @@ void test() { free(test); } +/** + * @brief Main function + * @returns 0 on exit + */ int main() { - test(); - printf("Tests passed."); + test(); // run self-test implementations + printf("All tests have passed!\n"); return 0; -} \ No newline at end of file +} From 45f09db995676b3fd77c1b776f28464f8ef23004 Mon Sep 17 00:00:00 2001 From: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> Date: Mon, 3 Oct 2022 08:24:14 +0000 Subject: [PATCH 011/156] updating DIRECTORY.md --- DIRECTORY.md | 1 + 1 file changed, 1 insertion(+) diff --git a/DIRECTORY.md b/DIRECTORY.md index 477ccf63e0..fa52f96f7a 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -285,6 +285,7 @@ * [Prime Seive](https://github.com/TheAlgorithms/C/blob/master/misc/prime_seive.c) * [Quartile](https://github.com/TheAlgorithms/C/blob/master/misc/quartile.c) * [Rselect](https://github.com/TheAlgorithms/C/blob/master/misc/rselect.c) + * [Run Length Encoding](https://github.com/TheAlgorithms/C/blob/master/misc/run_length_encoding.c) * [Strong Number](https://github.com/TheAlgorithms/C/blob/master/misc/strong_number.c) * [Sudoku Solver](https://github.com/TheAlgorithms/C/blob/master/misc/sudoku_solver.c) * [Tower Of Hanoi](https://github.com/TheAlgorithms/C/blob/master/misc/tower_of_hanoi.c) From 35f6431f4790c4478e7ea2439f32938fee507b09 Mon Sep 17 00:00:00 2001 From: serturx Date: Mon, 3 Oct 2022 10:24:21 +0200 Subject: [PATCH 012/156] Add algoritm description --- misc/run_length_encoding | Bin 16472 -> 0 bytes misc/run_length_encoding.c | 17 +++++++++++++---- 2 files changed, 13 insertions(+), 4 deletions(-) delete mode 100755 misc/run_length_encoding diff --git a/misc/run_length_encoding b/misc/run_length_encoding deleted file mode 100755 index b3229343ac1b7b04a606aad1bdd9d6e3109431e6..0000000000000000000000000000000000000000 GIT binary patch literal 0 HcmV?d00001 literal 16472 zcmeHO4Qw366`r#bFeQndkU)M4xw;8TN^{92CJE4h6K9h(a(-~^(o}`@-rd@FaDTbm ziyZ{5k%7iFmK>?HR4r0KNJOPoQ>j7$g1C@02@(ZIR453wO`@i?%TJ9d)U+kn_h#N( z?=5!)Ra8~08*A^)``+)q{qgMX%(t|bO;tXh;8rbe6v*|?R7fKU9$rfwAdO19eky{?$si*bcJ;E=4S{Sbuu`UgdHG?((`NJ5 zb^&hkh*23uRj=aNAIfHv9Q8A`wc)cr9q;N~_ttY$zS_~!c6ipSsDpW<4eDS+f0Ux+ zv0n=t>Zp3$D{;iIow8m|s9xz`4d7WNM2pMdH(gTKrnrkW3QGSKDgads>=9q&|k6ZVUJ--FY*T0B5} zZhq_%^t?}*3%+mi{i=fwS`Xb98TS)j)2Iv?Xa4j}3dd`Pb3^2e3&-n^+lULlltG|l zE_{XypK#%PEuwfY;TJ<6&lPS%E}ZWfD0|q2)4wEXvfqWP>t1;};KDHmw}UR6Yk{&u zE*uK&w7d)doP!E+(uGfR;lnN*4rrxSDp09Fr2>@-R4P!Z!2eJM-mAUpZ+hQbHTuBR z*Ov>S-=DXu3d4Hev6`cDFACST0z6(=yaPz>LV@~Gl#Gv_EffkvlE;C~_~(2S3o4vzzw@zGnD zhitEu*=`gvU*I1JVD^*zLmqz6!{6`W@A2?C51;VxmWRL1!?(Nn;M>jpr*7B#&*^=? zAKTuh1@pld^}%%yLD>p(R)OYUIs>%}?}MF$12nj9Cm{OZ)K(#zqTI9(hGY3n11A)oAe_S)w=Jve(Hif8yuX6*A3{Prf{ZH)`{)$ z`1Ysp|M=ABfcM=7woZJsAMFMqcG|%X zPPPuc|DFR8ePGJsCDNBR5zOlY+5x@)#K_&?tY15MLOTp1!DuI-x-X9kPhz)U8$O}s zQDgKa_&K2+!~TGl*Tcio#y4F1l-R31`{tBB?U-+%JwE_sxJbHId)7V&aNmf}r{xFQ zkLiQj8GUg2I1F?3{+A)vA#^%&GX_Kv1pn{)G z`(GIuLNQrBj+UtD8}8Q*OAE{tEMBO6N_%#1RUe4@w7d^?;s)(x?So68W^T3NxG(R+{tsmi+G%~D9UY$5`(HzN5yI#n`V;?r<=-14aWw)n}_(A8zqpkx} z2dC8s@U(+QEvn8F;ABD{oby)+OV{(j3{I6LpnSy)R6gA?N z=y4bJ2d7ra`kokhQzgy;7D!kII0T9m;Hl{yP^SVsN}}%+2T;dV z2Do)HKsyC!QUMk_0p24o3tRzy_IJ4BO;${uABW}nG4+DdSJ-QyD0{aZ1;1Efd5?AO zssL76r2>@-R4P!ZK&1ke3REgksX(Oy|Ah+hmzu>9VX77ig-kOHEn;<=W+Wrln5#l7 z&4zF=610MyD@~vok;x?u_#D+`M-3|(PDNtLu0R;_|AP90wZyiv_Lu$jrEKe$f?hlp zxg)wemX72y*6xrM%Y?dOY0He7>6Dd=cALO-=F;6UE7cjovIOJ77zDl}7!B@*UK;wj zU{chmU2GR#U4SWpxDd0l8&^a_u-v6<1a_1pl z)XqW6bmw--zg&*0|Cx|z7yMazPnn5ucywpVA{nsLm)#O=ZG8vUst2T#*5{r#zoL= zfUOZ?9z=Xb-KH6HZ?3(xyQWv%H2?Z9ty)x%Fxr0uwv(VI4H1NfxD6ZTydNkxjP)RF zLCE zDp09Fr2>@-R4P!Z!2eqXc>WsCSEJ#roFj+(I*oUj2BYwKLbk{pMduOE^Wqi|&tu2= z#Pj?(9Is+y`TG|NDdZ1U<1fvL2KqIcY{qlTPLrJHf}NAvLcsSC+2#_Zw1`vlRgp>4 z{4o3!jBQL2Ij+Vo&sD?uoY*=DV0=F%!g=SV7Ca*m<@i?-&wB9TMeZNeRYLG_M)Dox z55B6gTw1~~UGmqH{6pet_sRQbM|d8$*W(I0-i<`J6YU_HCfZAMi0FQz2Z`p1di{SA z&+{ZVH#J@FU(z1RCGDI)7!0fotXLMjE+_fmQbPWPGd!QCh<6KK6+CV}kUU6*^^?M7 zKuhW4ajg<{;vlUhyi|$Ye5W6Hy3p-sJ_36xIXKvH}PCq;&!KUN^m`Slx=4 zwkc$RXn8`h+_OZ%5jMb1xz<5AxJnwGs`Urx6qZAH(9AKK7p6q8Foq z?4E>ehC~2%QPC*(V0nj?NsB--Wm|!+WG;}-q|&fvWRD99~XBm_WV4+v=@sD4RgdU?>~>rV}RjMkL~&S zg6TPsxf{82Ap9$Io$Ml;Z$FV>2JpO0eNcP_R2^NFU!J4u?KaViY zlOo6W?*I46ego-sU?6Br#}q5j9&6^ce-tpR3Hx{cU()|ge(nPm*}TX9M}WHR{ba}V zAlWe?u@mMAkNq$yFlGI6_UPXo{|p&0-Oq+Z*&oxVJ@&jFndw=2j$k)z$NcjidmcA3 z<>zYF_tx*1WY5Q6_(_xK?T$d_WYdGLjy(DL*Lk#XNu1oc<%CH;^!1z*Uame z>9TO_`8Ylawpc&5=l2Qeae|=^10(yT}uvo>4dowg!oL!`SAT0pSL-8xBa08#XawF W&T&~6AFoT -#include -#include -#include +#include //For printf +#include //For string functions like strlen +#include //For malloc/free +#include //For assert /** * @brief Encodes a null-terminated string using run-length encoding From bd1b0ebcb9ee5fa4f75303f19e6aafda2cb7d6db Mon Sep 17 00:00:00 2001 From: serturx Date: Mon, 3 Oct 2022 10:32:08 +0200 Subject: [PATCH 013/156] Add include descriptions --- misc/run_length_encoding.c | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/misc/run_length_encoding.c b/misc/run_length_encoding.c index bb6ca3df69..5fa5b8a813 100644 --- a/misc/run_length_encoding.c +++ b/misc/run_length_encoding.c @@ -13,10 +13,10 @@ * */ -#include //For printf -#include //For string functions like strlen -#include //For malloc/free -#include //For assert +#include //for printf +#include //for string functions +#include //for malloc/free +#include //for assert /** * @brief Encodes a null-terminated string using run-length encoding From 7a997f2755f005a3f84b1cdf04ede6906d4e1ca0 Mon Sep 17 00:00:00 2001 From: serturx Date: Mon, 3 Oct 2022 11:40:57 +0200 Subject: [PATCH 014/156] fix comment --- misc/run_length_encoding.c | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/misc/run_length_encoding.c b/misc/run_length_encoding.c index 5fa5b8a813..408f7b0606 100644 --- a/misc/run_length_encoding.c +++ b/misc/run_length_encoding.c @@ -13,10 +13,10 @@ * */ -#include //for printf -#include //for string functions -#include //for malloc/free -#include //for assert +#include /// for printf +#include ///for string functions +#include /// for malloc/free +#include /// for assert /** * @brief Encodes a null-terminated string using run-length encoding From 8241a58d42afaad3f326b0c14e651aeb83864d60 Mon Sep 17 00:00:00 2001 From: serturx <56551721+serturx@users.noreply.github.com> Date: Wed, 5 Oct 2022 18:33:14 +0200 Subject: [PATCH 015/156] Apply suggestions from code review Co-authored-by: David Leal --- misc/run_length_encoding.c | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/misc/run_length_encoding.c b/misc/run_length_encoding.c index 408f7b0606..59e3342fb1 100644 --- a/misc/run_length_encoding.c +++ b/misc/run_length_encoding.c @@ -2,7 +2,7 @@ * @file * @author [serturx](https://github.com/serturx/) * @brief Encode a null terminated string using [Run-length encoding](https://en.wikipedia.org/wiki/Run-length_encoding) - * @section Description + * @details * Run-length encoding is a lossless compression algorithm. * It works by counting the consecutive occurences symbols * and encodes that series of consecutive symbols into the @@ -13,8 +13,8 @@ * */ -#include /// for printf -#include ///for string functions +#include /// for IO operations +#include /// for string functions #include /// for malloc/free #include /// for assert From 9502fd54ef4a2c540a035260ed70b5da57135cf6 Mon Sep 17 00:00:00 2001 From: zafar hussain Date: Tue, 18 Oct 2022 06:10:52 +0500 Subject: [PATCH 016/156] chore: update to match new Discord links (#1065) --- .github/ISSUE_TEMPLATE/config.yml | 2 +- .github/workflows/stale.yml | 4 ++-- CONTRIBUTING.md | 2 +- README.md | 2 +- 4 files changed, 5 insertions(+), 5 deletions(-) diff --git a/.github/ISSUE_TEMPLATE/config.yml b/.github/ISSUE_TEMPLATE/config.yml index fcff12b9ef..875cc4efab 100644 --- a/.github/ISSUE_TEMPLATE/config.yml +++ b/.github/ISSUE_TEMPLATE/config.yml @@ -1,5 +1,5 @@ blank_issues_enabled: false contact_links: - name: Discord community - url: https://discord.gg/c7MnfGFGa6 + url: https://the-algorithms.com/discord/ about: Have any questions or found any bugs? Please contact us via Discord diff --git a/.github/workflows/stale.yml b/.github/workflows/stale.yml index 406e56b7fe..0018600db5 100644 --- a/.github/workflows/stale.yml +++ b/.github/workflows/stale.yml @@ -9,9 +9,9 @@ jobs: - uses: actions/stale@v4 with: stale-issue-message: 'This issue has been automatically marked as abandoned because it has not had recent activity. It will be closed if no further activity occurs. Thank you for your contributions.' - close-issue-message: 'Please ping one of the maintainers once you add more information and updates here. If this is not the case and you need some help, feel free to ask for help in our [Gitter](https://gitter.im/TheAlgorithms) channel or our [Discord server](https://discord.gg/c7MnfGFGa6). Thank you for your contributions!' + close-issue-message: 'Please ping one of the maintainers once you add more information and updates here. If this is not the case and you need some help, feel free to ask for help in our [Gitter](https://gitter.im/TheAlgorithms) channel or our [Discord server](https://the-algorithms.com/discord/). Thank you for your contributions!' stale-pr-message: 'This pull request has been automatically marked as abandoned because it has not had recent activity. It will be closed if no further activity occurs. Thank you for your contributions.' - close-pr-message: 'Please ping one of the maintainers once you commit the changes requested or make improvements on the code. If this is not the case and you need some help, feel free to ask for help in our [Gitter](https://gitter.im/TheAlgorithms) channel or our [Discord server](https://discord.gg/c7MnfGFGa6). Thank you for your contributions!' + close-pr-message: 'Please ping one of the maintainers once you commit the changes requested or make improvements on the code. If this is not the case and you need some help, feel free to ask for help in our [Gitter](https://gitter.im/TheAlgorithms) channel or our [Discord server](https://the-algorithms.com/discord/). Thank you for your contributions!' exempt-issue-labels: 'dont-close,approved' exempt-pr-labels: 'dont-close,approved' days-before-stale: 30 diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index 56f7d99068..75dc35decd 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -2,7 +2,7 @@ ## Before contributing -Welcome to [TheAlgorithms/C](https://github.com/TheAlgorithms/C)! Before submitting pull requests, please make sure that you have **read the whole guidelines**. If you have any doubts about this contribution guide, please open [an issue](https://github.com/TheAlgorithms/C/issues/new/choose) or ask on our [Discord server](https://discord.gg/c7MnfGFGa6), and clearly state your concerns. +Welcome to [TheAlgorithms/C](https://github.com/TheAlgorithms/C)! Before submitting pull requests, please make sure that you have **read the whole guidelines**. If you have any doubts about this contribution guide, please open [an issue](https://github.com/TheAlgorithms/C/issues/new/choose) or ask on our [Discord server](https://the-algorithms.com/discord/), and clearly state your concerns. ## Contributing diff --git a/README.md b/README.md index e0b0ad64b5..bff102fe31 100644 --- a/README.md +++ b/README.md @@ -10,7 +10,7 @@ [![Doxygen CI](https://github.com/TheAlgorithms/C/workflows/Doxygen%20CI/badge.svg)](https://TheAlgorithms.github.io/C) [![Awesome CI](https://github.com/TheAlgorithms/C/workflows/Awesome%20CI%20Workflow/badge.svg)](https://github.com/TheAlgorithms/C/actions?query=workflow%3A%22Awesome+CI+Workflow%22) [![Income](https://img.shields.io/liberapay/receives/TheAlgorithms.svg?logo=liberapay)](https://liberapay.com/TheAlgorithms) -[![Discord chat](https://img.shields.io/discord/808045925556682782.svg?logo=discord&colorB=5865F2)](https://discord.gg/c7MnfGFGa6) +[![Discord chat](https://img.shields.io/discord/808045925556682782.svg?logo=discord&colorB=5865F2)](https://the-algorithms.com/discord/) [![Donate](https://liberapay.com/assets/widgets/donate.svg)](https://liberapay.com/TheAlgorithms/donate) ## Overview From 1a6ed6bf1c503d5604f6e477f9ea80ebedee047e Mon Sep 17 00:00:00 2001 From: utsavkhemka21 <90024442+utsavkhemka21@users.noreply.github.com> Date: Sat, 22 Oct 2022 15:35:58 +0530 Subject: [PATCH 017/156] Add Leet Code Solution of 62 No Ques (#1061) Co-authored-by: Utsav Khemka --- leetcode/README.md | 185 ++++++++++++++++++++++----------------------- leetcode/src/62.c | 39 ++++++++++ 2 files changed, 131 insertions(+), 93 deletions(-) create mode 100644 leetcode/src/62.c diff --git a/leetcode/README.md b/leetcode/README.md index b20037394d..30a5197a25 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -1,96 +1,95 @@ -LeetCode -======== +# LeetCode ### LeetCode Algorithm - -| # | Title | Solution | Difficulty | -|---| ----- | -------- | ---------- | -|1|[Two Sum](https://leetcode.com/problems/two-sum/) | [C](./src/1.c)|Easy| -|2|[Add Two Numbers](https://leetcode.com/problems/add-two-numbers/) | [C](./src/2.c)|Medium| -|3|[Longest Substring Without Repeating Characters](https://leetcode.com/problems/longest-substring-without-repeating-characters/) | [C](./src/3.c)|Medium| -|4|[Median of Two Sorted Arrays](https://leetcode.com/problems/median-of-two-sorted-arrays/) | [C](./src/4.c)|Hard| -|6|[ZigZag conversion](https://leetcode.com/problems/zigzag-conversion/) | [C](./src/4.c)|Medium| -|7|[Reverse Integer](https://leetcode.com/problems/reverse-integer/) | [C](./src/7.c)|Easy| -|8|[String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c)|Medium| -|9|[Palindrome Number](https://leetcode.com/problems/palindrome-number/) | [C](./src/9.c)|Easy| -|11| [Container With Most Water](https://leetcode.com/problems/container-with-most-water/) | [C](./src/11.c)|Medium| -|12|[Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c)|Medium| -|13|[Roman to Integer](https://leetcode.com/problems/roman-to-integer/) | [C](./src/13.c)|Easy| -|20|[Valid Parentheses](https://leetcode.com/problems/valid-parentheses/) | [C](./src/20.c)|Easy| -|21|[Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists/) | [C](./src/21.c)|Easy| -|24|[Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs/) | [C](./src/24.c)|Medium| -|26|[Remove Duplicates from Sorted Array](https://leetcode.com/problems/remove-duplicates-from-sorted-array/) | [C](./src/26.c)|Easy| -|27|[Remove Element](https://leetcode.com/problems/remove-element/) | [C](./src/27.c)|Easy| -|28|[Implement strStr()](https://leetcode.com/problems/implement-strstr/) | [C](./src/28.c)|Easy| -|29|[Divide Two Integers](https://leetcode.com/problems/divide-two-integers/) | [C](./src/29.c)|Medium| -|35|[Search Insert Position](https://leetcode.com/problems/search-insert-position/) | [C](./src/35.c)|Easy| -|38|[Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c)|Easy| -|53|[Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c)|Easy| -|66|[Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c)|Easy| -|82|[Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c)|Medium| -|83|[Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list/) | [C](./src/83.c)|Easy| -|94|[Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal/) | [C](./src/94.c)|Medium| -|101|[Symmetric Tree](https://leetcode.com/problems/symmetric-tree/) | [C](./src/101.c)|Easy| -|104|[Maximum Depth of Binary Tree](https://leetcode.com/problems/maximum-depth-of-binary-tree/) | [C](./src/104.c)|Easy| -|108|[Convert Sorted Array to Binary Search Tree](https://leetcode.com/problems/convert-sorted-array-to-binary-search-tree/) | [C](./src/108.c)|Easy| -|109|[Convert Sorted List to Binary Search Tree](https://leetcode.com/problems/convert-sorted-list-to-binary-search-tree/) | [C](./src/109.c)|Medium| -|110|[Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree/) | [C](./src/110.c)|Easy| -|112|[Path Sum](https://leetcode.com/problems/path-sum/) | [C](./src/112.c)|Easy| -|118|[Pascal's Triangle](https://leetcode.com/problems/pascals-triangle/) | [C](./src/118.c)|Easy| -|121|[Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock/) | [C](./src/121.c)|Easy| -|125|[Valid Palindrome](https://leetcode.com/problems/valid-palindrome/) | [C](./src/125.c)|Easy| -|136|[Single Number](https://leetcode.com/problems/single-number/) | [C](./src/136.c)|Easy| -|141|[Linked List Cycle](https://leetcode.com/problems/linked-list-cycle/) | [C](./src/141.c)|Easy| -|142|[Linked List Cycle II](https://leetcode.com/problems/linked-list-cycle-ii/) | [C](./src/142.c)|Medium| -|153|[Find Minimum in Rotated Sorted Array](https://leetcode.com/problems/find-minimum-in-rotated-sorted-array/) | [C](./src/153.c)|Medium| -|160|[Intersection of Two Linked Lists](https://leetcode.com/problems/intersection-of-two-linked-lists/) | [C](./src/160.c)|Easy| -|169|[Majority Element](https://leetcode.com/problems/majority-element/) | [C](./src/169.c)|Easy| -|173|[Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator/) | [C](./src/173.c)|Medium| -|189|[Rotate Array](https://leetcode.com/problems/rotate-array) | [C](./src/189.c)|Easy| -|190|[Reverse Bits](https://leetcode.com/problems/reverse-bits/) | [C](./src/190.c)|Easy| -|191|[Number of 1 Bits](https://leetcode.com/problems/number-of-1-bits/) | [C](./src/191.c)|Easy| -|201|[Bitwise AND of Numbers Range](https://leetcode.com/problems/bitwise-and-of-numbers-range/) | [C](./src/201.c)|Medium| -|203|[Remove Linked List Elements](https://leetcode.com/problems/remove-linked-list-elements/) | [C](./src/203.c)|Easy| -|206|[Reverse Linked List](https://leetcode.com/problems/reverse-linked-list/) | [C](./src/206.c)|Easy| -|215|[Kth Largest Element in an Array](https://leetcode.com/problems/kth-largest-element-in-an-array/) | [C](./src/215.c)|Medium| -|217|[Contains Duplicate](https://leetcode.com/problems/contains-duplicate/) | [C](./src/217.c)|Easy| -|226|[Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree/) | [C](./src/226.c)|Easy| -|231|[Power of Two](https://leetcode.com/problems/power-of-two/) | [C](./src/231.c)|Easy| -|234|[Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list/) | [C](./src/234.c)|Easy| -|242|[Valid Anagram](https://leetcode.com/problems/valid-anagram/) | [C](./src/242.c)|Easy| -|268|[Missing Number](https://leetcode.com/problems/missing-number/) | [C](./src/268.c)|Easy| -|278|[First Bad Version](https://leetcode.com/problems/first-bad-version/) | [C](./src/278.c)|Easy| -|283|[Move Zeroes](https://leetcode.com/problems/move-zeroes/) | [C](./src/283.c)|Easy| -|287|[Find the Duplicate Number](https://leetcode.com/problems/find-the-duplicate-number/) | [C](./src/287.c)|Medium| -|344|[Reverse String](https://leetcode.com/problems/reverse-string/) | [C](./src/344.c)|Easy| -|367|[Valid Perfect Square](https://leetcode.com/problems/valid-perfect-square/) | [C](./src/367.c)|Easy| -|387|[First Unique Character in a String](https://leetcode.com/problems/first-unique-character-in-a-string/) | [C](./src/387.c)|Easy| -|389|[Find the Difference](https://leetcode.com/problems/find-the-difference/) | [C](./src/389.c)|Easy| -|404|[Sum of Left Leaves](https://leetcode.com/problems/sum-of-left-leaves/) | [C](./src/404.c)|Easy| -|442|[Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array/) | [C](./src/442.c)|Medium| -|461|[Hamming Distance](https://leetcode.com/problems/hamming-distance/) | [C](./src/461.c) |Easy| -|476|[Number Complement](https://leetcode.com/problems/number-complement/) | [C](./src/476.c)|Easy| -|509|[Fibonacci Number](https://leetcode.com/problems/fibonacci-number/) | [C](./src/509.c)|Easy| -|520|[Detect Capital](https://leetcode.com/problems/detect-capital/) | [C](./src/520.c)|Easy| -|561|[Array Partition I](https://leetcode.com/problems/array-partition-i/) | [C](./src/561.c)|Easy| -|617|[Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees/) | [C](./src/617.c)|Easy| -|647|[Palindromic Substring](https://leetcode.com/problems/palindromic-substrings/) | [C](./src/647.c)|Medium| -|674|[Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence/) | [C](./src/674.c)|Easy| -|700|[Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree/) | [C](./src/700.c)|Easy| -|701|[Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree/) | [C](./src/701.c)|Medium| -|704|[Binary Search](https://leetcode.com/problems/binary-search/) | [C](./src/704.c)|Easy| -|709|[To Lower Case](https://leetcode.com/problems/to-lower-case/) | [C](./src/709.c)|Easy| -|771|[Jewels and Stones](https://leetcode.com/problems/jewels-and-stones/) | [C](./src/771.c)|Easy| -|852|[Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array/) | [C](./src/852.c)|Easy| -|876|[Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list/) | [C](./src/876.c)|Easy| -|905|[Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity/) | [C](./src/905.c)|Easy| -|917|[Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters/) | [C](./src/917.c)|Easy| -|938|[Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c)|Easy| -|965|[Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c)|Easy| -|977|[Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c)|Easy| -|1089|[Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c)|Easy| -|1184|[Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c)|Easy| -|1189|[Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c)|Easy| -|1207|[Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c)|Easy| -|2130|[Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c)|Medium| +| # | Title | Solution | Difficulty | +| ---- | ------------------------------------------------------------------------------------------------------------------------------- | ----------------- | ---------- | +| 1 | [Two Sum](https://leetcode.com/problems/two-sum/) | [C](./src/1.c) | Easy | +| 2 | [Add Two Numbers](https://leetcode.com/problems/add-two-numbers/) | [C](./src/2.c) | Medium | +| 3 | [Longest Substring Without Repeating Characters](https://leetcode.com/problems/longest-substring-without-repeating-characters/) | [C](./src/3.c) | Medium | +| 4 | [Median of Two Sorted Arrays](https://leetcode.com/problems/median-of-two-sorted-arrays/) | [C](./src/4.c) | Hard | +| 6 | [ZigZag conversion](https://leetcode.com/problems/zigzag-conversion/) | [C](./src/4.c) | Medium | +| 7 | [Reverse Integer](https://leetcode.com/problems/reverse-integer/) | [C](./src/7.c) | Easy | +| 8 | [String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c) | Medium | +| 9 | [Palindrome Number](https://leetcode.com/problems/palindrome-number/) | [C](./src/9.c) | Easy | +| 11 | [Container With Most Water](https://leetcode.com/problems/container-with-most-water/) | [C](./src/11.c) | Medium | +| 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | +| 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer/) | [C](./src/13.c) | Easy | +| 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses/) | [C](./src/20.c) | Easy | +| 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists/) | [C](./src/21.c) | Easy | +| 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs/) | [C](./src/24.c) | Medium | +| 26 | [Remove Duplicates from Sorted Array](https://leetcode.com/problems/remove-duplicates-from-sorted-array/) | [C](./src/26.c) | Easy | +| 27 | [Remove Element](https://leetcode.com/problems/remove-element/) | [C](./src/27.c) | Easy | +| 28 | [Implement strStr()](https://leetcode.com/problems/implement-strstr/) | [C](./src/28.c) | Easy | +| 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers/) | [C](./src/29.c) | Medium | +| 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position/) | [C](./src/35.c) | Easy | +| 38 | [Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c) | Easy | +| 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | +| 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | Medium | +| 66 | [Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c) | Easy | +| 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c) | Medium | +| 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list/) | [C](./src/83.c) | Easy | +| 94 | [Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal/) | [C](./src/94.c) | Medium | +| 101 | [Symmetric Tree](https://leetcode.com/problems/symmetric-tree/) | [C](./src/101.c) | Easy | +| 104 | [Maximum Depth of Binary Tree](https://leetcode.com/problems/maximum-depth-of-binary-tree/) | [C](./src/104.c) | Easy | +| 108 | [Convert Sorted Array to Binary Search Tree](https://leetcode.com/problems/convert-sorted-array-to-binary-search-tree/) | [C](./src/108.c) | Easy | +| 109 | [Convert Sorted List to Binary Search Tree](https://leetcode.com/problems/convert-sorted-list-to-binary-search-tree/) | [C](./src/109.c) | Medium | +| 110 | [Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree/) | [C](./src/110.c) | Easy | +| 112 | [Path Sum](https://leetcode.com/problems/path-sum/) | [C](./src/112.c) | Easy | +| 118 | [Pascal's Triangle](https://leetcode.com/problems/pascals-triangle/) | [C](./src/118.c) | Easy | +| 121 | [Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock/) | [C](./src/121.c) | Easy | +| 125 | [Valid Palindrome](https://leetcode.com/problems/valid-palindrome/) | [C](./src/125.c) | Easy | +| 136 | [Single Number](https://leetcode.com/problems/single-number/) | [C](./src/136.c) | Easy | +| 141 | [Linked List Cycle](https://leetcode.com/problems/linked-list-cycle/) | [C](./src/141.c) | Easy | +| 142 | [Linked List Cycle II](https://leetcode.com/problems/linked-list-cycle-ii/) | [C](./src/142.c) | Medium | +| 153 | [Find Minimum in Rotated Sorted Array](https://leetcode.com/problems/find-minimum-in-rotated-sorted-array/) | [C](./src/153.c) | Medium | +| 160 | [Intersection of Two Linked Lists](https://leetcode.com/problems/intersection-of-two-linked-lists/) | [C](./src/160.c) | Easy | +| 169 | [Majority Element](https://leetcode.com/problems/majority-element/) | [C](./src/169.c) | Easy | +| 173 | [Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator/) | [C](./src/173.c) | Medium | +| 189 | [Rotate Array](https://leetcode.com/problems/rotate-array) | [C](./src/189.c) | Easy | +| 190 | [Reverse Bits](https://leetcode.com/problems/reverse-bits/) | [C](./src/190.c) | Easy | +| 191 | [Number of 1 Bits](https://leetcode.com/problems/number-of-1-bits/) | [C](./src/191.c) | Easy | +| 201 | [Bitwise AND of Numbers Range](https://leetcode.com/problems/bitwise-and-of-numbers-range/) | [C](./src/201.c) | Medium | +| 203 | [Remove Linked List Elements](https://leetcode.com/problems/remove-linked-list-elements/) | [C](./src/203.c) | Easy | +| 206 | [Reverse Linked List](https://leetcode.com/problems/reverse-linked-list/) | [C](./src/206.c) | Easy | +| 215 | [Kth Largest Element in an Array](https://leetcode.com/problems/kth-largest-element-in-an-array/) | [C](./src/215.c) | Medium | +| 217 | [Contains Duplicate](https://leetcode.com/problems/contains-duplicate/) | [C](./src/217.c) | Easy | +| 226 | [Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree/) | [C](./src/226.c) | Easy | +| 231 | [Power of Two](https://leetcode.com/problems/power-of-two/) | [C](./src/231.c) | Easy | +| 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list/) | [C](./src/234.c) | Easy | +| 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram/) | [C](./src/242.c) | Easy | +| 268 | [Missing Number](https://leetcode.com/problems/missing-number/) | [C](./src/268.c) | Easy | +| 278 | [First Bad Version](https://leetcode.com/problems/first-bad-version/) | [C](./src/278.c) | Easy | +| 283 | [Move Zeroes](https://leetcode.com/problems/move-zeroes/) | [C](./src/283.c) | Easy | +| 287 | [Find the Duplicate Number](https://leetcode.com/problems/find-the-duplicate-number/) | [C](./src/287.c) | Medium | +| 344 | [Reverse String](https://leetcode.com/problems/reverse-string/) | [C](./src/344.c) | Easy | +| 367 | [Valid Perfect Square](https://leetcode.com/problems/valid-perfect-square/) | [C](./src/367.c) | Easy | +| 387 | [First Unique Character in a String](https://leetcode.com/problems/first-unique-character-in-a-string/) | [C](./src/387.c) | Easy | +| 389 | [Find the Difference](https://leetcode.com/problems/find-the-difference/) | [C](./src/389.c) | Easy | +| 404 | [Sum of Left Leaves](https://leetcode.com/problems/sum-of-left-leaves/) | [C](./src/404.c) | Easy | +| 442 | [Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array/) | [C](./src/442.c) | Medium | +| 461 | [Hamming Distance](https://leetcode.com/problems/hamming-distance/) | [C](./src/461.c) | Easy | +| 476 | [Number Complement](https://leetcode.com/problems/number-complement/) | [C](./src/476.c) | Easy | +| 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number/) | [C](./src/509.c) | Easy | +| 520 | [Detect Capital](https://leetcode.com/problems/detect-capital/) | [C](./src/520.c) | Easy | +| 561 | [Array Partition I](https://leetcode.com/problems/array-partition-i/) | [C](./src/561.c) | Easy | +| 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees/) | [C](./src/617.c) | Easy | +| 647 | [Palindromic Substring](https://leetcode.com/problems/palindromic-substrings/) | [C](./src/647.c) | Medium | +| 674 | [Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence/) | [C](./src/674.c) | Easy | +| 700 | [Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree/) | [C](./src/700.c) | Easy | +| 701 | [Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree/) | [C](./src/701.c) | Medium | +| 704 | [Binary Search](https://leetcode.com/problems/binary-search/) | [C](./src/704.c) | Easy | +| 709 | [To Lower Case](https://leetcode.com/problems/to-lower-case/) | [C](./src/709.c) | Easy | +| 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones/) | [C](./src/771.c) | Easy | +| 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array/) | [C](./src/852.c) | Easy | +| 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list/) | [C](./src/876.c) | Easy | +| 905 | [Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity/) | [C](./src/905.c) | Easy | +| 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters/) | [C](./src/917.c) | Easy | +| 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | +| 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c) | Easy | +| 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | +| 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | +| 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | +| 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | +| 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | +| 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | diff --git a/leetcode/src/62.c b/leetcode/src/62.c new file mode 100644 index 0000000000..b2ac88d687 --- /dev/null +++ b/leetcode/src/62.c @@ -0,0 +1,39 @@ +// Dynamic programming can be applied here, because every solved sub-problem has +// an optimal sub-solution +// Searching backwards from end to start, we can incrementally calculate number +// of paths to destination. i.e. start from bottom-right, and calculate +// leftwards (lowest row should all be 1). then go to second-last-row, rightmost +// column, and calculate leftwards the last cell to be calculated is the start +// location (0, 0). The iteration ordering is intentional: the inner loop +// iterates the contents of each vector, the outer loop iterates each vector. +// This is more cache-friendly. + +// Example below, calculated from right-to-left, bottom-to-top. +// 7 by 3 grid +// 28 21 15 10 6 3 1 +// 7 6 5 4 3 2 1 +// 1 1 1 1 1 1 1 + +int uniquePaths(int m, int n) +{ + int dp[m][n]; + + for (int column = 0; column < n; column++) + { + dp[0][column] = 1; + } + + for (int row = 1; row < m; row++) + { + dp[row][0] = 1; + } + + for (int row = 1; row < m; row++) + { + for (int column = 1; column < n; column++) + { + dp[row][column] = dp[row - 1][column] + dp[row][column - 1]; + } + } + return dp[m - 1][n - 1]; +} From 8fa62620c2106b96973384ad225c2f3de50192a3 Mon Sep 17 00:00:00 2001 From: David Leal Date: Mon, 24 Oct 2022 14:48:49 -0500 Subject: [PATCH 018/156] chore: use the `DIRECTORY.md` workflow from the `scripts` repository (#1096) * updating DIRECTORY.md * chore: use the scripts repository for... ...the `DIRECTORY.md` workflow. The code is much shorter now as well. * updating DIRECTORY.md Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> --- .github/workflows/awesome_workflow.yml | 50 ++------------------------ DIRECTORY.md | 4 ++- 2 files changed, 6 insertions(+), 48 deletions(-) diff --git a/.github/workflows/awesome_workflow.yml b/.github/workflows/awesome_workflow.yml index 582bc9c6f9..8b70b04cfa 100644 --- a/.github/workflows/awesome_workflow.yml +++ b/.github/workflows/awesome_workflow.yml @@ -42,54 +42,10 @@ jobs: done git commit -am "formatting filenames ${GITHUB_SHA::8}" || true - name: Update DIRECTORY.md - shell: python - run: | - import os - from typing import Iterator - - URL_BASE = "https://github.com/TheAlgorithms/C/blob/master" - g_output = [] - - def good_filepaths(top_dir: str = ".") -> Iterator[str]: - cpp_exts = tuple(".c .c++ .cc .cpp .cu .cuh .cxx .h .h++ .hh .hpp .hxx".split()) - for dirpath, dirnames, filenames in os.walk(top_dir): - dirnames[:] = [d for d in dirnames if d[0] not in "._"] - for filename in filenames: - if os.path.splitext(filename)[1].lower() in cpp_exts: - yield os.path.join(dirpath, filename).lstrip("./") - - def md_prefix(i): - return f"{i * ' '}*" if i else "\n##" - - def print_path(old_path: str, new_path: str) -> str: - global g_output - old_parts = old_path.split(os.sep) - for i, new_part in enumerate(new_path.split(os.sep)): - if i + 1 > len(old_parts) or old_parts[i] != new_part: - if new_part: - g_output.append(f"{md_prefix(i)} {new_part.replace('_', ' ').title()}") - return new_path - - def build_directory_md(top_dir: str = ".") -> str: - global g_output - old_path = "" - for filepath in sorted(good_filepaths(), key=str.lower): - filepath, filename = os.path.split(filepath) - if filepath != old_path: - old_path = print_path(old_path, filepath) - indent = (filepath.count(os.sep) + 1) if filepath else 0 - url = "/".join((URL_BASE, filepath, filename)).replace(" ", "%20") - filename = os.path.splitext(filename.replace("_", " ").title())[0] - g_output.append(f"{md_prefix(indent)} [{filename}]({url})") - return "# List of all files\n" + "\n".join(g_output) - - with open("DIRECTORY.md", "w") as out_file: - out_file.write(build_directory_md(".") + "\n") - - name: Commit DIRECTORY.md run: | - git diff DIRECTORY.md - git add DIRECTORY.md - git commit -m "updating DIRECTORY.md" || true + wget https://raw.githubusercontent.com/TheAlgorithms/scripts/main/build_directory_md.py + python3 build_directory_md.py C . .c,.h > DIRECTORY.md + git commit -m "updating DIRECTORY.md" DIRECTORY.md || true - name: Get file changes run: | git remote -v diff --git a/DIRECTORY.md b/DIRECTORY.md index fa52f96f7a..a6e53d03f1 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -1,4 +1,3 @@ -# List of all files ## Audio * [Alaw](https://github.com/TheAlgorithms/C/blob/master/audio/alaw.c) @@ -170,6 +169,7 @@ * [11](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/11.c) * [110](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/110.c) * [112](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/112.c) + * [118](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/118.c) * [1184](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/1184.c) * [1189](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/1189.c) * [12](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/12.c) @@ -193,6 +193,7 @@ * [203](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/203.c) * [206](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/206.c) * [21](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/21.c) + * [2130](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/2130.c) * [215](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/215.c) * [217](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/217.c) * [226](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/226.c) @@ -226,6 +227,7 @@ * [561](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/561.c) * [6](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/6.c) * [617](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/617.c) + * [62](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/62.c) * [647](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/647.c) * [66](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/66.c) * [674](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/674.c) From 0cd4f6b691cae0706771a1e9fb68768a2bd59132 Mon Sep 17 00:00:00 2001 From: Adhiraj Date: Sat, 29 Oct 2022 05:17:45 +0530 Subject: [PATCH 019/156] feat: add Leetcode problem 119 (#997) * added 119 * added 119.c Co-authored-by: David Leal --- leetcode/README.md | 1 + leetcode/src/119.c | 22 ++++++++++++++++++++++ 2 files changed, 23 insertions(+) create mode 100644 leetcode/src/119.c diff --git a/leetcode/README.md b/leetcode/README.md index 30a5197a25..8e9fe6a638 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -37,6 +37,7 @@ | 110 | [Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree/) | [C](./src/110.c) | Easy | | 112 | [Path Sum](https://leetcode.com/problems/path-sum/) | [C](./src/112.c) | Easy | | 118 | [Pascal's Triangle](https://leetcode.com/problems/pascals-triangle/) | [C](./src/118.c) | Easy | +| 119 | [Pascal's Triangle II](https://leetcode.com/problems/pascals-triangle-ii/) | [C](./src/119.c) | Easy | | 121 | [Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock/) | [C](./src/121.c) | Easy | | 125 | [Valid Palindrome](https://leetcode.com/problems/valid-palindrome/) | [C](./src/125.c) | Easy | | 136 | [Single Number](https://leetcode.com/problems/single-number/) | [C](./src/136.c) | Easy | diff --git a/leetcode/src/119.c b/leetcode/src/119.c new file mode 100644 index 0000000000..a4b6f7a921 --- /dev/null +++ b/leetcode/src/119.c @@ -0,0 +1,22 @@ +/** + * Note: The returned array must be malloced, assume caller calls free(). + */ +int* getRow(int rowIndex, int* returnSize){ + int colIndex = rowIndex + 1; + int* ans = (int*) malloc(sizeof(int) * colIndex); + for (int i = 0; i < colIndex; i++) + { + ans[i] = 1; + } + *returnSize = colIndex; + + for (int r = 2; r <= rowIndex; r++) + { + for (int c = r - 1; c > 0; c--) + { + ans[c] = ans[c] + ans[c-1]; + } + } + + return ans; +} From 27145d7ce4a87dc4585a056acaec185c634b2033 Mon Sep 17 00:00:00 2001 From: utsavkhemka21 <90024442+utsavkhemka21@users.noreply.github.com> Date: Sat, 29 Oct 2022 07:00:13 +0530 Subject: [PATCH 020/156] feat: add LeetCode problem 62 (#1062) Co-authored-by: Utsav Khemka Co-authored-by: David Leal --- leetcode/README.md | 1 + leetcode/src/63.c | 39 +++++++++++++++++++++++++++++++++++++++ 2 files changed, 40 insertions(+) create mode 100644 leetcode/src/63.c diff --git a/leetcode/README.md b/leetcode/README.md index 8e9fe6a638..c122338420 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -26,6 +26,7 @@ | 38 | [Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c) | Easy | | 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | | 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | Medium | +| 63 | [Unique Paths II](https://leetcode.com/problems/unique-paths-ii/) | [C](./src/63.c) | Medium | | 66 | [Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c) | Easy | | 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c) | Medium | | 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list/) | [C](./src/83.c) | Easy | diff --git a/leetcode/src/63.c b/leetcode/src/63.c new file mode 100644 index 0000000000..d26106fd90 --- /dev/null +++ b/leetcode/src/63.c @@ -0,0 +1,39 @@ +/* +I walk through the grids and record the path numbers at the +same time. +By using a 2D array called paths, it will add up possible so +urce path and save the number. +Noted that: +if the destination has obstacle, we can't reach it +the first grid (paths[0][0]) always set as 1 our previous +path source is either from top or left border of grid has +different condition +*/ + +int uniquePathsWithObstacles(int** obstacleGrid, int obstacleGridSize, + int* obstacleGridColSize) +{ + if (obstacleGrid[obstacleGridSize - 1][*obstacleGridColSize - 1] == 1) + { + return 0; + } + int paths[obstacleGridSize][*obstacleGridColSize]; + for (int i = 0; i < obstacleGridSize; i++) + { + for (int j = 0; j < *obstacleGridColSize; j++) + { + if (obstacleGrid[i][j]) + { + paths[i][j] = 0; + } + else + { + paths[i][j] = (i == 0 && j == 0) + ? 1 + : ((i == 0 ? 0 : paths[i - 1][j]) + + (j == 0 ? 0 : paths[i][j - 1])); + } + } + } + return paths[obstacleGridSize - 1][*obstacleGridColSize - 1]; +} From 9ab1bc981bf3cc34cbc7bcdd4a21fe0f95c13986 Mon Sep 17 00:00:00 2001 From: Sindhu Inti <89198083+Sindhuinti@users.noreply.github.com> Date: Wed, 2 Nov 2022 11:44:45 +0530 Subject: [PATCH 021/156] feat: LeetCode Next Greater Node In Linked List solution (1019) (#1022) Co-authored-by: David Leal --- leetcode/README.md | 3 ++- leetcode/src/1019.c | 29 +++++++++++++++++++++++++++++ 2 files changed, 31 insertions(+), 1 deletion(-) create mode 100644 leetcode/src/1019.c diff --git a/leetcode/README.md b/leetcode/README.md index c122338420..6031964338 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -90,8 +90,9 @@ | 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | | 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c) | Easy | | 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | +| 1019 | [Next Greater Node In Linked List](https://leetcode.com/problems/next-greater-node-in-linked-list/) | [C](./src/1019.c) | Medium | | 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | -| 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | +| 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | \ No newline at end of file diff --git a/leetcode/src/1019.c b/leetcode/src/1019.c new file mode 100644 index 0000000000..31eca53d72 --- /dev/null +++ b/leetcode/src/1019.c @@ -0,0 +1,29 @@ +/** + * Definition for singly-linked list. + * struct ListNode { + * int val; + * struct ListNode *next; + * }; + */ + +int* nextLargerNodes(struct ListNode* head, int* returnSize) +{ + int *output, count = 0; + struct ListNode *tmp = head, *tmp2; + for (; tmp != NULL; tmp = tmp->next, count++) + ; + output = (int*)calloc(count, sizeof(int)); + *returnSize = count; + for (tmp = head, count = 0; tmp->next != NULL; tmp = tmp->next, count++) + { + for (tmp2 = tmp->next; tmp2 != NULL; tmp2 = tmp2->next) + { + if (tmp2->val > tmp->val) + { + output[count] = tmp2->val; + break; + } + } + } + return output; +} From a0f658311decf7b6e6e9acbcae0677a202a25493 Mon Sep 17 00:00:00 2001 From: Sindhu Inti <89198083+Sindhuinti@users.noreply.github.com> Date: Sat, 5 Nov 2022 06:45:30 +0530 Subject: [PATCH 022/156] feat: leetcode Construct Binary Search Tree from Preorder Traversal solution (1008) (#1021) Co-authored-by: David Leal --- leetcode/README.md | 3 ++- leetcode/src/1008.c | 39 +++++++++++++++++++++++++++++++++++++++ 2 files changed, 41 insertions(+), 1 deletion(-) create mode 100644 leetcode/src/1008.c diff --git a/leetcode/README.md b/leetcode/README.md index 6031964338..216885c0c8 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -90,9 +90,10 @@ | 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | | 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c) | Easy | | 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | +| 1008 | [Construct Binary Search Tree from Preorder Traversal](https://leetcode.com/problems/construct-binary-search-tree-from-preorder-traversal/description/) | [C](./src/1008.c) | Medium | | 1019 | [Next Greater Node In Linked List](https://leetcode.com/problems/next-greater-node-in-linked-list/) | [C](./src/1019.c) | Medium | | 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | -| 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | \ No newline at end of file +| 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | diff --git a/leetcode/src/1008.c b/leetcode/src/1008.c new file mode 100644 index 0000000000..ce4871ecd4 --- /dev/null +++ b/leetcode/src/1008.c @@ -0,0 +1,39 @@ +/** + * Definition for a binary tree node. + * struct TreeNode { + * int val; + * struct TreeNode *left; + * struct TreeNode *right; + * }; + */ + +struct TreeNode* bstFromPreorder(int* preorder, int preorderSize) +{ + struct TreeNode* new; + int left_ptr; + + new = malloc(sizeof(struct TreeNode)); + new->val = preorder[0]; + + if (preorderSize == 1) + { + new->right = NULL; + new->left = NULL; + return new; + } + + left_ptr = 1; + while ((left_ptr < preorderSize) && (preorder[left_ptr] < preorder[0])) + left_ptr++; + if (left_ptr == 1) + new->left = NULL; + else + new->left = bstFromPreorder(preorder + 1, left_ptr - 1); + if (left_ptr < preorderSize) + new->right = + bstFromPreorder(preorder + left_ptr, preorderSize - left_ptr); + else + new->right = NULL; + + return new; +} From 25f3b63d5bdd5b47810b61369bb657a1cd89fb8b Mon Sep 17 00:00:00 2001 From: Aniket Dubey <58386130+aniketwdubey@users.noreply.github.com> Date: Wed, 9 Nov 2022 02:38:46 +0530 Subject: [PATCH 023/156] chore: add LeetCode problem 485 (#981) * Create 485.c added "485. Max Consecutive Ones" solution * Update README.md Co-authored-by: David Leal --- leetcode/README.md | 1 + leetcode/src/485.c | 23 +++++++++++++++++++++++ 2 files changed, 24 insertions(+) create mode 100644 leetcode/src/485.c diff --git a/leetcode/README.md b/leetcode/README.md index 216885c0c8..3fcec08e55 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -72,6 +72,7 @@ | 442 | [Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array/) | [C](./src/442.c) | Medium | | 461 | [Hamming Distance](https://leetcode.com/problems/hamming-distance/) | [C](./src/461.c) | Easy | | 476 | [Number Complement](https://leetcode.com/problems/number-complement/) | [C](./src/476.c) | Easy | +| 485 | [Max Consecutive Ones](https://leetcode.com/problems/max-consecutive-ones/) | [C](./src/485.c) | Easy | | 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number/) | [C](./src/509.c) | Easy | | 520 | [Detect Capital](https://leetcode.com/problems/detect-capital/) | [C](./src/520.c) | Easy | | 561 | [Array Partition I](https://leetcode.com/problems/array-partition-i/) | [C](./src/561.c) | Easy | diff --git a/leetcode/src/485.c b/leetcode/src/485.c new file mode 100644 index 0000000000..a288761590 --- /dev/null +++ b/leetcode/src/485.c @@ -0,0 +1,23 @@ +int max(a,b){ + if(a>b) + return a; + else + return b; +} + +int findMaxConsecutiveOnes(int* nums, int numsSize){ + int count = 0; + int result = 0; + + for (int i = 0; i < numsSize; i++) + { + if (nums[i] == 0) + count = 0; + else + { + count++; + result = max(result, count); + } + } + return result; +} From 154bcdb935c83a9eb168f0b21dfc8c9c1eaa390b Mon Sep 17 00:00:00 2001 From: Shreyas Sable <43932047+KILLinefficiency@users.noreply.github.com> Date: Wed, 9 Nov 2022 02:48:39 +0530 Subject: [PATCH 024/156] feat: add a vector implementation in data structures (#977) * added a vector implementation in data structures * changed a comment * made the required changes * added tests --- data_structures/vector.c | 168 +++++++++++++++++++++++++++++++++++++++ 1 file changed, 168 insertions(+) create mode 100644 data_structures/vector.c diff --git a/data_structures/vector.c b/data_structures/vector.c new file mode 100644 index 0000000000..ed3b930e36 --- /dev/null +++ b/data_structures/vector.c @@ -0,0 +1,168 @@ +/** + * @file + * @brief This is a vector implemenation in C. A vector is an expandable array. + * @details This vector implementation in C comes with some wrapper functions that lets the user work with data without having to worrying about memory. + */ + +#include /// for IO operations +#include /// for malloc() and free() +#include /// for testing using assert() + +/** This is the struct that defines the vector. */ +typedef struct { + int len; ///< contains the length of the vector + int current; ///< holds the current item + int* contents; ///< the internal array itself +} Vector; + +/** + * This function initilaizes the vector and gives it a size of 1 + * and initializes the first index to 0. + * @params Vector* (a pointer to the Vector struct) + * @params int (the actual data to be passed to the vector) + * @returns none + */ +void init(Vector* vec, int val) { + vec->contents = (int*)malloc(sizeof(int)); + vec->contents[0] = val; + vec->current = 0; + vec->len = 1; +} + +/** + * This function clears the heap memory allocated by the Vector. + * @params Vector* (a pointer to the Vector struct) + * @returns: none + */ +void delete(Vector* vec) { + free(vec->contents); +} + +/** + * This function clears the contents of the Vector. + * @params Vector* (a pointer to the Vector struct) + * @returns: none + */ +void clear(Vector* vec) { + delete(vec); + init(vec, 0); +} + +/** + * This function returns the length the Vector. + * @params Vector* (a pointer to the Vector struct) + * @returns: int + */ +int len(Vector* vec) { + return vec->len; +} + +/** + * This function pushes a value to the end of the Vector. + * @params Vector* (a pointer to the Vector struct) + * @params int (the value to be pushed) + * @returns: none + */ +void push(Vector* vec, int val) { + vec->contents = realloc(vec->contents, (sizeof(int) * (vec->len + 1))); + vec->contents[vec->len] = val; + vec->len++; +} + +/** + * This function get the item at the specified index of the Vector. + * @params Vector* (a pointer to the Vector struct) + * @params int (the index to get value from) + * @returns: int + */ +int get(Vector* vec, int index) { + if(index < vec->len) { + return vec->contents[index]; + } + return -1; +} + +/** + * This function sets an item at the specified index of the Vector. + * @params Vector* (a pointer to the Vector struct) + * @params int (the index to set value at) + * @returns: none + */ +void set(Vector* vec, int index, int val) { + if(index < vec->len) { + vec->contents[index] = val; + } +} + +/** + * This function gets the next item from the Vector each time it's called. + * @params Vector* (a pointer to the Vector struct) + * @returns: int + */ +int next(Vector* vec) { + if(vec->current == vec->len) { + vec->current = 0; + } + int current_val = vec->contents[vec->current]; + vec->current++; + return current_val; +} + +/** + * This function returns the pointer to the begining of the Vector. + * @params Vector* (a pointer to the Vector struct) + * @returns: void* + */ +void* begin(Vector* vec) { + return (void*)vec->contents; +} + +/** + * This function prints the entire Vector as a list. + * @params Vector* (a pointer to the Vector struct) + * @returns: none + */ +void print(Vector* vec) { + int size = vec->len; + printf("[ "); + for(int count = 0; count < size; count++) { + printf("%d ", vec->contents[count]); + } + printf("]\n"); +} + +/** + * This function tests the functions used to work with Vectors. + * @returns: none + */ +static void test() { + Vector vec; + init(&vec, 10); + assert(get(&vec, 0) == 10); + push(&vec, 20); + assert(get(&vec, 1) == 20); + set(&vec, 0, 11); + assert(get(&vec, 0) == 11); + assert(next(&vec) == 11); + set(&vec, 1, 22); + assert(get(&vec, 1) == 22); + assert(len(&vec) == 2); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() { + test(); + + Vector vec; + init(&vec, 10); + push(&vec, 20); + print(&vec); + set(&vec, 0, 11); + set(&vec, 1, 22); + print(&vec); + printf("Length: %d\n", len(&vec)); + return 0; +} From 0d5abe0a77a02a47df710300a4a47a586fd085a3 Mon Sep 17 00:00:00 2001 From: mr-shivamgarg <97354675+mr-shivamgarg@users.noreply.github.com> Date: Thu, 10 Nov 2022 01:04:14 +0530 Subject: [PATCH 025/156] fix: add solution link to LeetCode problem 62 (#1128) --- leetcode/README.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/leetcode/README.md b/leetcode/README.md index 3fcec08e55..1b4f86dd9c 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -25,7 +25,7 @@ | 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position/) | [C](./src/35.c) | Easy | | 38 | [Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c) | Easy | | 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | -| 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | Medium | +| 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | [C](./src/62.c) | Medium | | 63 | [Unique Paths II](https://leetcode.com/problems/unique-paths-ii/) | [C](./src/63.c) | Medium | | 66 | [Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c) | Easy | | 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c) | Medium | From 9101ccd27c62a17a4cad0b72bbff7441d60b12f1 Mon Sep 17 00:00:00 2001 From: David Leal Date: Wed, 9 Nov 2022 19:21:17 -0600 Subject: [PATCH 026/156] docs: add a guide for new LeetCode solutions (#1131) * docs: add a guide for new LeetCode solutions * updating DIRECTORY.md * updating DIRECTORY.md * updating DIRECTORY.md Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> --- CONTRIBUTING.md | 6 +- DIRECTORY.md | 696 +++++++++++++++++++++--------------------- leetcode/DIRECTORY.md | 95 ++++++ leetcode/README.md | 179 +++++------ 4 files changed, 530 insertions(+), 446 deletions(-) create mode 100644 leetcode/DIRECTORY.md diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index 75dc35decd..3d05296e96 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -8,7 +8,7 @@ Welcome to [TheAlgorithms/C](https://github.com/TheAlgorithms/C)! Before submitt ### Maintainer/reviewer -**Please check the [reviewer code](https://github.com/TheAlgorithms/C-Plus-Plus/blob/master/REVIEWER_CODE.md) file for maintainers and reviewers.** +**Please check the [reviewer code](https://github.com/TheAlgorithms/C/blob/master/REVIEWER_CODE.md) file for maintainers and reviewers.** ### Contributor @@ -25,6 +25,10 @@ You can add new algorithms or data structures that are **not present in the repo **Issues** Please avoid opening issues asking to be "assigned” to a particular algorithm. This merely creates unnecessary noise for maintainers. Instead, please submit your implementation in a pull request, and it will be evaluated by project maintainers. +### LeetCode solutions + +For LeetCode solutions, please check its [**guide**](https://github.com/TheAlgorithms/C/blob/master/src/leetcode/README.md) to make a proper solution file. + ### Making Changes #### Code diff --git a/DIRECTORY.md b/DIRECTORY.md index a6e53d03f1..a669f48139 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -1,424 +1,430 @@ ## Audio - * [Alaw](https://github.com/TheAlgorithms/C/blob/master/audio/alaw.c) + * [Alaw](https://github.com/TheAlgorithms/C/blob/HEAD/audio/alaw.c) ## Client Server - * [Client](https://github.com/TheAlgorithms/C/blob/master/client_server/client.c) - * [Remote Command Exec Udp Client](https://github.com/TheAlgorithms/C/blob/master/client_server/remote_command_exec_udp_client.c) - * [Remote Command Exec Udp Server](https://github.com/TheAlgorithms/C/blob/master/client_server/remote_command_exec_udp_server.c) - * [Server](https://github.com/TheAlgorithms/C/blob/master/client_server/server.c) - * [Tcp Full Duplex Client](https://github.com/TheAlgorithms/C/blob/master/client_server/tcp_full_duplex_client.c) - * [Tcp Full Duplex Server](https://github.com/TheAlgorithms/C/blob/master/client_server/tcp_full_duplex_server.c) - * [Tcp Half Duplex Client](https://github.com/TheAlgorithms/C/blob/master/client_server/tcp_half_duplex_client.c) - * [Tcp Half Duplex Server](https://github.com/TheAlgorithms/C/blob/master/client_server/tcp_half_duplex_server.c) - * [Udp Client](https://github.com/TheAlgorithms/C/blob/master/client_server/udp_client.c) - * [Udp Server](https://github.com/TheAlgorithms/C/blob/master/client_server/udp_server.c) + * [Client](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/client.c) + * [Remote Command Exec Udp Client](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/remote_command_exec_udp_client.c) + * [Remote Command Exec Udp Server](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/remote_command_exec_udp_server.c) + * [Server](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/server.c) + * [Tcp Full Duplex Client](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/tcp_full_duplex_client.c) + * [Tcp Full Duplex Server](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/tcp_full_duplex_server.c) + * [Tcp Half Duplex Client](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/tcp_half_duplex_client.c) + * [Tcp Half Duplex Server](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/tcp_half_duplex_server.c) + * [Udp Client](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/udp_client.c) + * [Udp Server](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/udp_server.c) ## Conversions - * [Binary To Decimal](https://github.com/TheAlgorithms/C/blob/master/conversions/binary_to_decimal.c) - * [Binary To Hexadecimal](https://github.com/TheAlgorithms/C/blob/master/conversions/binary_to_hexadecimal.c) - * [Binary To Octal](https://github.com/TheAlgorithms/C/blob/master/conversions/binary_to_octal.c) - * [C Atoi Str To Integer](https://github.com/TheAlgorithms/C/blob/master/conversions/c_atoi_str_to_integer.c) - * [Decimal To Any Base](https://github.com/TheAlgorithms/C/blob/master/conversions/decimal_to_any_base.c) - * [Decimal To Binary](https://github.com/TheAlgorithms/C/blob/master/conversions/decimal_to_binary.c) - * [Decimal To Binary Recursion](https://github.com/TheAlgorithms/C/blob/master/conversions/decimal_to_binary_recursion.c) - * [Decimal To Hexa](https://github.com/TheAlgorithms/C/blob/master/conversions/decimal_to_hexa.c) - * [Decimal To Octal](https://github.com/TheAlgorithms/C/blob/master/conversions/decimal_to_octal.c) - * [Decimal To Octal Recursion](https://github.com/TheAlgorithms/C/blob/master/conversions/decimal_to_octal_recursion.c) - * [Hexadecimal To Octal](https://github.com/TheAlgorithms/C/blob/master/conversions/hexadecimal_to_octal.c) - * [Hexadecimal To Octal2](https://github.com/TheAlgorithms/C/blob/master/conversions/hexadecimal_to_octal2.c) - * [Infix To Postfix](https://github.com/TheAlgorithms/C/blob/master/conversions/infix_to_postfix.c) - * [Infix To Postfix2](https://github.com/TheAlgorithms/C/blob/master/conversions/infix_to_postfix2.c) - * [Int To String](https://github.com/TheAlgorithms/C/blob/master/conversions/int_to_string.c) - * [Octal To Binary](https://github.com/TheAlgorithms/C/blob/master/conversions/octal_to_binary.c) - * [Octal To Decimal](https://github.com/TheAlgorithms/C/blob/master/conversions/octal_to_decimal.c) - * [Octal To Hexadecimal](https://github.com/TheAlgorithms/C/blob/master/conversions/octal_to_hexadecimal.c) - * [To Decimal](https://github.com/TheAlgorithms/C/blob/master/conversions/to_decimal.c) + * [Binary To Decimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/binary_to_decimal.c) + * [Binary To Hexadecimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/binary_to_hexadecimal.c) + * [Binary To Octal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/binary_to_octal.c) + * [C Atoi Str To Integer](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/c_atoi_str_to_integer.c) + * [Decimal To Any Base](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/decimal_to_any_base.c) + * [Decimal To Binary](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/decimal_to_binary.c) + * [Decimal To Binary Recursion](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/decimal_to_binary_recursion.c) + * [Decimal To Hexa](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/decimal_to_hexa.c) + * [Decimal To Octal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/decimal_to_octal.c) + * [Decimal To Octal Recursion](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/decimal_to_octal_recursion.c) + * [Hexadecimal To Octal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/hexadecimal_to_octal.c) + * [Hexadecimal To Octal2](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/hexadecimal_to_octal2.c) + * [Infix To Postfix](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/infix_to_postfix.c) + * [Infix To Postfix2](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/infix_to_postfix2.c) + * [Int To String](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/int_to_string.c) + * [Octal To Binary](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/octal_to_binary.c) + * [Octal To Decimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/octal_to_decimal.c) + * [Octal To Hexadecimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/octal_to_hexadecimal.c) + * [To Decimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/to_decimal.c) ## Data Structures * Array - * [Carray](https://github.com/TheAlgorithms/C/blob/master/data_structures/array/carray.c) - * [Carray](https://github.com/TheAlgorithms/C/blob/master/data_structures/array/carray.h) - * [Carray Tests](https://github.com/TheAlgorithms/C/blob/master/data_structures/array/carray_tests.c) + * [Carray](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/array/carray.c) + * [Carray](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/array/carray.h) + * [Carray Tests](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/array/carray_tests.c) * Binary Trees - * [Avl Tree](https://github.com/TheAlgorithms/C/blob/master/data_structures/binary_trees/avl_tree.c) - * [Binary Search Tree](https://github.com/TheAlgorithms/C/blob/master/data_structures/binary_trees/binary_search_tree.c) - * [Create Node](https://github.com/TheAlgorithms/C/blob/master/data_structures/binary_trees/create_node.c) - * [Recursive Traversals](https://github.com/TheAlgorithms/C/blob/master/data_structures/binary_trees/recursive_traversals.c) - * [Red Black Tree](https://github.com/TheAlgorithms/C/blob/master/data_structures/binary_trees/red_black_tree.c) - * [Segment Tree](https://github.com/TheAlgorithms/C/blob/master/data_structures/binary_trees/segment_tree.c) - * [Threaded Binary Trees](https://github.com/TheAlgorithms/C/blob/master/data_structures/binary_trees/threaded_binary_trees.c) - * [Words Alphabetical](https://github.com/TheAlgorithms/C/blob/master/data_structures/binary_trees/words_alphabetical.c) + * [Avl Tree](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/binary_trees/avl_tree.c) + * [Binary Search Tree](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/binary_trees/binary_search_tree.c) + * [Create Node](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/binary_trees/create_node.c) + * [Recursive Traversals](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/binary_trees/recursive_traversals.c) + * [Red Black Tree](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/binary_trees/red_black_tree.c) + * [Segment Tree](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/binary_trees/segment_tree.c) + * [Threaded Binary Trees](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/binary_trees/threaded_binary_trees.c) + * [Words Alphabetical](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/binary_trees/words_alphabetical.c) * Dictionary - * [Dict](https://github.com/TheAlgorithms/C/blob/master/data_structures/dictionary/dict.c) - * [Dict](https://github.com/TheAlgorithms/C/blob/master/data_structures/dictionary/dict.h) - * [Test Program](https://github.com/TheAlgorithms/C/blob/master/data_structures/dictionary/test_program.c) + * [Dict](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/dictionary/dict.c) + * [Dict](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/dictionary/dict.h) + * [Test Program](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/dictionary/test_program.c) * Dynamic Array - * [Dynamic Array](https://github.com/TheAlgorithms/C/blob/master/data_structures/dynamic_array/dynamic_array.c) - * [Dynamic Array](https://github.com/TheAlgorithms/C/blob/master/data_structures/dynamic_array/dynamic_array.h) - * [Main](https://github.com/TheAlgorithms/C/blob/master/data_structures/dynamic_array/main.c) + * [Dynamic Array](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/dynamic_array/dynamic_array.c) + * [Dynamic Array](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/dynamic_array/dynamic_array.h) + * [Main](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/dynamic_array/main.c) * Graphs - * [Bellman Ford](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/bellman_ford.c) - * [Bfs](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/bfs.c) - * [Bfs Queue](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/bfs_queue.c) - * [Dfs](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/dfs.c) - * [Dfs Recursive](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/dfs_recursive.c) - * [Dijkstra](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/dijkstra.c) - * [Euler](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/euler.c) - * [Floyd Warshall](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/floyd_warshall.c) - * [Graph](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/graph.c) - * [Graph](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/graph.h) - * [Hamiltonian](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/hamiltonian.c) - * [Kruskal](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/kruskal.c) - * [Queue](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/queue.c) - * [Queue](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/queue.h) - * [Strongly Connected Components](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/strongly_connected_components.c) - * [Topological Sort](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/topological_sort.c) - * [Transitive Closure](https://github.com/TheAlgorithms/C/blob/master/data_structures/graphs/transitive_closure.c) + * [Bellman Ford](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/bellman_ford.c) + * [Bfs](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/bfs.c) + * [Bfs Queue](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/bfs_queue.c) + * [Dfs](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/dfs.c) + * [Dfs Recursive](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/dfs_recursive.c) + * [Dijkstra](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/dijkstra.c) + * [Euler](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/euler.c) + * [Floyd Warshall](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/floyd_warshall.c) + * [Graph](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/graph.c) + * [Graph](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/graph.h) + * [Hamiltonian](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/hamiltonian.c) + * [Kruskal](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/kruskal.c) + * [Queue](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/queue.c) + * [Queue](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/queue.h) + * [Strongly Connected Components](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/strongly_connected_components.c) + * [Topological Sort](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/topological_sort.c) + * [Transitive Closure](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/graphs/transitive_closure.c) * Hash Set - * [Hash Set](https://github.com/TheAlgorithms/C/blob/master/data_structures/hash_set/hash_set.c) - * [Hash Set](https://github.com/TheAlgorithms/C/blob/master/data_structures/hash_set/hash_set.h) - * [Main](https://github.com/TheAlgorithms/C/blob/master/data_structures/hash_set/main.c) + * [Hash Set](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/hash_set/hash_set.c) + * [Hash Set](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/hash_set/hash_set.h) + * [Main](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/hash_set/main.c) * Heap - * [Max Heap](https://github.com/TheAlgorithms/C/blob/master/data_structures/heap/max_heap.c) - * [Min Heap](https://github.com/TheAlgorithms/C/blob/master/data_structures/heap/min_heap.c) + * [Max Heap](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/heap/max_heap.c) + * [Min Heap](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/heap/min_heap.c) * Linked List - * [Ascending Priority Queue](https://github.com/TheAlgorithms/C/blob/master/data_structures/linked_list/ascending_priority_queue.c) - * [Circular Linked List](https://github.com/TheAlgorithms/C/blob/master/data_structures/linked_list/circular_linked_list.c) - * [Doubly Linked List](https://github.com/TheAlgorithms/C/blob/master/data_structures/linked_list/doubly_linked_list.c) - * [Merge Linked Lists](https://github.com/TheAlgorithms/C/blob/master/data_structures/linked_list/merge_linked_lists.c) - * [Middle Element In List](https://github.com/TheAlgorithms/C/blob/master/data_structures/linked_list/middle_element_in_list.c) - * [Queue Linked List](https://github.com/TheAlgorithms/C/blob/master/data_structures/linked_list/queue_linked_list.c) - * [Singly Link List Deletion](https://github.com/TheAlgorithms/C/blob/master/data_structures/linked_list/singly_link_list_deletion.c) - * [Stack Using Linked Lists](https://github.com/TheAlgorithms/C/blob/master/data_structures/linked_list/stack_using_linked_lists.c) + * [Ascending Priority Queue](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/ascending_priority_queue.c) + * [Circular Linked List](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/circular_linked_list.c) + * [Doubly Linked List](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/doubly_linked_list.c) + * [Merge Linked Lists](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/merge_linked_lists.c) + * [Middle Element In List](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/middle_element_in_list.c) + * [Queue Linked List](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/queue_linked_list.c) + * [Singly Link List Deletion](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/singly_link_list_deletion.c) + * [Stack Using Linked Lists](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/stack_using_linked_lists.c) * List - * [List](https://github.com/TheAlgorithms/C/blob/master/data_structures/list/list.c) - * [List](https://github.com/TheAlgorithms/C/blob/master/data_structures/list/list.h) - * [Main](https://github.com/TheAlgorithms/C/blob/master/data_structures/list/main.c) + * [List](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/list/list.c) + * [List](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/list/list.h) + * [Main](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/list/main.c) * Queue - * [Include](https://github.com/TheAlgorithms/C/blob/master/data_structures/queue/include.h) - * [Queue](https://github.com/TheAlgorithms/C/blob/master/data_structures/queue/queue.c) - * [Stack](https://github.com/TheAlgorithms/C/blob/master/data_structures/stack.c) + * [Include](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/queue/include.h) + * [Queue](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/queue/queue.c) + * [Stack](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack.c) * Stack - * [Main](https://github.com/TheAlgorithms/C/blob/master/data_structures/stack/main.c) - * [Parenthesis](https://github.com/TheAlgorithms/C/blob/master/data_structures/stack/parenthesis.c) - * [Stack](https://github.com/TheAlgorithms/C/blob/master/data_structures/stack/stack.c) - * [Stack](https://github.com/TheAlgorithms/C/blob/master/data_structures/stack/stack.h) + * [Main](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/main.c) + * [Parenthesis](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/parenthesis.c) + * [Stack](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/stack.c) + * [Stack](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/stack.h) * Stack Linked List - * [Main](https://github.com/TheAlgorithms/C/blob/master/data_structures/stack/stack_linked_list/main.c) - * [Stack](https://github.com/TheAlgorithms/C/blob/master/data_structures/stack/stack_linked_list/stack.c) - * [Stack](https://github.com/TheAlgorithms/C/blob/master/data_structures/stack/stack_linked_list/stack.h) + * [Main](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/stack_linked_list/main.c) + * [Stack](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/stack_linked_list/stack.c) + * [Stack](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/stack_linked_list/stack.h) * Trie - * [Trie](https://github.com/TheAlgorithms/C/blob/master/data_structures/trie/trie.c) + * [Trie](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/trie/trie.c) + * [Vector](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/vector.c) ## Developer Tools - * [Malloc Dbg](https://github.com/TheAlgorithms/C/blob/master/developer_tools/malloc_dbg.c) - * [Malloc Dbg](https://github.com/TheAlgorithms/C/blob/master/developer_tools/malloc_dbg.h) - * [Min Printf](https://github.com/TheAlgorithms/C/blob/master/developer_tools/min_printf.h) - * [Test Malloc Dbg](https://github.com/TheAlgorithms/C/blob/master/developer_tools/test_malloc_dbg.c) - * [Test Min Printf](https://github.com/TheAlgorithms/C/blob/master/developer_tools/test_min_printf.c) + * [Malloc Dbg](https://github.com/TheAlgorithms/C/blob/HEAD/developer_tools/malloc_dbg.c) + * [Malloc Dbg](https://github.com/TheAlgorithms/C/blob/HEAD/developer_tools/malloc_dbg.h) + * [Min Printf](https://github.com/TheAlgorithms/C/blob/HEAD/developer_tools/min_printf.h) + * [Test Malloc Dbg](https://github.com/TheAlgorithms/C/blob/HEAD/developer_tools/test_malloc_dbg.c) + * [Test Min Printf](https://github.com/TheAlgorithms/C/blob/HEAD/developer_tools/test_min_printf.c) ## Exercism * Acronym - * [Acronym](https://github.com/TheAlgorithms/C/blob/master/exercism/acronym/acronym.c) - * [Acronym](https://github.com/TheAlgorithms/C/blob/master/exercism/acronym/acronym.h) + * [Acronym](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/acronym/acronym.c) + * [Acronym](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/acronym/acronym.h) * Hello World - * [Hello World](https://github.com/TheAlgorithms/C/blob/master/exercism/hello_world/hello_world.c) - * [Hello World](https://github.com/TheAlgorithms/C/blob/master/exercism/hello_world/hello_world.h) + * [Hello World](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/hello_world/hello_world.c) + * [Hello World](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/hello_world/hello_world.h) * Isogram - * [Isogram](https://github.com/TheAlgorithms/C/blob/master/exercism/isogram/isogram.c) - * [Isogram](https://github.com/TheAlgorithms/C/blob/master/exercism/isogram/isogram.h) + * [Isogram](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/isogram/isogram.c) + * [Isogram](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/isogram/isogram.h) * Rna Transcription - * [Rna Transcription](https://github.com/TheAlgorithms/C/blob/master/exercism/rna_transcription/rna_transcription.c) - * [Rna Transcription](https://github.com/TheAlgorithms/C/blob/master/exercism/rna_transcription/rna_transcription.h) + * [Rna Transcription](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/rna_transcription/rna_transcription.c) + * [Rna Transcription](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/rna_transcription/rna_transcription.h) * Word Count - * [Word Count](https://github.com/TheAlgorithms/C/blob/master/exercism/word_count/word_count.c) - * [Word Count](https://github.com/TheAlgorithms/C/blob/master/exercism/word_count/word_count.h) + * [Word Count](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/word_count/word_count.c) + * [Word Count](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/word_count/word_count.h) ## Games - * [Naval Battle](https://github.com/TheAlgorithms/C/blob/master/games/naval_battle.c) - * [Tic Tac Toe](https://github.com/TheAlgorithms/C/blob/master/games/tic_tac_toe.c) + * [Naval Battle](https://github.com/TheAlgorithms/C/blob/HEAD/games/naval_battle.c) + * [Tic Tac Toe](https://github.com/TheAlgorithms/C/blob/HEAD/games/tic_tac_toe.c) ## Geometry - * [Geometry Datatypes](https://github.com/TheAlgorithms/C/blob/master/geometry/geometry_datatypes.h) - * [Quaternions](https://github.com/TheAlgorithms/C/blob/master/geometry/quaternions.c) - * [Vectors 3D](https://github.com/TheAlgorithms/C/blob/master/geometry/vectors_3d.c) + * [Geometry Datatypes](https://github.com/TheAlgorithms/C/blob/HEAD/geometry/geometry_datatypes.h) + * [Quaternions](https://github.com/TheAlgorithms/C/blob/HEAD/geometry/quaternions.c) + * [Vectors 3D](https://github.com/TheAlgorithms/C/blob/HEAD/geometry/vectors_3d.c) ## Graphics - * [Spirograph](https://github.com/TheAlgorithms/C/blob/master/graphics/spirograph.c) + * [Spirograph](https://github.com/TheAlgorithms/C/blob/HEAD/graphics/spirograph.c) ## Greedy Approach - * [Dijkstra](https://github.com/TheAlgorithms/C/blob/master/greedy_approach/dijkstra.c) - * [Prim](https://github.com/TheAlgorithms/C/blob/master/greedy_approach/prim.c) + * [Dijkstra](https://github.com/TheAlgorithms/C/blob/HEAD/greedy_approach/dijkstra.c) + * [Prim](https://github.com/TheAlgorithms/C/blob/HEAD/greedy_approach/prim.c) ## Hash - * [Hash Adler32](https://github.com/TheAlgorithms/C/blob/master/hash/hash_adler32.c) - * [Hash Crc32](https://github.com/TheAlgorithms/C/blob/master/hash/hash_crc32.c) - * [Hash Djb2](https://github.com/TheAlgorithms/C/blob/master/hash/hash_djb2.c) - * [Hash Sdbm](https://github.com/TheAlgorithms/C/blob/master/hash/hash_sdbm.c) - * [Hash Xor8](https://github.com/TheAlgorithms/C/blob/master/hash/hash_xor8.c) + * [Hash Adler32](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_adler32.c) + * [Hash Crc32](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_crc32.c) + * [Hash Djb2](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_djb2.c) + * [Hash Sdbm](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_sdbm.c) + * [Hash Xor8](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_xor8.c) ## Leetcode * Src - * [1](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/1.c) - * [101](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/101.c) - * [104](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/104.c) - * [108](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/108.c) - * [1089](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/1089.c) - * [109](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/109.c) - * [11](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/11.c) - * [110](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/110.c) - * [112](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/112.c) - * [118](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/118.c) - * [1184](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/1184.c) - * [1189](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/1189.c) - * [12](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/12.c) - * [1207](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/1207.c) - * [121](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/121.c) - * [125](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/125.c) - * [13](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/13.c) - * [136](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/136.c) - * [141](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/141.c) - * [142](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/142.c) - * [153](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/153.c) - * [160](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/160.c) - * [169](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/169.c) - * [173](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/173.c) - * [189](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/189.c) - * [190](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/190.c) - * [191](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/191.c) - * [2](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/2.c) - * [20](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/20.c) - * [201](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/201.c) - * [203](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/203.c) - * [206](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/206.c) - * [21](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/21.c) - * [2130](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/2130.c) - * [215](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/215.c) - * [217](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/217.c) - * [226](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/226.c) - * [231](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/231.c) - * [234](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/234.c) - * [24](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/24.c) - * [242](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/242.c) - * [26](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/26.c) - * [268](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/268.c) - * [27](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/27.c) - * [278](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/278.c) - * [28](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/28.c) - * [283](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/283.c) - * [287](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/287.c) - * [29](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/29.c) - * [3](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/3.c) - * [344](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/344.c) - * [35](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/35.c) - * [367](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/367.c) - * [38](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/38.c) - * [387](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/387.c) - * [389](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/389.c) - * [4](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/4.c) - * [404](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/404.c) - * [442](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/442.c) - * [461](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/461.c) - * [476](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/476.c) - * [509](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/509.c) - * [520](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/520.c) - * [53](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/53.c) - * [561](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/561.c) - * [6](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/6.c) - * [617](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/617.c) - * [62](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/62.c) - * [647](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/647.c) - * [66](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/66.c) - * [674](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/674.c) - * [7](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/7.c) - * [700](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/700.c) - * [701](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/701.c) - * [704](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/704.c) - * [709](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/709.c) - * [771](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/771.c) - * [8](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/8.c) - * [82](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/82.c) - * [83](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/83.c) - * [852](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/852.c) - * [876](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/876.c) - * [9](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/9.c) - * [905](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/905.c) - * [917](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/917.c) - * [938](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/938.c) - * [94](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/94.c) - * [965](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/965.c) - * [977](https://github.com/TheAlgorithms/C/blob/master/leetcode/src/977.c) + * [1](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1.c) + * [1008](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1008.c) + * [101](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/101.c) + * [1019](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1019.c) + * [104](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/104.c) + * [108](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/108.c) + * [1089](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1089.c) + * [109](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/109.c) + * [11](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/11.c) + * [110](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/110.c) + * [112](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/112.c) + * [118](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/118.c) + * [1184](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1184.c) + * [1189](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1189.c) + * [119](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/119.c) + * [12](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/12.c) + * [1207](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1207.c) + * [121](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/121.c) + * [125](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/125.c) + * [13](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/13.c) + * [136](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/136.c) + * [141](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/141.c) + * [142](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/142.c) + * [153](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/153.c) + * [160](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/160.c) + * [169](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/169.c) + * [173](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/173.c) + * [189](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/189.c) + * [190](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/190.c) + * [191](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/191.c) + * [2](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2.c) + * [20](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/20.c) + * [201](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/201.c) + * [203](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/203.c) + * [206](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/206.c) + * [21](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/21.c) + * [2130](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2130.c) + * [215](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/215.c) + * [217](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/217.c) + * [226](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/226.c) + * [231](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/231.c) + * [234](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/234.c) + * [24](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/24.c) + * [242](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/242.c) + * [26](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/26.c) + * [268](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/268.c) + * [27](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/27.c) + * [278](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/278.c) + * [28](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/28.c) + * [283](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/283.c) + * [287](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/287.c) + * [29](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/29.c) + * [3](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/3.c) + * [344](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/344.c) + * [35](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/35.c) + * [367](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/367.c) + * [38](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/38.c) + * [387](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/387.c) + * [389](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/389.c) + * [4](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/4.c) + * [404](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/404.c) + * [442](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/442.c) + * [461](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/461.c) + * [476](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/476.c) + * [485](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/485.c) + * [509](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/509.c) + * [520](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/520.c) + * [53](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/53.c) + * [561](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/561.c) + * [6](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/6.c) + * [617](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/617.c) + * [62](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/62.c) + * [63](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/63.c) + * [647](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/647.c) + * [66](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/66.c) + * [674](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/674.c) + * [7](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/7.c) + * [700](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/700.c) + * [701](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/701.c) + * [704](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/704.c) + * [709](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/709.c) + * [771](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/771.c) + * [8](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/8.c) + * [82](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/82.c) + * [83](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/83.c) + * [852](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/852.c) + * [876](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/876.c) + * [9](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/9.c) + * [905](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/905.c) + * [917](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/917.c) + * [938](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/938.c) + * [94](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/94.c) + * [965](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/965.c) + * [977](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/977.c) ## Machine Learning - * [Adaline Learning](https://github.com/TheAlgorithms/C/blob/master/machine_learning/adaline_learning.c) - * [K Means Clustering](https://github.com/TheAlgorithms/C/blob/master/machine_learning/k_means_clustering.c) - * [Kohonen Som Topology](https://github.com/TheAlgorithms/C/blob/master/machine_learning/kohonen_som_topology.c) - * [Kohonen Som Trace](https://github.com/TheAlgorithms/C/blob/master/machine_learning/kohonen_som_trace.c) + * [Adaline Learning](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/adaline_learning.c) + * [K Means Clustering](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/k_means_clustering.c) + * [Kohonen Som Topology](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/kohonen_som_topology.c) + * [Kohonen Som Trace](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/kohonen_som_trace.c) ## Misc - * [Armstrong Number](https://github.com/TheAlgorithms/C/blob/master/misc/armstrong_number.c) - * [Cantor Set](https://github.com/TheAlgorithms/C/blob/master/misc/cantor_set.c) - * [Cartesian To Polar](https://github.com/TheAlgorithms/C/blob/master/misc/cartesian_to_polar.c) - * [Catalan](https://github.com/TheAlgorithms/C/blob/master/misc/catalan.c) - * [Collatz](https://github.com/TheAlgorithms/C/blob/master/misc/collatz.c) - * [Demonetization](https://github.com/TheAlgorithms/C/blob/master/misc/demonetization.c) - * [Factorial](https://github.com/TheAlgorithms/C/blob/master/misc/factorial.c) - * [Factorial Large Number](https://github.com/TheAlgorithms/C/blob/master/misc/factorial_large_number.c) - * [Factorial Trailing Zeroes](https://github.com/TheAlgorithms/C/blob/master/misc/factorial_trailing_zeroes.c) - * [Fibonacci](https://github.com/TheAlgorithms/C/blob/master/misc/fibonacci.c) - * [Fibonacci Dp](https://github.com/TheAlgorithms/C/blob/master/misc/fibonacci_dp.c) - * [Fibonacci Fast](https://github.com/TheAlgorithms/C/blob/master/misc/fibonacci_fast.c) - * [Fibonacci Formula](https://github.com/TheAlgorithms/C/blob/master/misc/fibonacci_formula.c) - * [Gcd](https://github.com/TheAlgorithms/C/blob/master/misc/gcd.c) - * [Is Armstrong](https://github.com/TheAlgorithms/C/blob/master/misc/is_armstrong.c) - * [Large Factorials](https://github.com/TheAlgorithms/C/blob/master/misc/large_factorials.c) - * [Lcm](https://github.com/TheAlgorithms/C/blob/master/misc/lcm.c) - * [Lerp](https://github.com/TheAlgorithms/C/blob/master/misc/lerp.c) - * [Lexicographic Permutations](https://github.com/TheAlgorithms/C/blob/master/misc/lexicographic_permutations.c) - * [Longest Subsequence](https://github.com/TheAlgorithms/C/blob/master/misc/longest_subsequence.c) - * [Mirror](https://github.com/TheAlgorithms/C/blob/master/misc/mirror.c) - * [Palindrome](https://github.com/TheAlgorithms/C/blob/master/misc/palindrome.c) - * [Pid](https://github.com/TheAlgorithms/C/blob/master/misc/pid.c) - * [Poly Add](https://github.com/TheAlgorithms/C/blob/master/misc/poly_add.c) - * [Postfix Evaluation](https://github.com/TheAlgorithms/C/blob/master/misc/postfix_evaluation.c) - * [Prime](https://github.com/TheAlgorithms/C/blob/master/misc/prime.c) - * [Prime Factoriziation](https://github.com/TheAlgorithms/C/blob/master/misc/prime_factoriziation.c) - * [Prime Seive](https://github.com/TheAlgorithms/C/blob/master/misc/prime_seive.c) - * [Quartile](https://github.com/TheAlgorithms/C/blob/master/misc/quartile.c) - * [Rselect](https://github.com/TheAlgorithms/C/blob/master/misc/rselect.c) - * [Run Length Encoding](https://github.com/TheAlgorithms/C/blob/master/misc/run_length_encoding.c) - * [Strong Number](https://github.com/TheAlgorithms/C/blob/master/misc/strong_number.c) - * [Sudoku Solver](https://github.com/TheAlgorithms/C/blob/master/misc/sudoku_solver.c) - * [Tower Of Hanoi](https://github.com/TheAlgorithms/C/blob/master/misc/tower_of_hanoi.c) - * [Union Find](https://github.com/TheAlgorithms/C/blob/master/misc/union_find.c) + * [Armstrong Number](https://github.com/TheAlgorithms/C/blob/HEAD/misc/armstrong_number.c) + * [Cantor Set](https://github.com/TheAlgorithms/C/blob/HEAD/misc/cantor_set.c) + * [Cartesian To Polar](https://github.com/TheAlgorithms/C/blob/HEAD/misc/cartesian_to_polar.c) + * [Catalan](https://github.com/TheAlgorithms/C/blob/HEAD/misc/catalan.c) + * [Collatz](https://github.com/TheAlgorithms/C/blob/HEAD/misc/collatz.c) + * [Demonetization](https://github.com/TheAlgorithms/C/blob/HEAD/misc/demonetization.c) + * [Factorial](https://github.com/TheAlgorithms/C/blob/HEAD/misc/factorial.c) + * [Factorial Large Number](https://github.com/TheAlgorithms/C/blob/HEAD/misc/factorial_large_number.c) + * [Factorial Trailing Zeroes](https://github.com/TheAlgorithms/C/blob/HEAD/misc/factorial_trailing_zeroes.c) + * [Fibonacci](https://github.com/TheAlgorithms/C/blob/HEAD/misc/fibonacci.c) + * [Fibonacci Dp](https://github.com/TheAlgorithms/C/blob/HEAD/misc/fibonacci_dp.c) + * [Fibonacci Fast](https://github.com/TheAlgorithms/C/blob/HEAD/misc/fibonacci_fast.c) + * [Fibonacci Formula](https://github.com/TheAlgorithms/C/blob/HEAD/misc/fibonacci_formula.c) + * [Gcd](https://github.com/TheAlgorithms/C/blob/HEAD/misc/gcd.c) + * [Is Armstrong](https://github.com/TheAlgorithms/C/blob/HEAD/misc/is_armstrong.c) + * [Large Factorials](https://github.com/TheAlgorithms/C/blob/HEAD/misc/large_factorials.c) + * [Lcm](https://github.com/TheAlgorithms/C/blob/HEAD/misc/lcm.c) + * [Lerp](https://github.com/TheAlgorithms/C/blob/HEAD/misc/lerp.c) + * [Lexicographic Permutations](https://github.com/TheAlgorithms/C/blob/HEAD/misc/lexicographic_permutations.c) + * [Longest Subsequence](https://github.com/TheAlgorithms/C/blob/HEAD/misc/longest_subsequence.c) + * [Mirror](https://github.com/TheAlgorithms/C/blob/HEAD/misc/mirror.c) + * [Palindrome](https://github.com/TheAlgorithms/C/blob/HEAD/misc/palindrome.c) + * [Pid](https://github.com/TheAlgorithms/C/blob/HEAD/misc/pid.c) + * [Poly Add](https://github.com/TheAlgorithms/C/blob/HEAD/misc/poly_add.c) + * [Postfix Evaluation](https://github.com/TheAlgorithms/C/blob/HEAD/misc/postfix_evaluation.c) + * [Prime](https://github.com/TheAlgorithms/C/blob/HEAD/misc/prime.c) + * [Prime Factoriziation](https://github.com/TheAlgorithms/C/blob/HEAD/misc/prime_factoriziation.c) + * [Prime Seive](https://github.com/TheAlgorithms/C/blob/HEAD/misc/prime_seive.c) + * [Quartile](https://github.com/TheAlgorithms/C/blob/HEAD/misc/quartile.c) + * [Rselect](https://github.com/TheAlgorithms/C/blob/HEAD/misc/rselect.c) + * [Run Length Encoding](https://github.com/TheAlgorithms/C/blob/HEAD/misc/run_length_encoding.c) + * [Strong Number](https://github.com/TheAlgorithms/C/blob/HEAD/misc/strong_number.c) + * [Sudoku Solver](https://github.com/TheAlgorithms/C/blob/HEAD/misc/sudoku_solver.c) + * [Tower Of Hanoi](https://github.com/TheAlgorithms/C/blob/HEAD/misc/tower_of_hanoi.c) + * [Union Find](https://github.com/TheAlgorithms/C/blob/HEAD/misc/union_find.c) ## Numerical Methods - * [Durand Kerner Roots](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/durand_kerner_roots.c) - * [Gauss Elimination](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/gauss_elimination.c) - * [Gauss Seidel Method](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/gauss_seidel_method.c) - * [Lagrange Theorem](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/lagrange_theorem.c) - * [Lu Decompose](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/lu_decompose.c) - * [Mean](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/mean.c) - * [Median](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/median.c) - * [Newton Raphson Root](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/newton_raphson_root.c) - * [Ode Forward Euler](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/ode_forward_euler.c) - * [Ode Midpoint Euler](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/ode_midpoint_euler.c) - * [Ode Semi Implicit Euler](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/ode_semi_implicit_euler.c) - * [Qr Decompose](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/qr_decompose.h) - * [Qr Decomposition](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/qr_decomposition.c) - * [Qr Eigen Values](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/qr_eigen_values.c) - * [Realtime Stats](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/realtime_stats.c) - * [Simpsons 1 3Rd Rule](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/simpsons_1_3rd_rule.c) - * [Variance](https://github.com/TheAlgorithms/C/blob/master/numerical_methods/variance.c) + * [Durand Kerner Roots](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/durand_kerner_roots.c) + * [Gauss Elimination](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/gauss_elimination.c) + * [Gauss Seidel Method](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/gauss_seidel_method.c) + * [Lagrange Theorem](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/lagrange_theorem.c) + * [Lu Decompose](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/lu_decompose.c) + * [Mean](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/mean.c) + * [Median](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/median.c) + * [Newton Raphson Root](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/newton_raphson_root.c) + * [Ode Forward Euler](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/ode_forward_euler.c) + * [Ode Midpoint Euler](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/ode_midpoint_euler.c) + * [Ode Semi Implicit Euler](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/ode_semi_implicit_euler.c) + * [Qr Decompose](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/qr_decompose.h) + * [Qr Decomposition](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/qr_decomposition.c) + * [Qr Eigen Values](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/qr_eigen_values.c) + * [Realtime Stats](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/realtime_stats.c) + * [Simpsons 1 3Rd Rule](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/simpsons_1_3rd_rule.c) + * [Variance](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/variance.c) ## Project Euler * Problem 1 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_1/sol1.c) - * [Sol2](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_1/sol2.c) - * [Sol3](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_1/sol3.c) - * [Sol4](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_1/sol4.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_1/sol1.c) + * [Sol2](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_1/sol2.c) + * [Sol3](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_1/sol3.c) + * [Sol4](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_1/sol4.c) * Problem 10 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_10/sol1.c) - * [Sol2](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_10/sol2.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_10/sol1.c) + * [Sol2](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_10/sol2.c) * Problem 12 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_12/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_12/sol1.c) * Problem 13 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_13/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_13/sol1.c) * Problem 14 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_14/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_14/sol1.c) * Problem 15 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_15/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_15/sol1.c) * Problem 16 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_16/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_16/sol1.c) * Problem 19 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_19/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_19/sol1.c) * Problem 2 - * [So1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_2/so1.c) + * [So1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_2/so1.c) * Problem 20 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_20/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_20/sol1.c) * Problem 21 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_21/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_21/sol1.c) * Problem 22 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_22/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_22/sol1.c) * Problem 23 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_23/sol1.c) - * [Sol2](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_23/sol2.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_23/sol1.c) + * [Sol2](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_23/sol2.c) * Problem 25 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_25/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_25/sol1.c) * Problem 26 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_26/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_26/sol1.c) * Problem 3 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_3/sol1.c) - * [Sol2](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_3/sol2.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_3/sol1.c) + * [Sol2](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_3/sol2.c) * Problem 4 - * [Sol](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_4/sol.c) + * [Sol](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_4/sol.c) * Problem 401 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_401/sol1.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_401/sol1.c) * Problem 5 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_5/sol1.c) - * [Sol2](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_5/sol2.c) - * [Sol3](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_5/sol3.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_5/sol1.c) + * [Sol2](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_5/sol2.c) + * [Sol3](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_5/sol3.c) * Problem 6 - * [Sol](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_6/sol.c) + * [Sol](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_6/sol.c) * Problem 7 - * [Sol](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_7/sol.c) - * [Sol2](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_7/sol2.c) + * [Sol](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_7/sol.c) + * [Sol2](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_7/sol2.c) * Problem 8 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_8/sol1.c) - * [Sol2](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_8/sol2.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_8/sol1.c) + * [Sol2](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_8/sol2.c) * Problem 9 - * [Sol1](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_9/sol1.c) - * [Sol2](https://github.com/TheAlgorithms/C/blob/master/project_euler/problem_9/sol2.c) + * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_9/sol1.c) + * [Sol2](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_9/sol2.c) ## Searching - * [Binary Search](https://github.com/TheAlgorithms/C/blob/master/searching/binary_search.c) - * [Exponential Search](https://github.com/TheAlgorithms/C/blob/master/searching/exponential_search.c) - * [Fibonacci Search](https://github.com/TheAlgorithms/C/blob/master/searching/fibonacci_search.c) - * [Floyd Cycle Detection Algorithm](https://github.com/TheAlgorithms/C/blob/master/searching/floyd_cycle_detection_algorithm.c) - * [Interpolation Search](https://github.com/TheAlgorithms/C/blob/master/searching/interpolation_search.c) - * [Jump Search](https://github.com/TheAlgorithms/C/blob/master/searching/jump_search.c) - * [Linear Search](https://github.com/TheAlgorithms/C/blob/master/searching/linear_search.c) - * [Modified Binary Search](https://github.com/TheAlgorithms/C/blob/master/searching/modified_binary_search.c) - * [Other Binary Search](https://github.com/TheAlgorithms/C/blob/master/searching/other_binary_search.c) + * [Binary Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/binary_search.c) + * [Exponential Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/exponential_search.c) + * [Fibonacci Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/fibonacci_search.c) + * [Floyd Cycle Detection Algorithm](https://github.com/TheAlgorithms/C/blob/HEAD/searching/floyd_cycle_detection_algorithm.c) + * [Interpolation Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/interpolation_search.c) + * [Jump Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/jump_search.c) + * [Linear Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/linear_search.c) + * [Modified Binary Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/modified_binary_search.c) + * [Other Binary Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/other_binary_search.c) * Pattern Search - * [Boyer Moore Search](https://github.com/TheAlgorithms/C/blob/master/searching/pattern_search/boyer_moore_search.c) - * [Naive Search](https://github.com/TheAlgorithms/C/blob/master/searching/pattern_search/naive_search.c) - * [Rabin Karp Search](https://github.com/TheAlgorithms/C/blob/master/searching/pattern_search/rabin_karp_search.c) - * [Sentinel Linear Search](https://github.com/TheAlgorithms/C/blob/master/searching/sentinel_linear_search.c) - * [Ternary Search](https://github.com/TheAlgorithms/C/blob/master/searching/ternary_search.c) + * [Boyer Moore Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/pattern_search/boyer_moore_search.c) + * [Naive Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/pattern_search/naive_search.c) + * [Rabin Karp Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/pattern_search/rabin_karp_search.c) + * [Sentinel Linear Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/sentinel_linear_search.c) + * [Ternary Search](https://github.com/TheAlgorithms/C/blob/HEAD/searching/ternary_search.c) ## Sorting - * [Bead Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/bead_sort.c) - * [Binary Insertion Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/binary_insertion_sort.c) - * [Bogo Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/bogo_sort.c) - * [Bubble Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/bubble_sort.c) - * [Bubble Sort 2](https://github.com/TheAlgorithms/C/blob/master/sorting/bubble_sort_2.c) - * [Bubble Sort Recursion](https://github.com/TheAlgorithms/C/blob/master/sorting/bubble_sort_recursion.c) - * [Bucket Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/bucket_sort.c) - * [Cocktail Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/cocktail_sort.c) - * [Comb Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/comb_sort.c) - * [Counting Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/counting_sort.c) - * [Cycle Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/cycle_sort.c) - * [Gnome Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/gnome_sort.c) - * [Heap Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/heap_sort.c) - * [Heap Sort 2](https://github.com/TheAlgorithms/C/blob/master/sorting/heap_sort_2.c) - * [Insertion Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/insertion_sort.c) - * [Insertion Sort Recursive](https://github.com/TheAlgorithms/C/blob/master/sorting/insertion_sort_recursive.c) - * [Merge Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/merge_sort.c) - * [Merge Sort Nr](https://github.com/TheAlgorithms/C/blob/master/sorting/merge_sort_nr.c) - * [Multikey Quick Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/multikey_quick_sort.c) - * [Odd Even Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/odd_even_sort.c) - * [Pancake Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/pancake_sort.c) - * [Partition Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/partition_sort.c) - * [Pigeonhole Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/pigeonhole_sort.c) - * [Quick Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/quick_sort.c) - * [Radix Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/radix_sort.c) - * [Radix Sort 2](https://github.com/TheAlgorithms/C/blob/master/sorting/radix_sort_2.c) - * [Random Quick Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/random_quick_sort.c) - * [Selection Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/selection_sort.c) - * [Selection Sort Recursive](https://github.com/TheAlgorithms/C/blob/master/sorting/selection_sort_recursive.c) - * [Shaker Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/shaker_sort.c) - * [Shell Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/shell_sort.c) - * [Shell Sort2](https://github.com/TheAlgorithms/C/blob/master/sorting/shell_sort2.c) - * [Stooge Sort](https://github.com/TheAlgorithms/C/blob/master/sorting/stooge_sort.c) + * [Bead Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/bead_sort.c) + * [Binary Insertion Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/binary_insertion_sort.c) + * [Bogo Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/bogo_sort.c) + * [Bubble Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/bubble_sort.c) + * [Bubble Sort 2](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/bubble_sort_2.c) + * [Bubble Sort Recursion](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/bubble_sort_recursion.c) + * [Bucket Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/bucket_sort.c) + * [Cocktail Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/cocktail_sort.c) + * [Comb Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/comb_sort.c) + * [Counting Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/counting_sort.c) + * [Cycle Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/cycle_sort.c) + * [Gnome Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/gnome_sort.c) + * [Heap Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/heap_sort.c) + * [Heap Sort 2](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/heap_sort_2.c) + * [Insertion Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/insertion_sort.c) + * [Insertion Sort Recursive](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/insertion_sort_recursive.c) + * [Merge Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/merge_sort.c) + * [Merge Sort Nr](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/merge_sort_nr.c) + * [Multikey Quick Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/multikey_quick_sort.c) + * [Odd Even Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/odd_even_sort.c) + * [Pancake Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/pancake_sort.c) + * [Partition Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/partition_sort.c) + * [Pigeonhole Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/pigeonhole_sort.c) + * [Quick Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/quick_sort.c) + * [Radix Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/radix_sort.c) + * [Radix Sort 2](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/radix_sort_2.c) + * [Random Quick Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/random_quick_sort.c) + * [Selection Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/selection_sort.c) + * [Selection Sort Recursive](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/selection_sort_recursive.c) + * [Shaker Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/shaker_sort.c) + * [Shell Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/shell_sort.c) + * [Shell Sort2](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/shell_sort2.c) + * [Stooge Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/stooge_sort.c) diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md new file mode 100644 index 0000000000..0de9c220b0 --- /dev/null +++ b/leetcode/DIRECTORY.md @@ -0,0 +1,95 @@ +# LeetCode + +### LeetCode Algorithm + +| # | Title | Solution | Difficulty | +| ---- | ------------------------------------------------------------------------------------------------------------------------------- | ----------------- | ---------- | +| 1 | [Two Sum](https://leetcode.com/problems/two-sum/) | [C](./src/1.c) | Easy | +| 2 | [Add Two Numbers](https://leetcode.com/problems/add-two-numbers/) | [C](./src/2.c) | Medium | +| 3 | [Longest Substring Without Repeating Characters](https://leetcode.com/problems/longest-substring-without-repeating-characters/) | [C](./src/3.c) | Medium | +| 4 | [Median of Two Sorted Arrays](https://leetcode.com/problems/median-of-two-sorted-arrays/) | [C](./src/4.c) | Hard | +| 6 | [ZigZag conversion](https://leetcode.com/problems/zigzag-conversion/) | [C](./src/4.c) | Medium | +| 7 | [Reverse Integer](https://leetcode.com/problems/reverse-integer/) | [C](./src/7.c) | Easy | +| 8 | [String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c) | Medium | +| 9 | [Palindrome Number](https://leetcode.com/problems/palindrome-number/) | [C](./src/9.c) | Easy | +| 11 | [Container With Most Water](https://leetcode.com/problems/container-with-most-water/) | [C](./src/11.c) | Medium | +| 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | +| 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer/) | [C](./src/13.c) | Easy | +| 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses/) | [C](./src/20.c) | Easy | +| 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists/) | [C](./src/21.c) | Easy | +| 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs/) | [C](./src/24.c) | Medium | +| 26 | [Remove Duplicates from Sorted Array](https://leetcode.com/problems/remove-duplicates-from-sorted-array/) | [C](./src/26.c) | Easy | +| 27 | [Remove Element](https://leetcode.com/problems/remove-element/) | [C](./src/27.c) | Easy | +| 28 | [Implement strStr()](https://leetcode.com/problems/implement-strstr/) | [C](./src/28.c) | Easy | +| 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers/) | [C](./src/29.c) | Medium | +| 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position/) | [C](./src/35.c) | Easy | +| 38 | [Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c) | Easy | +| 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | +| 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | [C](./src/62.c) | Medium | +| 66 | [Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c) | Easy | +| 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c) | Medium | +| 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list/) | [C](./src/83.c) | Easy | +| 94 | [Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal/) | [C](./src/94.c) | Medium | +| 101 | [Symmetric Tree](https://leetcode.com/problems/symmetric-tree/) | [C](./src/101.c) | Easy | +| 104 | [Maximum Depth of Binary Tree](https://leetcode.com/problems/maximum-depth-of-binary-tree/) | [C](./src/104.c) | Easy | +| 108 | [Convert Sorted Array to Binary Search Tree](https://leetcode.com/problems/convert-sorted-array-to-binary-search-tree/) | [C](./src/108.c) | Easy | +| 109 | [Convert Sorted List to Binary Search Tree](https://leetcode.com/problems/convert-sorted-list-to-binary-search-tree/) | [C](./src/109.c) | Medium | +| 110 | [Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree/) | [C](./src/110.c) | Easy | +| 112 | [Path Sum](https://leetcode.com/problems/path-sum/) | [C](./src/112.c) | Easy | +| 118 | [Pascal's Triangle](https://leetcode.com/problems/pascals-triangle/) | [C](./src/118.c) | Easy | +| 121 | [Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock/) | [C](./src/121.c) | Easy | +| 125 | [Valid Palindrome](https://leetcode.com/problems/valid-palindrome/) | [C](./src/125.c) | Easy | +| 136 | [Single Number](https://leetcode.com/problems/single-number/) | [C](./src/136.c) | Easy | +| 141 | [Linked List Cycle](https://leetcode.com/problems/linked-list-cycle/) | [C](./src/141.c) | Easy | +| 142 | [Linked List Cycle II](https://leetcode.com/problems/linked-list-cycle-ii/) | [C](./src/142.c) | Medium | +| 153 | [Find Minimum in Rotated Sorted Array](https://leetcode.com/problems/find-minimum-in-rotated-sorted-array/) | [C](./src/153.c) | Medium | +| 160 | [Intersection of Two Linked Lists](https://leetcode.com/problems/intersection-of-two-linked-lists/) | [C](./src/160.c) | Easy | +| 169 | [Majority Element](https://leetcode.com/problems/majority-element/) | [C](./src/169.c) | Easy | +| 173 | [Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator/) | [C](./src/173.c) | Medium | +| 189 | [Rotate Array](https://leetcode.com/problems/rotate-array) | [C](./src/189.c) | Easy | +| 190 | [Reverse Bits](https://leetcode.com/problems/reverse-bits/) | [C](./src/190.c) | Easy | +| 191 | [Number of 1 Bits](https://leetcode.com/problems/number-of-1-bits/) | [C](./src/191.c) | Easy | +| 201 | [Bitwise AND of Numbers Range](https://leetcode.com/problems/bitwise-and-of-numbers-range/) | [C](./src/201.c) | Medium | +| 203 | [Remove Linked List Elements](https://leetcode.com/problems/remove-linked-list-elements/) | [C](./src/203.c) | Easy | +| 206 | [Reverse Linked List](https://leetcode.com/problems/reverse-linked-list/) | [C](./src/206.c) | Easy | +| 215 | [Kth Largest Element in an Array](https://leetcode.com/problems/kth-largest-element-in-an-array/) | [C](./src/215.c) | Medium | +| 217 | [Contains Duplicate](https://leetcode.com/problems/contains-duplicate/) | [C](./src/217.c) | Easy | +| 226 | [Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree/) | [C](./src/226.c) | Easy | +| 231 | [Power of Two](https://leetcode.com/problems/power-of-two/) | [C](./src/231.c) | Easy | +| 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list/) | [C](./src/234.c) | Easy | +| 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram/) | [C](./src/242.c) | Easy | +| 268 | [Missing Number](https://leetcode.com/problems/missing-number/) | [C](./src/268.c) | Easy | +| 278 | [First Bad Version](https://leetcode.com/problems/first-bad-version/) | [C](./src/278.c) | Easy | +| 283 | [Move Zeroes](https://leetcode.com/problems/move-zeroes/) | [C](./src/283.c) | Easy | +| 287 | [Find the Duplicate Number](https://leetcode.com/problems/find-the-duplicate-number/) | [C](./src/287.c) | Medium | +| 344 | [Reverse String](https://leetcode.com/problems/reverse-string/) | [C](./src/344.c) | Easy | +| 367 | [Valid Perfect Square](https://leetcode.com/problems/valid-perfect-square/) | [C](./src/367.c) | Easy | +| 387 | [First Unique Character in a String](https://leetcode.com/problems/first-unique-character-in-a-string/) | [C](./src/387.c) | Easy | +| 389 | [Find the Difference](https://leetcode.com/problems/find-the-difference/) | [C](./src/389.c) | Easy | +| 404 | [Sum of Left Leaves](https://leetcode.com/problems/sum-of-left-leaves/) | [C](./src/404.c) | Easy | +| 442 | [Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array/) | [C](./src/442.c) | Medium | +| 461 | [Hamming Distance](https://leetcode.com/problems/hamming-distance/) | [C](./src/461.c) | Easy | +| 476 | [Number Complement](https://leetcode.com/problems/number-complement/) | [C](./src/476.c) | Easy | +| 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number/) | [C](./src/509.c) | Easy | +| 520 | [Detect Capital](https://leetcode.com/problems/detect-capital/) | [C](./src/520.c) | Easy | +| 561 | [Array Partition I](https://leetcode.com/problems/array-partition-i/) | [C](./src/561.c) | Easy | +| 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees/) | [C](./src/617.c) | Easy | +| 647 | [Palindromic Substring](https://leetcode.com/problems/palindromic-substrings/) | [C](./src/647.c) | Medium | +| 674 | [Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence/) | [C](./src/674.c) | Easy | +| 700 | [Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree/) | [C](./src/700.c) | Easy | +| 701 | [Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree/) | [C](./src/701.c) | Medium | +| 704 | [Binary Search](https://leetcode.com/problems/binary-search/) | [C](./src/704.c) | Easy | +| 709 | [To Lower Case](https://leetcode.com/problems/to-lower-case/) | [C](./src/709.c) | Easy | +| 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones/) | [C](./src/771.c) | Easy | +| 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array/) | [C](./src/852.c) | Easy | +| 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list/) | [C](./src/876.c) | Easy | +| 905 | [Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity/) | [C](./src/905.c) | Easy | +| 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters/) | [C](./src/917.c) | Easy | +| 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | +| 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c) | Easy | +| 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | +| 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | +| 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | +| 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | +| 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | +| 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | diff --git a/leetcode/README.md b/leetcode/README.md index 1b4f86dd9c..4d258034ea 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -1,100 +1,79 @@ -# LeetCode - -### LeetCode Algorithm - -| # | Title | Solution | Difficulty | -| ---- | ------------------------------------------------------------------------------------------------------------------------------- | ----------------- | ---------- | -| 1 | [Two Sum](https://leetcode.com/problems/two-sum/) | [C](./src/1.c) | Easy | -| 2 | [Add Two Numbers](https://leetcode.com/problems/add-two-numbers/) | [C](./src/2.c) | Medium | -| 3 | [Longest Substring Without Repeating Characters](https://leetcode.com/problems/longest-substring-without-repeating-characters/) | [C](./src/3.c) | Medium | -| 4 | [Median of Two Sorted Arrays](https://leetcode.com/problems/median-of-two-sorted-arrays/) | [C](./src/4.c) | Hard | -| 6 | [ZigZag conversion](https://leetcode.com/problems/zigzag-conversion/) | [C](./src/4.c) | Medium | -| 7 | [Reverse Integer](https://leetcode.com/problems/reverse-integer/) | [C](./src/7.c) | Easy | -| 8 | [String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c) | Medium | -| 9 | [Palindrome Number](https://leetcode.com/problems/palindrome-number/) | [C](./src/9.c) | Easy | -| 11 | [Container With Most Water](https://leetcode.com/problems/container-with-most-water/) | [C](./src/11.c) | Medium | -| 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | -| 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer/) | [C](./src/13.c) | Easy | -| 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses/) | [C](./src/20.c) | Easy | -| 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists/) | [C](./src/21.c) | Easy | -| 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs/) | [C](./src/24.c) | Medium | -| 26 | [Remove Duplicates from Sorted Array](https://leetcode.com/problems/remove-duplicates-from-sorted-array/) | [C](./src/26.c) | Easy | -| 27 | [Remove Element](https://leetcode.com/problems/remove-element/) | [C](./src/27.c) | Easy | -| 28 | [Implement strStr()](https://leetcode.com/problems/implement-strstr/) | [C](./src/28.c) | Easy | -| 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers/) | [C](./src/29.c) | Medium | -| 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position/) | [C](./src/35.c) | Easy | -| 38 | [Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c) | Easy | -| 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | -| 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | [C](./src/62.c) | Medium | -| 63 | [Unique Paths II](https://leetcode.com/problems/unique-paths-ii/) | [C](./src/63.c) | Medium | -| 66 | [Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c) | Easy | -| 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c) | Medium | -| 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list/) | [C](./src/83.c) | Easy | -| 94 | [Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal/) | [C](./src/94.c) | Medium | -| 101 | [Symmetric Tree](https://leetcode.com/problems/symmetric-tree/) | [C](./src/101.c) | Easy | -| 104 | [Maximum Depth of Binary Tree](https://leetcode.com/problems/maximum-depth-of-binary-tree/) | [C](./src/104.c) | Easy | -| 108 | [Convert Sorted Array to Binary Search Tree](https://leetcode.com/problems/convert-sorted-array-to-binary-search-tree/) | [C](./src/108.c) | Easy | -| 109 | [Convert Sorted List to Binary Search Tree](https://leetcode.com/problems/convert-sorted-list-to-binary-search-tree/) | [C](./src/109.c) | Medium | -| 110 | [Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree/) | [C](./src/110.c) | Easy | -| 112 | [Path Sum](https://leetcode.com/problems/path-sum/) | [C](./src/112.c) | Easy | -| 118 | [Pascal's Triangle](https://leetcode.com/problems/pascals-triangle/) | [C](./src/118.c) | Easy | -| 119 | [Pascal's Triangle II](https://leetcode.com/problems/pascals-triangle-ii/) | [C](./src/119.c) | Easy | -| 121 | [Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock/) | [C](./src/121.c) | Easy | -| 125 | [Valid Palindrome](https://leetcode.com/problems/valid-palindrome/) | [C](./src/125.c) | Easy | -| 136 | [Single Number](https://leetcode.com/problems/single-number/) | [C](./src/136.c) | Easy | -| 141 | [Linked List Cycle](https://leetcode.com/problems/linked-list-cycle/) | [C](./src/141.c) | Easy | -| 142 | [Linked List Cycle II](https://leetcode.com/problems/linked-list-cycle-ii/) | [C](./src/142.c) | Medium | -| 153 | [Find Minimum in Rotated Sorted Array](https://leetcode.com/problems/find-minimum-in-rotated-sorted-array/) | [C](./src/153.c) | Medium | -| 160 | [Intersection of Two Linked Lists](https://leetcode.com/problems/intersection-of-two-linked-lists/) | [C](./src/160.c) | Easy | -| 169 | [Majority Element](https://leetcode.com/problems/majority-element/) | [C](./src/169.c) | Easy | -| 173 | [Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator/) | [C](./src/173.c) | Medium | -| 189 | [Rotate Array](https://leetcode.com/problems/rotate-array) | [C](./src/189.c) | Easy | -| 190 | [Reverse Bits](https://leetcode.com/problems/reverse-bits/) | [C](./src/190.c) | Easy | -| 191 | [Number of 1 Bits](https://leetcode.com/problems/number-of-1-bits/) | [C](./src/191.c) | Easy | -| 201 | [Bitwise AND of Numbers Range](https://leetcode.com/problems/bitwise-and-of-numbers-range/) | [C](./src/201.c) | Medium | -| 203 | [Remove Linked List Elements](https://leetcode.com/problems/remove-linked-list-elements/) | [C](./src/203.c) | Easy | -| 206 | [Reverse Linked List](https://leetcode.com/problems/reverse-linked-list/) | [C](./src/206.c) | Easy | -| 215 | [Kth Largest Element in an Array](https://leetcode.com/problems/kth-largest-element-in-an-array/) | [C](./src/215.c) | Medium | -| 217 | [Contains Duplicate](https://leetcode.com/problems/contains-duplicate/) | [C](./src/217.c) | Easy | -| 226 | [Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree/) | [C](./src/226.c) | Easy | -| 231 | [Power of Two](https://leetcode.com/problems/power-of-two/) | [C](./src/231.c) | Easy | -| 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list/) | [C](./src/234.c) | Easy | -| 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram/) | [C](./src/242.c) | Easy | -| 268 | [Missing Number](https://leetcode.com/problems/missing-number/) | [C](./src/268.c) | Easy | -| 278 | [First Bad Version](https://leetcode.com/problems/first-bad-version/) | [C](./src/278.c) | Easy | -| 283 | [Move Zeroes](https://leetcode.com/problems/move-zeroes/) | [C](./src/283.c) | Easy | -| 287 | [Find the Duplicate Number](https://leetcode.com/problems/find-the-duplicate-number/) | [C](./src/287.c) | Medium | -| 344 | [Reverse String](https://leetcode.com/problems/reverse-string/) | [C](./src/344.c) | Easy | -| 367 | [Valid Perfect Square](https://leetcode.com/problems/valid-perfect-square/) | [C](./src/367.c) | Easy | -| 387 | [First Unique Character in a String](https://leetcode.com/problems/first-unique-character-in-a-string/) | [C](./src/387.c) | Easy | -| 389 | [Find the Difference](https://leetcode.com/problems/find-the-difference/) | [C](./src/389.c) | Easy | -| 404 | [Sum of Left Leaves](https://leetcode.com/problems/sum-of-left-leaves/) | [C](./src/404.c) | Easy | -| 442 | [Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array/) | [C](./src/442.c) | Medium | -| 461 | [Hamming Distance](https://leetcode.com/problems/hamming-distance/) | [C](./src/461.c) | Easy | -| 476 | [Number Complement](https://leetcode.com/problems/number-complement/) | [C](./src/476.c) | Easy | -| 485 | [Max Consecutive Ones](https://leetcode.com/problems/max-consecutive-ones/) | [C](./src/485.c) | Easy | -| 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number/) | [C](./src/509.c) | Easy | -| 520 | [Detect Capital](https://leetcode.com/problems/detect-capital/) | [C](./src/520.c) | Easy | -| 561 | [Array Partition I](https://leetcode.com/problems/array-partition-i/) | [C](./src/561.c) | Easy | -| 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees/) | [C](./src/617.c) | Easy | -| 647 | [Palindromic Substring](https://leetcode.com/problems/palindromic-substrings/) | [C](./src/647.c) | Medium | -| 674 | [Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence/) | [C](./src/674.c) | Easy | -| 700 | [Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree/) | [C](./src/700.c) | Easy | -| 701 | [Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree/) | [C](./src/701.c) | Medium | -| 704 | [Binary Search](https://leetcode.com/problems/binary-search/) | [C](./src/704.c) | Easy | -| 709 | [To Lower Case](https://leetcode.com/problems/to-lower-case/) | [C](./src/709.c) | Easy | -| 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones/) | [C](./src/771.c) | Easy | -| 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array/) | [C](./src/852.c) | Easy | -| 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list/) | [C](./src/876.c) | Easy | -| 905 | [Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity/) | [C](./src/905.c) | Easy | -| 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters/) | [C](./src/917.c) | Easy | -| 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | -| 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c) | Easy | -| 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | -| 1008 | [Construct Binary Search Tree from Preorder Traversal](https://leetcode.com/problems/construct-binary-search-tree-from-preorder-traversal/description/) | [C](./src/1008.c) | Medium | -| 1019 | [Next Greater Node In Linked List](https://leetcode.com/problems/next-greater-node-in-linked-list/) | [C](./src/1019.c) | Medium | -| 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | -| 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | -| 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | -| 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | -| 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | +# 📚 Contributing 📚 + +We're glad you're interested in adding C LeetCode solutions to the repository.\ +Here we'll be explaining how to contribute to LeetCode solutions properly. + +## 💻 Cloning/setting up the project 💻 + +First off, you'll need to fork the repository [**here**](https://github.com/TheAlgorithms/C/fork).\ +Then, you'll need to clone the repository to your local machine. + +```bash +git clone https://github.com/your-username/C.git +``` + +After that, you'll need to create a new branch for your solution. + +```bash +git checkout -b solution/your-solution-name +``` + +## 📝 Adding a new solution 📝 + +All LeetCode problems can be found [**here**](https://leetcode.com/problemset/all/).\ +If you have a solution to any of these problems (which are not being [**repeated**](https://github.com/TheAlgorithms/C/blob/master/leetcode/DIRECTORY.md)), that's great! Here are the steps: + +1. Add a new file in `leetcode/src` with the number of the problem.\ + - For example: if the problem's number is 98, the filename should be `98.c`. +2. Provide a small description of the solution at the top of the file. A function should go below that. For example: + +```c +/** + * Return an array of arrays of size *returnSize. + * The sizes of the arrays are returned as *returnColumnSizes array. + * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free(). + */ +``` + +3. Do not provide a `main` function. Use the required standalone functions instead. +4. Doxygen documentation isn't used in LeetCode solutions. Simple/small documentation or comments should be fine. +5. Don't include libraries/headers such as `stdio.h`. Your file should be the solution to the problem only. + +### 📜 Adding your new solution to the list 📜 + +Great! You've added your solution. Now, you'll have to add it to `leetcode/DIRECTORY.md`.\ +Please use numerical order. For example: if the solution's number is `98`, add your solution after `97`, if available. + +This is the required format for new solutinos: + +```markdown +... +| | []() | [C](./src/.c) | | +... +``` + +## 📦 Committing your changes 📦 + +Once you're done with adding a new LeetCode solution, it's time we make a pull request. + +1. First, stage your changes. + +```bash +git add leetcode/src/98.c # Use `git add .` to stage all changes. +``` + +2. Then, commit your changes. + +```bash +git commit -m "feat: add LeetCode problem 98" -m "Commit description" # Optional +``` + +3. Finally, push your changes to your forked repository. + +```bash +git push origin solution/your-solution-name:solution/your-solution-name +``` + +4. You're done now! You just have to make a [**pull request**](https://github.com/TheAlgorithms/C/compare). 🎉 + +If you need any help, don't hesitate to ask and join our [**Discord server**](https://the-algorithms.com/discord)! 🙂 From 68bdbfb0a58560041f2fd7313b87ccf5ebd28777 Mon Sep 17 00:00:00 2001 From: Yashvardhan Singh <68675629+PythonicBoat@users.noreply.github.com> Date: Thu, 10 Nov 2022 06:54:15 +0530 Subject: [PATCH 027/156] feat: add LeetCode problem 10 (#1033) * updated readme * Create 10.c * Update README.md * added documentation * chore: apply suggestions from code review * Update DIRECTORY.md Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/10.c | 59 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 60 insertions(+) create mode 100644 leetcode/src/10.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 0de9c220b0..1283f175e7 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -12,6 +12,7 @@ | 7 | [Reverse Integer](https://leetcode.com/problems/reverse-integer/) | [C](./src/7.c) | Easy | | 8 | [String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c) | Medium | | 9 | [Palindrome Number](https://leetcode.com/problems/palindrome-number/) | [C](./src/9.c) | Easy | +| 10 | [Regular Expression Matching](https://leetcode.com/problems/regular-expression-matching/) | [C](./src/10.c) | Hard | | 11 | [Container With Most Water](https://leetcode.com/problems/container-with-most-water/) | [C](./src/11.c) | Medium | | 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | | 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer/) | [C](./src/13.c) | Easy | diff --git a/leetcode/src/10.c b/leetcode/src/10.c new file mode 100644 index 0000000000..26ed6a3b89 --- /dev/null +++ b/leetcode/src/10.c @@ -0,0 +1,59 @@ +/* +Prompt: + +Given an input string s and a pattern p, implement regular expression matching with support for '.' and '*' where: +- '.' Matches any single character. +- '*' Matches zero or more of the preceding element. +The matching should cover the entire input string (not partial). + +Constraints: + +1 <= s.length <= 20 +1 <= p.length <= 30 +s contains only lowercase English letters. +p contains only lowercase English letters, '.', and '*'. + +It is guaranteed for each appearance of the character '*', there will be a previous valid character to match. +*/ + +bool isMatch(char* s, char* p); +bool matchStar(char ch, char* s, char* p); + +/* +Uses Rob pikes Regexp matcher - https://www.cs.princeton.edu/courses/archive/spr09/cos333/beautiful.html +Implementation: + // match: search for regexp anywhere in text + int match(char *regexp, char *text) + { + if (regexp[0] == '^') + return matchhere(regexp+1, text); + do { + if (matchhere(regexp, text)) + return 1; + } while (*text++ != '\0'); + return 0; + } +*/ + +bool matchStar(char ch, char* s, char* p) { + do { + if (isMatch(s, p)) + return true; + } while (*s != '\0' && (*s++ == ch || ch == '.')); + + return false; +} + +bool isMatch(char* s, char* p) { + if (*p == '\0') + return *s == '\0'; + + if (p[1] == '*') + return matchStar(p[0], s, p + 2); + + if (*s != '\0' && (p[0] == '.' || *p == *s)) { + return isMatch(s + 1, p + 1); + } + + return false; +} From 1b3a1ca91ee4696f8d51f8cd5ffc223eee37cf5d Mon Sep 17 00:00:00 2001 From: Enzo Veroneze <78752573+enzoveroneze@users.noreply.github.com> Date: Thu, 10 Nov 2022 02:19:01 -0300 Subject: [PATCH 028/156] fix: remove double/unintended `free` (#1143) The call to realloc() already frees the previously allocated memory if necessary. By the man page of realloc(): "f the area pointed to was moved, a free(ptr) is done.", and free(): "If free(ptr) has already been called before, undefined behavior occurs.". --- data_structures/dynamic_array/dynamic_array.c | 3 +-- 1 file changed, 1 insertion(+), 2 deletions(-) diff --git a/data_structures/dynamic_array/dynamic_array.c b/data_structures/dynamic_array/dynamic_array.c index 7ecf359ccb..19631cb1d1 100644 --- a/data_structures/dynamic_array/dynamic_array.c +++ b/data_structures/dynamic_array/dynamic_array.c @@ -18,7 +18,6 @@ void *add(dynamic_array_t *da, const void *value) { void **newItems = realloc(da->items, (da->capacity <<= 1) * sizeof(void **)); - free(da->items); da->items = newItems; } @@ -79,4 +78,4 @@ void *retrive_copy_of_value(const void *value) memcpy(value_copy, value, sizeof(void *)); return value_copy; -} \ No newline at end of file +} From 00500d610890a6088a04d004f5586cd878914dde Mon Sep 17 00:00:00 2001 From: Anas Khan <83116240+anxkhn@users.noreply.github.com> Date: Sat, 12 Nov 2022 01:23:44 +0530 Subject: [PATCH 029/156] chore: add display() and improve code formatting (#975) added display to view entire stack using for loop and formatted code. --- data_structures/stack/main.c | 53 ++++++++++++++++++++++++------------ 1 file changed, 36 insertions(+), 17 deletions(-) diff --git a/data_structures/stack/main.c b/data_structures/stack/main.c index ebdabc4670..d3f20c0a93 100644 --- a/data_structures/stack/main.c +++ b/data_structures/stack/main.c @@ -1,11 +1,11 @@ // program for stack using array - #include void push(); void pop(); void peek(); void update(); +void display(); int a[100], top = -1; @@ -14,12 +14,13 @@ int main() int x; while (1) { - printf("\n0.exit"); - printf("\n1.push"); - printf("\n2.pop"); - printf("\n3.peek"); - printf("\n4.update"); - printf("\nenter your choice? "); + printf("\n0 or CTRL-C to Exit "); + printf("\n1. Push"); + printf("\n2. Pop"); + printf("\n3. Peek"); + printf("\n4. Update"); + printf("\n5. Display"); + printf("\nEnter your choice? \n"); scanf("%d", &x); switch (x) { @@ -37,8 +38,11 @@ int main() case 4: update(); break; + case 5: + display(); + break; default: - printf("\ninvalid choice"); + printf("\nInvalid choice,\nPlease try again.\n"); } } return (0); @@ -48,7 +52,7 @@ int main() void push() { int n = 0; - printf("\nenter the value to insert? "); + printf("\nEnter the value to be inserted: "); scanf("%d", &n); top += 1; a[top] = n; @@ -59,14 +63,14 @@ void pop() { if (top == -1) { - printf("\nstack is empty"); + printf("\nStack is empty"); } else { int item; item = a[top]; top -= 1; - printf("\npoped item is %d ", item); + printf("\nPoped item is %d ", item); } } @@ -74,25 +78,40 @@ void pop() void peek() { if (top >= 0) - printf("\n the top element is %d", a[top]); + printf("\nThe top element is %d", a[top]); else - printf("\nstack is empty"); + printf("\nStack is empty"); } // function to update the element of stack void update() { int i, n; - printf("\nenter the position to update? "); + printf("\nEnter the position to update? "); scanf("%d", &i); - printf("\nenter the item to insert? "); + printf("\nEnter the item to insert? "); scanf("%d", &n); if (top - i + 1 < 0) { - printf("\nunderflow condition"); + printf("\nUnderflow condition "); } else { a[top - i + 1] = n; } -} \ No newline at end of file +} +// function to view entire stack +void display() +{ + if (top == -1) + { + printf("\nStack is empty"); + } + else + { + for (int i = top; i >= 0; i--) + { + printf("%d\n", a[i]); + } + } +} From 55b2045b19e5b07393c3e368df2703c923f010be Mon Sep 17 00:00:00 2001 From: devarshitrivedi01 <60918197+devarshitrivedi01@users.noreply.github.com> Date: Tue, 15 Nov 2022 00:17:23 +0530 Subject: [PATCH 030/156] chore: add Max Consecutive Ones in LeetCode folder (#982) * Create 14.c * Update README.md * Update leetcode/src/14.c Co-authored-by: David Leal * Update DIRECTORY.md * Update DIRECTORY.md Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/14.c | 25 +++++++++++++++++++++++++ 2 files changed, 26 insertions(+) create mode 100644 leetcode/src/14.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 1283f175e7..9ce6a443e1 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -16,6 +16,7 @@ | 11 | [Container With Most Water](https://leetcode.com/problems/container-with-most-water/) | [C](./src/11.c) | Medium | | 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | | 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer/) | [C](./src/13.c) | Easy | +| 14 | [Max Consecutive Ones](https://leetcode.com/problems/max-consecutive-ones/) | [C](./src/14.c) | Easy | | 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses/) | [C](./src/20.c) | Easy | | 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists/) | [C](./src/21.c) | Easy | | 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs/) | [C](./src/24.c) | Medium | diff --git a/leetcode/src/14.c b/leetcode/src/14.c new file mode 100644 index 0000000000..8f5a22d840 --- /dev/null +++ b/leetcode/src/14.c @@ -0,0 +1,25 @@ +int findMaxConsecutiveOnes(int* nums, int numsSize){ + int i=0; + int maxCount=0; + int count = 0; + + while(i Date: Tue, 15 Nov 2022 00:40:23 +0530 Subject: [PATCH 031/156] chore: fix `tic_tac_toe.c` CodeQL warning (#1133) e<=8 is not needed as remainder is always less than remainder so e<9(e>=8) is obvious in every case --- games/tic_tac_toe.c | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/games/tic_tac_toe.c b/games/tic_tac_toe.c index 07b7bd689f..fbaf0e22be 100644 --- a/games/tic_tac_toe.c +++ b/games/tic_tac_toe.c @@ -283,7 +283,7 @@ void place() int e = rand() % 9; - if (e >= 0 && e <= 8) + if (e >= 0) { if (game_table[e] != 'x' && game_table[e] != 'o') { From 21bd88215c192c4f31d108bf33fc4d1b224edadc Mon Sep 17 00:00:00 2001 From: David Leal Date: Mon, 14 Nov 2022 15:56:23 -0600 Subject: [PATCH 032/156] chore: remove redundant `\` --- leetcode/README.md | 4 +--- 1 file changed, 1 insertion(+), 3 deletions(-) diff --git a/leetcode/README.md b/leetcode/README.md index 4d258034ea..47c2b5836e 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -23,7 +23,7 @@ git checkout -b solution/your-solution-name All LeetCode problems can be found [**here**](https://leetcode.com/problemset/all/).\ If you have a solution to any of these problems (which are not being [**repeated**](https://github.com/TheAlgorithms/C/blob/master/leetcode/DIRECTORY.md)), that's great! Here are the steps: -1. Add a new file in `leetcode/src` with the number of the problem.\ +1. Add a new file in `leetcode/src` with the number of the problem. - For example: if the problem's number is 98, the filename should be `98.c`. 2. Provide a small description of the solution at the top of the file. A function should go below that. For example: @@ -47,9 +47,7 @@ Please use numerical order. For example: if the solution's number is `98`, add y This is the required format for new solutinos: ```markdown -... | | []() | [C](./src/.c) | | -... ``` ## 📦 Committing your changes 📦 From 0e956c6e583ecf600603caacfee36f7763f6eeb1 Mon Sep 17 00:00:00 2001 From: Jeremias Moreira Gomes Date: Tue, 15 Nov 2022 21:22:16 -0300 Subject: [PATCH 033/156] chore: add Rot13 Cipher (#1008) * Add ROT13 cipher. * updating DIRECTORY.md * Fix suggestions. * Suggestions. Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> Co-authored-by: David Leal --- misc/rot13.c | 60 ++++++++++++++++++++++++++++++++++++++++++++++++++++ 1 file changed, 60 insertions(+) create mode 100644 misc/rot13.c diff --git a/misc/rot13.c b/misc/rot13.c new file mode 100644 index 0000000000..1a6022f40e --- /dev/null +++ b/misc/rot13.c @@ -0,0 +1,60 @@ +/** + * @file + * @brief [ROT13](https://en.wikipedia.org/wiki/ROT13) is a simple letter + * substitution cipher that replaces a letter with the 13th letter after it in + * the alphabet. + * @details ROT13 transforms a piece of text by examining its alphabetic + * characters and replacing each one with the letter 13 places further along in + * the alphabet, wrapping back to the beginning if necessary. A becomes N, B + * becomes O, and so on up to M, which becomes Z, then the sequence continues at + * the beginning of the alphabet: N becomes A, O becomes B, and so on to Z, + * which becomes M. + * @author [Jeremias Moreira Gomes](https://github.com/j3r3mias) + */ + +#include /// for IO operations +#include /// for string operations +#include /// for assert + +/** + * @brief Apply the ROT13 cipher + * @param s contains the string to be processed + */ +void rot13(char *s) { + for (int i = 0; s[i]; i++) { + if (s[i] >= 'A' && s[i] <= 'Z') { + s[i] = 'A' + ((s[i] - 'A' + 13) % 26); + } else if (s[i] >= 'a' && s[i] <= 'z') { + s[i] = 'a' + ((s[i] - 'a' + 13) % 26); + } + } +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() { + char test_01[] = "The more I C, the less I see."; + rot13(test_01); + assert(strcmp(test_01, "Gur zber V P, gur yrff V frr.") == 0); + + char test_02[] = "Which witch switched the Swiss wristwatches?"; + rot13(test_02); + assert(strcmp(test_02, "Juvpu jvgpu fjvgpurq gur Fjvff jevfgjngpurf?") == 0); + + char test_03[] = "Juvpu jvgpu fjvgpurq gur Fjvff jevfgjngpurf?"; + rot13(test_03); + assert(strcmp(test_03, "Which witch switched the Swiss wristwatches?") == 0); + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() { + test(); // run self-test implementations + return 0; +} From 856168384d4c802eb531683829606db25925b6dc Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Wed, 16 Nov 2022 04:27:22 +0400 Subject: [PATCH 034/156] feat: add compliment of 10 integer (#1136) * add complinent of 10 integer * Update 1009.c add new line at the end * Rename README.md to DIRECTORY.md change filename * chore: apply suggestions from code review Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/1009.c | 15 +++++++++++++++ 2 files changed, 16 insertions(+) create mode 100644 leetcode/src/1009.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 9ce6a443e1..56051ab4cf 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -90,6 +90,7 @@ | 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | | 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c) | Easy | | 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | +| 1009 | [Complement of Base 10 Integer](https://leetcode.com/problems/complement-of-base-10-integer/) | [C](./src/1009.c) | Easy | | 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | diff --git a/leetcode/src/1009.c b/leetcode/src/1009.c new file mode 100644 index 0000000000..77480d71a7 --- /dev/null +++ b/leetcode/src/1009.c @@ -0,0 +1,15 @@ +// Bit manipulation. +// - Find the bit length of n using log2 +// - Create bit mask of bit length of n +// - Retun ~n and bit of ones mask +// Runtime: O(log2(n)) +// Space: O(1) + +int bitwiseComplement(int n){ + if (n == 0){ + return 1; + } + + int binary_number_length = ceil(log2(n)); + return (~n) & ((1 << binary_number_length) - 1); +} From 136dee84e7705ffd6b15de322a7f8c68088e5d77 Mon Sep 17 00:00:00 2001 From: Aryan Raj Date: Thu, 17 Nov 2022 23:49:16 +0530 Subject: [PATCH 035/156] feat: add `non_preemptive_priority_scheduling` in Process Scheduling Algorithm (#968) * Added NonPreemptivePriorityScheduling * updating DIRECTORY.md * Added documentation and tests * Update process_scheduling_algorithms/non_preemptive_priority_scheduling.c Co-authored-by: David Leal * Update process_scheduling_algorithms/non_preemptive_priority_scheduling.c Co-authored-by: David Leal * Left out documentation and suggested changes * Update process_scheduling_algorithms/non_preemptive_priority_scheduling.c Co-authored-by: David Leal * Update process_scheduling_algorithms/non_preemptive_priority_scheduling.c Co-authored-by: David Leal * Update process_scheduling_algorithms/non_preemptive_priority_scheduling.c Co-authored-by: David Leal * Update process_scheduling_algorithms/non_preemptive_priority_scheduling.c Co-authored-by: David Leal * Update process_scheduling_algorithms/non_preemptive_priority_scheduling.c Co-authored-by: David Leal * test case added with assert.h * Update process_scheduling_algorithms/non_preemptive_priority_scheduling.c Co-authored-by: Taj * typedef | Snake Case naming * chore: apply suggestions from code review Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> Co-authored-by: David Leal Co-authored-by: Taj --- DIRECTORY.md | 3 + .../non_preemptive_priority_scheduling.c | 369 ++++++++++++++++++ 2 files changed, 372 insertions(+) create mode 100644 process_scheduling_algorithms/non_preemptive_priority_scheduling.c diff --git a/DIRECTORY.md b/DIRECTORY.md index a669f48139..45f93d8005 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -318,6 +318,9 @@ * [Simpsons 1 3Rd Rule](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/simpsons_1_3rd_rule.c) * [Variance](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/variance.c) +## Process Scheduling Algorithms + * [Non Preemptive Priority Scheduling](https://github.com/TheAlgorithms/C/blob/master/process_scheduling_algorithms/non_preemptive_priority_scheduling.c) + ## Project Euler * Problem 1 * [Sol1](https://github.com/TheAlgorithms/C/blob/HEAD/project_euler/problem_1/sol1.c) diff --git a/process_scheduling_algorithms/non_preemptive_priority_scheduling.c b/process_scheduling_algorithms/non_preemptive_priority_scheduling.c new file mode 100644 index 0000000000..2dd8ee8fc0 --- /dev/null +++ b/process_scheduling_algorithms/non_preemptive_priority_scheduling.c @@ -0,0 +1,369 @@ +/** + * @file + * @brief + * [Non-Preemptive Priority + * Scheduling](https://en.wikipedia.org/wiki/Scheduling_(computing)) + * is a scheduling algorithm that selects the tasks to execute based on + * priority. + * + * @details + * In this algorithm, processes are executed according to their + * priority. The process with the highest priority is to be executed first and + * so on. In this algorithm, a variable is maintained known as the time quantum. + * The length of the time quantum is decided by the user. The process which is + * being executed is interrupted after the expiration of the time quantum and + * the next process with the highest priority is executed. This cycle of + * interrupting the process after every time quantum and resuming the next + * process with the highest priority continues until all the processes have + * been executed. + * @author [Aryan Raj](https://github.com/aryaraj132) + */ +#include /// for assert +#include /// for boolean data type +#include /// for IO operations (`printf`) +#include /// for memory allocation eg: `malloc`, `realloc`, `free`, `exit` +/** + * @brief Structure to represent a process + */ + typedef struct node { + int ID; ///< ID of the process node + int AT; ///< Arrival Time of the process node + int BT; ///< Burst Time of the process node + int priority; ///< Priority of the process node + int CT; ///< Completion Time of the process node + int WT; ///< Waiting Time of the process node + int TAT; ///< Turn Around Time of the process node + struct node *next; ///< pointer to the node + } node; + +/** + * @brief To insert a new process in the queue + * @param root pointer to the head of the queue + * @param id process ID + * @param at arrival time + * @param bt burst time + * @param prior priority of the process + * @returns void + */ +void insert(node **root, int id, int at, int bt, int prior) +{ + // create a new node and initialize it + node *new = (node *)malloc(sizeof(node)); + node *ptr = *root; + new->ID = id; + new->AT = at; + new->BT = bt; + new->priority = prior; + new->next = NULL; + new->CT = 0; + new->WT = 0; + new->TAT = 0; + // if the root is null, make the new node the root + if (*root == NULL) + { + *root = new; + return; + } + // else traverse to the end of the queue and insert the new node there + while (ptr->next != NULL) + { + ptr = ptr->next; + } + ptr->next = new; + return; +} +/* + * @brief To delete a process from the queue + * @param root pointer to the head of the queue + * @param id process ID + * @returns void + */ +void delete(node **root, int id) +{ + node *ptr = *root, *prev; + // if the root is null, return + if (ptr == NULL) + { + return; + } + // if the root is the process to be deleted, make the next node the root + if (ptr->ID == id) + { + *root = ptr->next; + free(ptr); + return; + } + // else traverse the queue and delete the process + while (ptr != NULL && ptr->ID != id) + { + prev = ptr; + ptr = ptr->next; + } + if (ptr == NULL) + { + return; + } + prev->next = ptr->next; + free(ptr); +} +/** + * @brief To show the process queue + * @param head pointer to the head of the queue + * @returns void + */ +void show_list(node *head) +{ + printf("Process Priority AT BT CT TAT WT \n"); + while (head != NULL) + { + printf("P%d. %d %d %d %d %d %d \n", head->ID, head->priority, head->AT, + head->BT, head->CT, head->TAT, head->WT); + head = head->next; + } +} +/** + * @brief To length process queue + * @param root pointer to the head of the queue + * @returns int total length of the queue + */ +int l_length(node **root) +{ + int count = 0; + node *ptr = *root; + while (ptr != NULL) + { + count++; + ptr = ptr->next; + } + return count; +} +/** + * @brief To update the completion time, turn around time and waiting time of + * the processes + * @param root pointer to the head of the queue + * @param id process ID + * @param ct current time + * @param wt waiting time + * @param tat turn around time + * @returns void + */ +void update(node **root, int id, int ct, int wt, int tat) +{ + node *ptr = *root; + // If process to be updated is head node + if (ptr != NULL && ptr->ID == id) + { + if (ct != 0) + { + ptr->CT = ct; + } + if (wt != 0) + { + ptr->WT = wt; + } + if (tat != 0) + { + ptr->TAT = tat; + } + return; + } + // else traverse the queue and update the values + while (ptr != NULL && ptr->ID != id) + { + ptr = ptr->next; + } + if (ct != 0) + { + ptr->CT = ct; + } + if (wt != 0) + { + ptr->WT = wt; + } + if (tat != 0) + { + ptr->TAT = tat; + } + return; +} +/** + * @brief To compare the priority of two processes based on their arrival time + * and priority + * @param a pointer to the first process + * @param b pointer to the second process + * @returns true if the priority of the first process is greater than the + * the second process + * @returns false if the priority of the first process is NOT greater than the + * second process + */ +bool compare(node *a, node *b) +{ + if (a->AT == b->AT) + { + return a->priority < b->priority; + } + else + { + return a->AT < b->AT; + } +} +/** + * @brief To calculate the average completion time of all the processes + * @param root pointer to the head of the queue + * @returns float average completion time + */ +float calculate_ct(node **root) +{ + // calculate the total completion time of all the processes + node *ptr = *root, *prior, *rpt; + int ct = 0, i, time = 0; + int n = l_length(root); + float avg, sum = 0; + node *duproot = NULL; + // create a duplicate queue + while (ptr != NULL) + { + insert(&duproot, ptr->ID, ptr->AT, ptr->BT, ptr->priority); + ptr = ptr->next; + } + ptr = duproot; + rpt = ptr->next; + // sort the queue based on the arrival time and priority + while (rpt != NULL) + { + if (!compare(ptr, rpt)) + { + ptr = rpt; + } + rpt = rpt->next; + } + // ptr is the process to be executed first. + ct = ptr->AT + ptr->BT; + time = ct; + sum += ct; + // update the completion time, turn around time and waiting time of the + // process + update(root, ptr->ID, ct, 0, 0); + delete (&duproot, ptr->ID); + // repeat the process until all the processes are executed + for (i = 0; i < n - 1; i++) + { + ptr = duproot; + while (ptr != NULL && ptr->AT > time) + { + ptr = ptr->next; + } + rpt = ptr->next; + while (rpt != NULL) + { + if (rpt->AT <= time) + { + if (rpt->priority < ptr->priority) + { + ptr = rpt; + } + } + rpt = rpt->next; + } + ct += ptr->BT; + time += ptr->BT; + sum += ct; + update(root, ptr->ID, ct, 0, 0); + delete (&duproot, ptr->ID); + } + avg = sum / n; + return avg; +} +/** + * @brief To calculate the average turn around time of all the processes + * @param root pointer to the head of the queue + * @returns float average turn around time + */ +float calculate_tat(node **root) +{ + float avg, sum = 0; + int n = l_length(root); + node *ptr = *root; + // calculate the completion time if not already calculated + if (ptr->CT == 0) + { + calculate_ct(root); + } + // calculate the total turn around time of all the processes + while (ptr != NULL) + { + ptr->TAT = ptr->CT - ptr->AT; + sum += ptr->TAT; + ptr = ptr->next; + } + avg = sum / n; + return avg; +} +/** + * @brief To calculate the average waiting time of all the processes + * @param root pointer to the head of the queue + * @returns float average waiting time + */ +float calculate_wt(node **root) +{ + float avg, sum = 0; + int n = l_length(root); + node *ptr = *root; + // calculate the completion if not already calculated + if (ptr->CT == 0) + { + calculate_ct(root); + } + // calculate the total waiting time of all the processes + while (ptr != NULL) + { + ptr->WT = (ptr->TAT - ptr->BT); + sum += ptr->WT; + ptr = ptr->next; + } + avg = sum / n; + return avg; +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() +{ + // Entered processes + // printf("ID Priority Arrival Time Burst Time \n"); + // printf("1 0 5 1 \n"); + // printf("2 1 4 2 \n"); + // printf("3 2 3 3 \n"); + // printf("4 3 2 4 \n"); + // printf("5 4 1 5 \n"); + + node *root = NULL; + insert(&root, 1, 0, 5, 1); + insert(&root, 2, 1, 4, 2); + insert(&root, 3, 2, 3, 3); + insert(&root, 4, 3, 2, 4); + insert(&root, 5, 4, 1, 5); + float avgCT = calculate_ct(&root); + float avgTAT = calculate_tat(&root); + float avgWT = calculate_wt(&root); + assert(avgCT == 11); + assert(avgTAT == 9); + assert(avgWT == 6); + printf("[+] All tests have successfully passed!\n"); + // printf("Average Completion Time is : %f \n", calculate_ct(&root)); + // printf("Average Turn Around Time is : %f \n", calculate_tat(&root)); + // printf("Average Waiting Time is : %f \n", calculate_wt(&root)); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() +{ + test(); // run self-test implementations + + return 0; +} From ace1c695090b127032ec5f5ba6a1ee71dcdc5dd7 Mon Sep 17 00:00:00 2001 From: David Leal Date: Thu, 17 Nov 2022 12:27:30 -0600 Subject: [PATCH 036/156] fix: LeetCode guide link --- CONTRIBUTING.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index 3d05296e96..1651d1380e 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -27,7 +27,7 @@ You can add new algorithms or data structures that are **not present in the repo ### LeetCode solutions -For LeetCode solutions, please check its [**guide**](https://github.com/TheAlgorithms/C/blob/master/src/leetcode/README.md) to make a proper solution file. +For LeetCode solutions, please check its [**guide**](https://github.com/TheAlgorithms/C/blob/master/leetcode/README.md) to make a proper solution file. ### Making Changes From dee9ac73cd857ae7b0412b801d58502c9010379b Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 19 Nov 2022 00:02:59 +0400 Subject: [PATCH 037/156] feat: add Check if Array Is Sorted and Rotated (#1141) * add Check if Array Is Sorted and Rotated * Update 1752.c add new line * Rename README.md to DIRECTORY.md Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/1752.c | 18 ++++++++++++++++++ 2 files changed, 19 insertions(+) create mode 100644 leetcode/src/1752.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 56051ab4cf..b043ca4458 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -95,4 +95,5 @@ | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | +| 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | diff --git a/leetcode/src/1752.c b/leetcode/src/1752.c new file mode 100644 index 0000000000..492a82b484 --- /dev/null +++ b/leetcode/src/1752.c @@ -0,0 +1,18 @@ +bool check(int* nums, int numsSize){ + if (numsSize == 1) { + return true; + } + + bool wasShift = false; + for(int i = 1; i < numsSize; i++) { + if (nums[i - 1] > nums[i]) { + if (wasShift) { + return false; + } + + wasShift = true; + } + } + + return !wasShift || nums[0] >= nums[numsSize-1]; +} From ea775e7a045e8ce18702b5eca4439d1b3d811da5 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 19 Nov 2022 00:09:11 +0400 Subject: [PATCH 038/156] feat: add Number of Sub-arrays With Odd Sum (#1139) * add Number of Sub-arrays With Odd Sum * Update 1524.c add new line at the end * Rename README.md to DIRECTORY.md * chore: apply suggestions from code review Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/1524.c | 24 ++++++++++++++++++++++++ 2 files changed, 25 insertions(+) create mode 100644 leetcode/src/1524.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index b043ca4458..091453f8a3 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -95,5 +95,6 @@ | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | +| 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | diff --git a/leetcode/src/1524.c b/leetcode/src/1524.c new file mode 100644 index 0000000000..46ad3e46d1 --- /dev/null +++ b/leetcode/src/1524.c @@ -0,0 +1,24 @@ +// Counting whole summ. evens sums number and odd summs number. +// Runtime: O(n), +// Space: O(1) +int numOfSubarrays(int* arr, int arrSize){ + int result = 0; + int curSumm = 0; + int currOddSumms = 0; + int currEvenSumm = 0; + int modulo = 1000000000 + 7; + + for(int i = 0; i < arrSize; i++){ + curSumm += arr[i]; + if (curSumm % 2 == 0){ + currEvenSumm++; + result = (result + currOddSumms) % modulo; + } + else { + currOddSumms++; + result = (result + 1 + currEvenSumm) % modulo; + } + } + + return result % modulo; +} From 0bcabd6897dd3e105b8359d62b22b8537c3594f8 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 19 Nov 2022 00:09:44 +0400 Subject: [PATCH 039/156] feat: improve the Power of Two LeetCode problem (#1148) --- leetcode/src/231.c | 13 ++++++------- 1 file changed, 6 insertions(+), 7 deletions(-) diff --git a/leetcode/src/231.c b/leetcode/src/231.c index a2d3b1e7c6..81ea2b0454 100644 --- a/leetcode/src/231.c +++ b/leetcode/src/231.c @@ -1,7 +1,6 @@ -bool isPowerOfTwo(int n) -{ - if (!n) - return false; - while (n % 2 == 0) n /= 2; - return n == 1; -} \ No newline at end of file +// Without loops/recursion. +// Runtime: O(1) +// Space: O(1) +bool isPowerOfTwo(int n){ + return (n > 0) && ((n & (n - 1)) == 0); +} From a2b1983e57da3c4068cd60e4d4c76bf02b7f325c Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Tue, 22 Nov 2022 01:09:27 +0400 Subject: [PATCH 040/156] feat: add Rectangle Area LeetCode problem (#1147) --- leetcode/DIRECTORY.md | 1 + leetcode/src/223.c | 24 ++++++++++++++++++++++++ 2 files changed, 25 insertions(+) create mode 100644 leetcode/src/223.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 091453f8a3..1e3ffc236f 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -56,6 +56,7 @@ | 206 | [Reverse Linked List](https://leetcode.com/problems/reverse-linked-list/) | [C](./src/206.c) | Easy | | 215 | [Kth Largest Element in an Array](https://leetcode.com/problems/kth-largest-element-in-an-array/) | [C](./src/215.c) | Medium | | 217 | [Contains Duplicate](https://leetcode.com/problems/contains-duplicate/) | [C](./src/217.c) | Easy | +| 223 | [Rectangle Area](https://leetcode.com/problems/rectangle-area/) | [C](./src/223.c) | Medium | | 226 | [Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree/) | [C](./src/226.c) | Easy | | 231 | [Power of Two](https://leetcode.com/problems/power-of-two/) | [C](./src/231.c) | Easy | | 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list/) | [C](./src/234.c) | Easy | diff --git a/leetcode/src/223.c b/leetcode/src/223.c new file mode 100644 index 0000000000..6f424dc9e4 --- /dev/null +++ b/leetcode/src/223.c @@ -0,0 +1,24 @@ +#define min(X, Y) ((X) < (Y) ? (X) : (Y)) + +int intersectionSize(int p11, int p12, int p21, int p22){ + if (p11 >= p22 || p12 <= p21){ + return 0; + } + + if (p11 < p21){ + return min(p12 - p21, p22 - p21); + } + + return min(p22 - p11, p12 - p11); +} + +// Calculation area of the A, then area of the B then minus intersection of A and B +// Runtime: O(1) +// Space: O(1) +int computeArea(int ax1, int ay1, int ax2, int ay2, int bx1, int by1, int bx2, int by2){ + int areaA = (ay2 - ay1) * (ax2 - ax1); + int areaB = (by2 - by1) * (bx2 - bx1); + int areaInteresection = intersectionSize(ax1, ax2, bx1, bx2) * intersectionSize(ay1, ay2, by1, by2); + + return areaA + areaB - areaInteresection; +} From 9a3d934705a75a75e025f02bc646017b630e4dc5 Mon Sep 17 00:00:00 2001 From: Yaduttam Pareek Date: Fri, 25 Nov 2022 06:39:35 +0530 Subject: [PATCH 041/156] chore(fix): specify the player's turn in `naval_battle.c` (#1158) --- games/naval_battle.c | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/games/naval_battle.c b/games/naval_battle.c index 6e02762cdf..ec7f540c6e 100644 --- a/games/naval_battle.c +++ b/games/naval_battle.c @@ -885,7 +885,7 @@ int main() if (plays % 2 != 0) { printMessageScore(pts1, pts2); - printMessage("Player's turn 1"); + printMessage("Player 1's turn"); printsTray(Player2, 1); scanf("%d %c", &line, &column); @@ -911,7 +911,7 @@ int main() else { printMessageScore(pts1, pts2); - printMessage("Player's turn 1"); + printMessage("Player 2's turn"); printsTray(Player1, 1); scanf("%d %c", &line, &column); From 2f8fc8ca9912065eb06c26c13f7a5aa2f2542dfb Mon Sep 17 00:00:00 2001 From: David Leal Date: Thu, 24 Nov 2022 19:43:44 -0600 Subject: [PATCH 042/156] fix: use FreeGlut newest GitHub link (#1159) * updating DIRECTORY.md * fix: update FreeGlut link Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> --- DIRECTORY.md | 9 ++++++++- graphics/CMakeLists.txt | 2 +- 2 files changed, 9 insertions(+), 2 deletions(-) diff --git a/DIRECTORY.md b/DIRECTORY.md index 45f93d8005..c0f0c880ff 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -162,7 +162,9 @@ ## Leetcode * Src * [1](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1.c) + * [10](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/10.c) * [1008](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1008.c) + * [1009](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1009.c) * [101](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/101.c) * [1019](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1019.c) * [104](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/104.c) @@ -182,12 +184,15 @@ * [125](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/125.c) * [13](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/13.c) * [136](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/136.c) + * [14](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/14.c) * [141](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/141.c) * [142](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/142.c) + * [1524](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1524.c) * [153](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/153.c) * [160](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/160.c) * [169](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/169.c) * [173](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/173.c) + * [1752](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1752.c) * [189](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/189.c) * [190](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/190.c) * [191](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/191.c) @@ -200,6 +205,7 @@ * [2130](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2130.c) * [215](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/215.c) * [217](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/217.c) + * [223](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/223.c) * [226](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/226.c) * [231](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/231.c) * [234](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/234.c) @@ -292,6 +298,7 @@ * [Prime Factoriziation](https://github.com/TheAlgorithms/C/blob/HEAD/misc/prime_factoriziation.c) * [Prime Seive](https://github.com/TheAlgorithms/C/blob/HEAD/misc/prime_seive.c) * [Quartile](https://github.com/TheAlgorithms/C/blob/HEAD/misc/quartile.c) + * [Rot13](https://github.com/TheAlgorithms/C/blob/HEAD/misc/rot13.c) * [Rselect](https://github.com/TheAlgorithms/C/blob/HEAD/misc/rselect.c) * [Run Length Encoding](https://github.com/TheAlgorithms/C/blob/HEAD/misc/run_length_encoding.c) * [Strong Number](https://github.com/TheAlgorithms/C/blob/HEAD/misc/strong_number.c) @@ -319,7 +326,7 @@ * [Variance](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/variance.c) ## Process Scheduling Algorithms - * [Non Preemptive Priority Scheduling](https://github.com/TheAlgorithms/C/blob/master/process_scheduling_algorithms/non_preemptive_priority_scheduling.c) + * [Non Preemptive Priority Scheduling](https://github.com/TheAlgorithms/C/blob/HEAD/process_scheduling_algorithms/non_preemptive_priority_scheduling.c) ## Project Euler * Problem 1 diff --git a/graphics/CMakeLists.txt b/graphics/CMakeLists.txt index 046160b60f..6bb38bc294 100644 --- a/graphics/CMakeLists.txt +++ b/graphics/CMakeLists.txt @@ -6,7 +6,7 @@ if(OpenGL_FOUND) include(ExternalProject) ExternalProject_Add ( FREEGLUT-PRJ - URL https://sourceforge.net/projects/freeglut/files/freeglut/3.2.1/freeglut-3.2.1.tar.gz + URL https://github.com/FreeGLUTProject/freeglut/releases/download/v3.2.1/freeglut-3.2.1.tar.gz URL_MD5 cd5c670c1086358598a6d4a9d166949d CMAKE_GENERATOR ${CMAKE_GENERATOR} --config Release CMAKE_GENERATOR_TOOLSET ${CMAKE_GENERATOR_TOOLSET} From 7aba094afb43e8f2961174914c854d40bb04c792 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 25 Nov 2022 09:14:01 +0400 Subject: [PATCH 043/156] feat: add trapping rain water (#1132) * add trapping rain water. * add short description of algorithm * substitute min/max with define * fix directory DIRECTORY.md * chore: apply suggestions from code review Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/README.md | 2 +- leetcode/src/42.c | 27 +++++++++++++++++++++++++++ 3 files changed, 29 insertions(+), 1 deletion(-) create mode 100644 leetcode/src/42.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 1e3ffc236f..040d5b8dbb 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -26,6 +26,7 @@ | 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers/) | [C](./src/29.c) | Medium | | 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position/) | [C](./src/35.c) | Easy | | 38 | [Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c) | Easy | +| 42 | [Trapping Rain Water](https://leetcode.com/problems/trapping-rain-water/) | [C](./src/42.c) | Hard | | 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | | 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | [C](./src/62.c) | Medium | | 66 | [Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c) | Easy | diff --git a/leetcode/README.md b/leetcode/README.md index 47c2b5836e..53931eaf90 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -74,4 +74,4 @@ git push origin solution/your-solution-name:solution/your-solution-name 4. You're done now! You just have to make a [**pull request**](https://github.com/TheAlgorithms/C/compare). 🎉 -If you need any help, don't hesitate to ask and join our [**Discord server**](https://the-algorithms.com/discord)! 🙂 +If you need any help, don't hesitate to ask and join our [**Discord server**](https://the-algorithms.com/discord)! 🙂 \ No newline at end of file diff --git a/leetcode/src/42.c b/leetcode/src/42.c new file mode 100644 index 0000000000..7c49239740 --- /dev/null +++ b/leetcode/src/42.c @@ -0,0 +1,27 @@ +#define max(x,y)(((x)>(y))?(x):(y)) +#define min(x,y)(((x)<(y))?(x):(y)) + +// Max stack. Runtime: O(n), Space: O(n) +// Algorithm description: +// - Calculate the stack of maximums from right board. +// - For each index find left maximum and right maximum of height +// - The each index if heights could place nor greater than minimum of left and right max minus curr height +// - Sum all index in result +int trap(int* height, int heightSize){ + int* rightMaxStack = malloc(heightSize * sizeof(int)); + rightMaxStack[heightSize - 1] = height[heightSize - 1]; + + for (int i = heightSize - 2; i >= 0; i--){ + rightMaxStack[i] = max(rightMaxStack[i + 1], height[i]); + } + + int leftMax = 0; + int result = 0; + for (int i = 0; i < heightSize; i++){ + leftMax = max(leftMax, height[i]); + result += max(0, min(leftMax, rightMaxStack[i]) - height[i]); + } + + free(rightMaxStack); + return result; +} From 99f06e97e761b9048951e5cc7c5970e2fbf83c81 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 25 Nov 2022 09:14:53 +0400 Subject: [PATCH 044/156] feat: add Minimum Path Cost LeetCode problem (#1144) --- leetcode/DIRECTORY.md | 1 + leetcode/src/2304.c | 42 ++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 43 insertions(+) create mode 100644 leetcode/src/2304.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 040d5b8dbb..a79c1aff39 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -100,3 +100,4 @@ | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | +| 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | diff --git a/leetcode/src/2304.c b/leetcode/src/2304.c new file mode 100644 index 0000000000..d8cfcb2521 --- /dev/null +++ b/leetcode/src/2304.c @@ -0,0 +1,42 @@ +#define min(x,y)(((x)<(y))?(x):(y)) + +// DP up -> down. We are going down from gridline to gridline +// and collect the minumum cost path. +// Runtime : O(gridSize*gridColSize*gridColSize) +// Space: O(gridColSize) +int minPathCost(int** grid, int gridSize, int* gridColSize, int** moveCost, int moveCostSize, int* moveCostColSize){ + int* dp = (int*)calloc(gridColSize[0], sizeof(int)); + int* newDp = (int*)calloc(gridColSize[0], sizeof(int)); + + for(int i = 0; i < gridSize - 1; i++){ + int currGridColSize = gridColSize[i]; + for(int j = 0; j < currGridColSize; j++){ + newDp[j] = -1; + } + + for(int j = 0; j < currGridColSize; j++){ + int currGridItem = grid[i][j]; + for(int z = 0; z < currGridColSize; z++){ + int currMoveCost = dp[j] + moveCost[currGridItem][z] + currGridItem; + + newDp[z] = (newDp[z] == -1) ? currMoveCost : min(newDp[z], currMoveCost); + } + } + + for(int j = 0; j < currGridColSize; j++){ + dp[j] = newDp[j]; + } + } + + // Find minimum value. + int minValue = dp[0] + grid[gridSize - 1][0]; + for(int j = 1; j < gridColSize[0]; j++){ + minValue = min(minValue, dp[j] + grid[gridSize - 1][j]); + } + + // free resources + free(dp); + free(newDp); + + return minValue; +} From 077517d6ae840b0c5df62153b8861bd0f14c2afc Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 25 Nov 2022 22:35:54 +0400 Subject: [PATCH 045/156] feat: add Sum of Even Numbers LeetCode problem (#1145) * add Sum of Even Numbers After Queries leetcode task * chore: apply suggestions from code review Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/985.c | 39 +++++++++++++++++++++++++++++++++++++++ 2 files changed, 40 insertions(+) create mode 100644 leetcode/src/985.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index a79c1aff39..3b3ec304f2 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -92,6 +92,7 @@ | 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | | 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c) | Easy | | 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | +| 985 | [Sum of Even Numbers After Queries](https://leetcode.com/problems/sum-of-even-numbers-after-queries/) | [C](./src/985.c) | Medium | | 1009 | [Complement of Base 10 Integer](https://leetcode.com/problems/complement-of-base-10-integer/) | [C](./src/1009.c) | Easy | | 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | diff --git a/leetcode/src/985.c b/leetcode/src/985.c new file mode 100644 index 0000000000..7a2343ab22 --- /dev/null +++ b/leetcode/src/985.c @@ -0,0 +1,39 @@ +/** + * Note: The returned array must be malloced, assume caller calls free(). + */ + +// collecting sum Runtime: O(len(queries)), Space: O(1) +int* sumEvenAfterQueries(int* nums, int numsSize, int** queries, int queriesSize, int* queriesColSize, int* returnSize){ + int summ = 0; + int* result = malloc(queriesSize * sizeof(int)); + *returnSize = queriesSize; + + for(int i = 0; i < numsSize; i++){ + if (nums[i] % 2 == 0) { + summ += nums[i]; + } + } + + for(int i = 0; i < queriesSize; i++){ + int* query = queries[i]; + int val = query[0]; + int index = query[1]; + + // sub index value from summ if it's even + if (nums[index] % 2 == 0) { + summ -= nums[index]; + } + + // modify the nums[index] value + nums[index] += val; + + // add index value from summ if it's even + if (nums[index] % 2 == 0) { + summ += nums[index]; + } + + result[i] = summ; + } + + return result; +} From 8d28f1d36fdbf308d742525f80f9a6e24803668c Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 25 Nov 2022 22:57:19 +0400 Subject: [PATCH 046/156] feat: add Online Stock Span (#1142) * add Online Stock Span * free obj * Update leetcode/src/901.c Co-authored-by: David Leal * Rename README.md to DIRECTORY.md * merge conflicts * chore: apply suggestions from code review * chore: apply suggestions from code review * Update leetcode/src/901.c Co-authored-by: Taj Co-authored-by: David Leal Co-authored-by: Taj --- leetcode/DIRECTORY.md | 1 + leetcode/src/901.c | 68 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 69 insertions(+) create mode 100644 leetcode/src/901.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 3b3ec304f2..3adcf8d20b 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -87,6 +87,7 @@ | 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones/) | [C](./src/771.c) | Easy | | 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array/) | [C](./src/852.c) | Easy | | 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list/) | [C](./src/876.c) | Easy | +| 901 | [Online Stock Span](https://leetcode.com/problems/online-stock-span/) | [C](./src/901.c) | Medium | | 905 | [Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity/) | [C](./src/905.c) | Easy | | 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters/) | [C](./src/917.c) | Easy | | 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | diff --git a/leetcode/src/901.c b/leetcode/src/901.c new file mode 100644 index 0000000000..efa712b69c --- /dev/null +++ b/leetcode/src/901.c @@ -0,0 +1,68 @@ +// Use monotonic stack. +// Keep the stack of monotonically increasing price and index. + +// Runtime: O(n) +// Space: O(n) +typedef struct stack{ + int price; + int index; + struct stack* previous; +} Stack; + + +typedef struct { + int index; + Stack* stackPointer; + Stack* sentry; +} StockSpanner; + + +StockSpanner* stockSpannerCreate() { + Stack* sentry = (Stack *)malloc(sizeof(Stack)); + StockSpanner* result = (StockSpanner *)malloc(sizeof(StockSpanner)); + result->index = 0; + result->sentry = sentry; + result->stackPointer = sentry; + return result; +} + +int stockSpannerNext(StockSpanner* obj, int price) { + while(obj->stackPointer != obj->sentry && obj->stackPointer->price <= price){ + Stack* currStackPointer = obj->stackPointer; + obj->stackPointer = obj->stackPointer->previous; + free(currStackPointer); + } + + obj->index += 1; + int result = obj->index; + if (obj->stackPointer != obj->sentry){ + result -= obj->stackPointer->index; + } + + Stack* newStackItem = (Stack *)malloc(sizeof(Stack)); + newStackItem->index = obj->index; + newStackItem->price = price; + newStackItem->previous = obj->stackPointer; + obj->stackPointer = newStackItem; + + return result; +} + +void stockSpannerFree(StockSpanner* obj) { + while(obj->stackPointer != obj->sentry){ + Stack* currStackPointer = obj->stackPointer; + obj->stackPointer = obj->stackPointer->previous; + free(currStackPointer); + } + + free(obj->sentry); + free(obj); +} + +/** + * Your StockSpanner struct will be instantiated and called as such: + * StockSpanner* obj = stockSpannerCreate(); + * int param_1 = stockSpannerNext(obj, price); + + * stockSpannerFree(obj); + */ From defd82dda17d706db5409359aee23a5ec35acd42 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 26 Nov 2022 03:38:33 +0400 Subject: [PATCH 047/156] feat: add Minimum Deletions LeetCode problem (#1138) * add Minimum Deletions to Make String Balanced * Update 1653.c add new line at the end * Rename README.md to DIRECTORY.md * chore: apply suggestions from code review * Update leetcode/src/1653.c Co-authored-by: Taj * Update leetcode/src/1653.c Co-authored-by: Taj * Update leetcode/src/1653.c Co-authored-by: Taj * Update 1653.c remove redundant define * Update leetcode/src/1653.c Co-authored-by: John Law Co-authored-by: David Leal Co-authored-by: Taj Co-authored-by: John Law --- leetcode/DIRECTORY.md | 1 + leetcode/src/1653.c | 29 +++++++++++++++++++++++++++++ 2 files changed, 30 insertions(+) create mode 100644 leetcode/src/1653.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 3adcf8d20b..7a6dcc5de8 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -100,6 +100,7 @@ | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | +| 1653 | [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced/) | [C](./src/1653.c) | Medium | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | | 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | diff --git a/leetcode/src/1653.c b/leetcode/src/1653.c new file mode 100644 index 0000000000..04ac0c16b6 --- /dev/null +++ b/leetcode/src/1653.c @@ -0,0 +1,29 @@ +#define min(X, Y) ((X) < (Y) ? (X) : (Y)) + +// Dynamic programming approach. Down -> Up. +// Runtime: O(n) +// Space: O(1) +int minimumDeletions(char * s){ + int len = strlen(s); + + int aStateValue = s[0] == 'b'; + + int bStateValue = 0; + + int newAStateValue; + int newBStateValue; + + for(int i = 1; i < len; i++){ + newAStateValue = aStateValue + (s[i] == 'b'); + + newBStateValue = min( + aStateValue, + bStateValue + (s[i] == 'a') + ); + + aStateValue = newAStateValue; + bStateValue = newBStateValue; + } + + return min(aStateValue, bStateValue); +} From 435b4994ce70e3e663916caa6478375a7fbec83c Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 26 Nov 2022 04:54:41 +0400 Subject: [PATCH 048/156] feat: add Validate Binary Search Tree (#1153) * add Validate Binary Search Tree * improve condition --- leetcode/DIRECTORY.md | 1 + leetcode/src/98.c | 24 ++++++++++++++++++++++++ 2 files changed, 25 insertions(+) create mode 100644 leetcode/src/98.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 7a6dcc5de8..d02cf7ad43 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -33,6 +33,7 @@ | 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c) | Medium | | 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list/) | [C](./src/83.c) | Easy | | 94 | [Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal/) | [C](./src/94.c) | Medium | +| 98 | [Validate Binary Search Tree](https://leetcode.com/problems/validate-binary-search-tree/) | [C](./src/98.c) | Medium | | 101 | [Symmetric Tree](https://leetcode.com/problems/symmetric-tree/) | [C](./src/101.c) | Easy | | 104 | [Maximum Depth of Binary Tree](https://leetcode.com/problems/maximum-depth-of-binary-tree/) | [C](./src/104.c) | Easy | | 108 | [Convert Sorted Array to Binary Search Tree](https://leetcode.com/problems/convert-sorted-array-to-binary-search-tree/) | [C](./src/108.c) | Easy | diff --git a/leetcode/src/98.c b/leetcode/src/98.c new file mode 100644 index 0000000000..775fe9e1b7 --- /dev/null +++ b/leetcode/src/98.c @@ -0,0 +1,24 @@ +/** + * Definition for a binary tree node. + * struct TreeNode { + * int val; + * struct TreeNode *left; + * struct TreeNode *right; + * }; + */ + +// Depth first search approach. +// Runtime: O(n) +// Space: O(1) +bool checkIsBst(struct TreeNode* node, bool leftBoundInf, int leftBound, bool rightBoundInf, int rightBound){ + return + (node == NULL) + || (leftBoundInf || node->val > leftBound) + && (rightBoundInf || node->val < rightBound) + && checkIsBst(node->left, leftBoundInf, leftBound, false, node->val) + && checkIsBst(node->right, false, node->val, rightBoundInf, rightBound); +} + +bool isValidBST(struct TreeNode* root){ + return checkIsBst(root, true, INT_MIN, true, INT_MAX); +} From 6b2697e244f71897fbac10efacd79d2b0d712c53 Mon Sep 17 00:00:00 2001 From: Focus <65309793+Focusucof@users.noreply.github.com> Date: Thu, 1 Dec 2022 15:59:15 -0500 Subject: [PATCH 049/156] feat: conversion from roman to decimal numbers (#1104) * feat: added roman_numerals_to_decimal.c * added newline at end of file * updating DIRECTORY.md * Update conversions/roman_numerals_to_decimal.c Co-authored-by: David Leal * Update conversions/roman_numerals_to_decimal.c Co-authored-by: David Leal Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> Co-authored-by: David Leal --- conversions/roman_numerals_to_decimal.c | 121 ++++++++++++++++++++++++ 1 file changed, 121 insertions(+) create mode 100644 conversions/roman_numerals_to_decimal.c diff --git a/conversions/roman_numerals_to_decimal.c b/conversions/roman_numerals_to_decimal.c new file mode 100644 index 0000000000..7cf8c9c78c --- /dev/null +++ b/conversions/roman_numerals_to_decimal.c @@ -0,0 +1,121 @@ +/** + * @file + * @brief Conversion of [roman numerals](https://en.wikipedia.org/wiki/Roman_numerals) to decimal + * @details Roman numerals are an ancient Roman numeral system consisting of the symbols I, V, X, L, C, D, and M + * + * @author [Focusucof](https://github.com/Focusucof) + */ + +#include /// for assert +#include /// for IO operations +#include /// for strlen() + +/** + * @brief Convert roman numeral symbol to a decimal value helper function + * @param symbol Roman numeral char + * @returns Integer of decimal value for given symbol + */ +int symbol(char symbol) { + int value = 0; + switch(symbol) { + case 'I': + value = 1; + break; + case 'V': + value = 5; + break; + case 'X': + value = 10; + break; + case 'L': + value = 50; + break; + case 'C': + value = 100; + break; + case 'D': + value = 500; + break; + case 'M': + value = 1000; + break; + } + return value; +} + +/** + * @brief Converts roman numerals into a decimal number + * @param input Input roman numeral as a C-string + * @returns The converted number in decimal form + */ +int roman_to_decimal(char input[]) { + int result = 0; // result in decimal + + for(int i = 0; i < strlen(input); i++) { + if(strlen(input) > i + 1) { + if(symbol(input[i]) >= symbol(input[i + 1])) { + result += symbol(input[i]); // add value to sum + } else { + result += symbol(input[i + 1]) - symbol(input[i]); // if the current symbol is smaller than the next (ex. IV), subtract it from the next symbol + i++; // skip over an extra symbol + } + } else { + result += symbol(input[i]); // add value to sum + } + } + return result; +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() { + // 1st test + char input[] = "MCMIV"; + int expected = 1904; + + int output = roman_to_decimal(input); + + printf("TEST 1\n"); + printf("Input: %s\n", input); + printf("Expected Output: %d\n", expected); + printf("Output: %d\n", output); + assert(output == expected); + printf("== TEST PASSED ==\n\n"); + + // 2nd test + char input2[] = "MMMDCCXXIV"; + expected = 3724; + + output = roman_to_decimal(input2); + + printf("TEST 2\n"); + printf("Input: %s\n", input2); + printf("Expected Output: %d\n", expected); + printf("Output: %d\n", output); + assert(output == expected); + printf("== TEST PASSED ==\n\n"); + + // 3rd test + char input3[] = "III"; + expected = 3; + + output = roman_to_decimal(input3); + + printf("TEST 3\n"); + printf("Input: %s\n", input3); + printf("Expected Output: %d\n", expected); + printf("Output: %d\n", output); + assert(output == expected); + printf("== TEST PASSED ==\n\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() { + test(); // run self-test implementations + return 0; +} From bb11a352271401bb46281d109759202520ff9e31 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 2 Dec 2022 08:55:36 +0400 Subject: [PATCH 050/156] feat: add Maximize the Confusion LeetCode problem (#1150) * add Maximize the Confusion of an Exam leetcode * Update leetcode/src/2024.c Co-authored-by: Taj * Update 2024.c fix build Co-authored-by: Taj --- leetcode/DIRECTORY.md | 1 + leetcode/src/2024.c | 33 +++++++++++++++++++++++++++++++++ 2 files changed, 34 insertions(+) create mode 100644 leetcode/src/2024.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index d02cf7ad43..da62356470 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -103,5 +103,6 @@ | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | | 1653 | [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced/) | [C](./src/1653.c) | Medium | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | +| 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | | 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | diff --git a/leetcode/src/2024.c b/leetcode/src/2024.c new file mode 100644 index 0000000000..5796f0b03f --- /dev/null +++ b/leetcode/src/2024.c @@ -0,0 +1,33 @@ +#define max(X, Y) ((X) > (Y) ? (X) : (Y)) + +int maximizeTarget(char * answerKey, char targetChar, int k){ + int leftIndex = -1; + int result = 0; + int currTargetChars = 0; + int lenAnswerKey = strlen(answerKey); + + for (int rightIndex = 0; rightIndex < lenAnswerKey; rightIndex++){ + char ch = answerKey[rightIndex]; + if (ch == targetChar){ + currTargetChars++; + } + + while (rightIndex - leftIndex > currTargetChars + k) { + leftIndex++; + if (answerKey[leftIndex] == targetChar){ + currTargetChars--; + } + } + + result = max(result, rightIndex - leftIndex); + } + + return result; +} + +// Use sliding window approach + two pointers. +// Runtime: O(n) +// Space: O(1) +int maxConsecutiveAnswers(char * answerKey, int k){ + return max(maximizeTarget(answerKey, 'T', k), maximizeTarget(answerKey, 'F', k)); +} From 0f5f241a1d0a586cc7eb634c05f9320d793d1ad2 Mon Sep 17 00:00:00 2001 From: Focus <65309793+Focusucof@users.noreply.github.com> Date: Fri, 2 Dec 2022 00:01:16 -0500 Subject: [PATCH 051/156] feat: add Celsius to Fahrenheit conversion (#1129) * feat: added celcius_to_fahrenheit.c * docs: added comment to 1st test * updating DIRECTORY.md * fix: changed spelling of 'celcius' to 'celsius' * updating DIRECTORY.md * Update conversions/celsius_to_fahrenheit.c Co-authored-by: David Leal * Update conversions/celsius_to_fahrenheit.c Co-authored-by: David Leal * chore: apply suggestions from code review Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> Co-authored-by: David Leal --- conversions/celsius_to_fahrenheit.c | 74 +++++++++++++++++++++++++++++ 1 file changed, 74 insertions(+) create mode 100644 conversions/celsius_to_fahrenheit.c diff --git a/conversions/celsius_to_fahrenheit.c b/conversions/celsius_to_fahrenheit.c new file mode 100644 index 0000000000..3c1bda9e09 --- /dev/null +++ b/conversions/celsius_to_fahrenheit.c @@ -0,0 +1,74 @@ +/** + * @file + * @brief Conversion of temperature in degrees from [Celsius](https://en.wikipedia.org/wiki/Celsius) + * to [Fahrenheit](https://en.wikipedia.org/wiki/Fahrenheit). + * + * @author [Focusucof](https://github.com/Focusucof) + */ + +#include /// for assert +#include /// for IO operations + +/** + * @brief Convert celsius to Fahrenheit + * @param celsius Temperature in degrees celsius double + * @returns Double of temperature in degrees Fahrenheit + */ + double celcius_to_fahrenheit(double celsius) { + return (celsius * 9.0 / 5.0) + 32.0; + } + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() { + // 1st test + double input = 0.0; + double expected = 32.0; + + double output = celcius_to_fahrenheit(input); + + // 1st test + printf("TEST 1\n"); + printf("Input: %f\n", input); + printf("Expected Output: %f\n", expected); + printf("Output: %f\n", output); + assert(output == expected); + printf("== TEST PASSED ==\n\n"); + + // 2nd test + input = 100.0; + expected = 212.0; + + output = celcius_to_fahrenheit(input); + + printf("TEST 2\n"); + printf("Input: %f\n", input); + printf("Expected Output: %f\n", expected); + printf("Output: %f\n", output); + assert(output == expected); + printf("== TEST PASSED ==\n\n"); + + // 3rd test + input = 22.5; + expected = 72.5; + + output = celcius_to_fahrenheit(input); + + printf("TEST 3\n"); + printf("Input: %f\n", input); + printf("Expected Output: %f\n", expected); + printf("Output: %f\n", output); + assert(output == expected); + printf("== TEST PASSED ==\n\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() { + test(); // run self-test implementations + return 0; +} From 794ec129aec8cf4e904041c88ef1d1d40d194958 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 2 Dec 2022 09:03:24 +0400 Subject: [PATCH 052/156] feat: add Minimum Number of Operations to... (#1146) ...Move All Balls to Each Box LeetCode problem. * add Minimum Number of Operations to Move All Balls to Each Box leetcode * chore: apply suggestions from code review * Update leetcode/src/1769.c Co-authored-by: Taj Co-authored-by: David Leal Co-authored-by: Taj --- leetcode/DIRECTORY.md | 1 + leetcode/src/1769.c | 41 +++++++++++++++++++++++++++++++++++++++++ 2 files changed, 42 insertions(+) create mode 100644 leetcode/src/1769.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index da62356470..73157c2bec 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -100,6 +100,7 @@ | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | +| 1769 | [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box/) | [C](./src/1769.c) | Medium | | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | | 1653 | [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced/) | [C](./src/1653.c) | Medium | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | diff --git a/leetcode/src/1769.c b/leetcode/src/1769.c new file mode 100644 index 0000000000..e1a81d0492 --- /dev/null +++ b/leetcode/src/1769.c @@ -0,0 +1,41 @@ +/** + * Note: The returned array must be malloced, assume caller calls free(). + */ + +// Count one's from right. Each step from right side decrease for one for each 1's and increase from left: +// 1001*0101 -> left: 4 + 1, right: 2 + 4 +// 10010*101 -> left: (4+1) + (1+1), right: (2-1) + (4-1) +// Runtime: O(n) +// Space: O(1) +int* minOperations(char* boxes, int* returnSize){ + int leftOnes = 0; + int leftCommonDistance = 0; + + int rightOnes = 0; + int rightCommonDistance = 0; + + int boxesLength = strlen(boxes); + + *returnSize = boxesLength; + int* result = malloc(boxesLength * sizeof(int)); + + for (int i = 0; i < boxesLength; i++){ + if (boxes[i] == '1'){ + rightOnes += 1; + rightCommonDistance += i; + } + } + + for (int i = 0; i < boxesLength; i++){ + if (boxes[i] == '1'){ + rightOnes -= 1; + leftOnes += 1; + } + + result[i] = rightCommonDistance + leftCommonDistance; + rightCommonDistance -= rightOnes; + leftCommonDistance += leftOnes; + } + + return result; +} From b37bf7f6b996d54baf00c4a37a68e29cee7f1021 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 2 Dec 2022 09:11:58 +0400 Subject: [PATCH 053/156] feat: add Trim a Binary Search Tree LeetCode problem (#1156) --- leetcode/DIRECTORY.md | 1 + leetcode/src/669.c | 30 ++++++++++++++++++++++++++++++ 2 files changed, 31 insertions(+) create mode 100644 leetcode/src/669.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 73157c2bec..9c1e26afb9 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -80,6 +80,7 @@ | 561 | [Array Partition I](https://leetcode.com/problems/array-partition-i/) | [C](./src/561.c) | Easy | | 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees/) | [C](./src/617.c) | Easy | | 647 | [Palindromic Substring](https://leetcode.com/problems/palindromic-substrings/) | [C](./src/647.c) | Medium | +| 669 | [Trim a Binary Search Tree](https://leetcode.com/problems/trim-a-binary-search-tree/) | [C](./src/669.c) | Medium | | 674 | [Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence/) | [C](./src/674.c) | Easy | | 700 | [Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree/) | [C](./src/700.c) | Easy | | 701 | [Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree/) | [C](./src/701.c) | Medium | diff --git a/leetcode/src/669.c b/leetcode/src/669.c new file mode 100644 index 0000000000..f8842a3463 --- /dev/null +++ b/leetcode/src/669.c @@ -0,0 +1,30 @@ +/** + * Definition for a binary tree node. + * struct TreeNode { + * int val; + * struct TreeNode *left; + * struct TreeNode *right; + * }; + */ + + +// Depth-First Search +// Runtime: O(n) +// Space: O(1) +struct TreeNode* trimBST(struct TreeNode* root, int low, int high){ + if (root == NULL){ + return NULL; + } + + if (root->val > high){ + return trimBST(root->left, low, high); + } + + if (root->val < low){ + return trimBST(root->right, low, high); + } + + root->left = trimBST(root->left, low, high); + root->right = trimBST(root->right, low, high); + return root; +} From 2ee92040f33dc1ba24e04df955136852ca1fd395 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 2 Dec 2022 09:18:59 +0400 Subject: [PATCH 054/156] feat: add Maximum Erasure Value LeetCode problem (#1137) * add leetcode Maximum Erasure Value * Update 1695.c add new line at the end * Rename README.md to DIRECTORY.md * chore: apply suggestions from code review * Update DIRECTORY.md * Update leetcode/DIRECTORY.md Co-authored-by: Taj Co-authored-by: David Leal Co-authored-by: Taj --- leetcode/DIRECTORY.md | 1 + leetcode/src/1695.c | 29 +++++++++++++++++++++++++++++ 2 files changed, 30 insertions(+) create mode 100644 leetcode/src/1695.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 9c1e26afb9..3b7fd16b3e 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -101,6 +101,7 @@ | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | +| 1695 | [Maximum Erasure Value](https://leetcode.com/problems/maximum-erasure-value/) | [C](./src/1695.c) | Medium | | 1769 | [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box/) | [C](./src/1769.c) | Medium | | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | | 1653 | [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced/) | [C](./src/1653.c) | Medium | diff --git a/leetcode/src/1695.c b/leetcode/src/1695.c new file mode 100644 index 0000000000..c0a57247a0 --- /dev/null +++ b/leetcode/src/1695.c @@ -0,0 +1,29 @@ +// Window sliding. Runtime: O(n), Space: O(n) +int maximumUniqueSubarray(int* nums, int numsSize){ + short* numsSet = (short*)calloc(10001, sizeof(short)); + numsSet[nums[0]] = 1; + + int maxSum = nums[0]; + + int windowSumm = maxSum; + int leftIndex = 0; + + int num = 0; + for(int i = 1; i < numsSize; i++){ + num = nums[i]; + while (numsSet[num] != 0){ + numsSet[nums[leftIndex]] = 0; + windowSumm -= nums[leftIndex]; + leftIndex++; + } + + numsSet[num] = 1; + windowSumm += num; + + if (maxSum < windowSumm){ + maxSum = windowSumm; + } + } + + return maxSum; +} From c97a33a6c2b05f34a4245a025457177803fbddcb Mon Sep 17 00:00:00 2001 From: Taj Date: Fri, 16 Dec 2022 19:53:06 +0000 Subject: [PATCH 055/156] fix: Awesome Workflow issues (#1176) * Delete codeql_analysis.yml * fixing workflows --- .github/workflows/awesome_workflow.yml | 4 +- .github/workflows/codeql.yml | 56 ++++++++++++++++++++++++++ .github/workflows/codeql_analysis.yml | 48 ---------------------- .github/workflows/gh-pages.yml | 2 +- DIRECTORY.md | 12 ++++++ 5 files changed, 71 insertions(+), 51 deletions(-) create mode 100644 .github/workflows/codeql.yml delete mode 100644 .github/workflows/codeql_analysis.yml diff --git a/.github/workflows/awesome_workflow.yml b/.github/workflows/awesome_workflow.yml index 8b70b04cfa..a32b532d80 100644 --- a/.github/workflows/awesome_workflow.yml +++ b/.github/workflows/awesome_workflow.yml @@ -15,8 +15,8 @@ jobs: - uses: actions/setup-python@v2 - name: requirements run: | - sudo apt -qq -y update - sudo apt -qq install clang-tidy-10 clang-format-10 + sudo apt-get -qq update + sudo apt-get -qq install clang-tidy clang-format - name: Setup Git Specs run: | git config --global user.name github-actions diff --git a/.github/workflows/codeql.yml b/.github/workflows/codeql.yml new file mode 100644 index 0000000000..e856dd5f9c --- /dev/null +++ b/.github/workflows/codeql.yml @@ -0,0 +1,56 @@ +name: "CodeQL" + +on: + push: + branches: [ "master" ] + pull_request: + branches: [ "master" ] + +jobs: + analyze: + name: Analyze + runs-on: ubuntu-latest + permissions: + actions: read + contents: read + security-events: write + + strategy: + fail-fast: false + matrix: + language: [ 'cpp' ] + steps: + - name: Checkout repository + uses: actions/checkout@v3 + - name: Initialize CodeQL + uses: github/codeql-action/init@v2 + with: + languages: ${{ matrix.language }} + # If you wish to specify custom queries, you can do so here or in a config file. + # By default, queries listed here will override any specified in a config file. + # Prefix the list here with "+" to use these queries and those in the config file. + + # Details on CodeQL's query packs refer to : https://docs.github.com/en/code-security/code-scanning/automatically-scanning-your-code-for-vulnerabilities-and-errors/configuring-code-scanning#using-queries-in-ql-packs + # queries: security-extended,security-and-quality + + # Autobuild attempts to build any compiled languages (C/C++, C#, Go, or Java). + # If this step fails, then you should remove it and run the build manually (see below) + - name: Autobuild + uses: github/codeql-action/autobuild@v2 + + # ℹ️ Command-line programs to run using the OS shell. + # 📚 See https://docs.github.com/en/actions/using-workflows/workflow-syntax-for-github-actions#jobsjob_idstepsrun + + # If the Autobuild fails above, remove it and uncomment the following three lines. + # modify them (or add more) to build your code if your project, please refer to the EXAMPLE below for guidance. + + # - run: | + # echo "Run, Build Application using script" + # ./location_of_script_within_repo/buildscript.sh + # + # In our case, this would be a CMake build step. + + - name: Perform CodeQL Analysis + uses: github/codeql-action/analyze@v2 + with: + category: "/language:${{matrix.language}}" diff --git a/.github/workflows/codeql_analysis.yml b/.github/workflows/codeql_analysis.yml deleted file mode 100644 index aa3ddbd7f7..0000000000 --- a/.github/workflows/codeql_analysis.yml +++ /dev/null @@ -1,48 +0,0 @@ -name: "CodeQL" -on: [push, pull_request] - -jobs: - analyze: - name: Analyze - runs-on: ubuntu-latest - - strategy: - fail-fast: false - matrix: - language: [ 'cpp' ] - # CodeQL supports [ 'cpp', 'csharp', 'go', 'java', 'javascript', 'python' ] - # Learn more: - # https://docs.github.com/en/free-pro-team@latest/github/finding-security-vulnerabilities-and-errors-in-your-code/configuring-code-scanning#changing-the-languages-that-are-analyzed - - steps: - - name: Checkout repository - uses: actions/checkout@main - - # Initializes the CodeQL tools for scanning. - - name: Initialize CodeQL - uses: github/codeql-action/init@main - with: - languages: ${{ matrix.language }} - # If you wish to specify custom queries, you can do so here or in a config file. - # By default, queries listed here will override any specified in a config file. - # Prefix the list here with "+" to use these queries and those in the config file. - # queries: ./path/to/local/query, your-org/your-repo/queries@main - - # Autobuild attempts to build any compiled languages (C/C++, C#, or Java). - # If this step fails, then you should remove it and run the build manually (see below) - - name: Autobuild - uses: github/codeql-action/autobuild@main - - # ℹ️ Command-line programs to run using the OS shell. - # 📚 https://git.io/JvXDl - - # ✏️ If the Autobuild fails above, remove it and uncomment the following three lines - # and modify them (or add more) to build your code if your project - # uses a compiled language - - #- run: | - # make bootstrap - # make release - - - name: Perform CodeQL Analysis - uses: github/codeql-action/analyze@main diff --git a/.github/workflows/gh-pages.yml b/.github/workflows/gh-pages.yml index 881ea1c337..4d30ca99e7 100644 --- a/.github/workflows/gh-pages.yml +++ b/.github/workflows/gh-pages.yml @@ -8,7 +8,7 @@ jobs: build: runs-on: macos-latest steps: - - uses: actions/checkout@master + - uses: actions/checkout@v3 with: submodules: true - name: Install requirements diff --git a/DIRECTORY.md b/DIRECTORY.md index c0f0c880ff..8dbb7a0640 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -19,6 +19,7 @@ * [Binary To Hexadecimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/binary_to_hexadecimal.c) * [Binary To Octal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/binary_to_octal.c) * [C Atoi Str To Integer](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/c_atoi_str_to_integer.c) + * [Celsius To Fahrenheit](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/celsius_to_fahrenheit.c) * [Decimal To Any Base](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/decimal_to_any_base.c) * [Decimal To Binary](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/decimal_to_binary.c) * [Decimal To Binary Recursion](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/decimal_to_binary_recursion.c) @@ -33,6 +34,7 @@ * [Octal To Binary](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/octal_to_binary.c) * [Octal To Decimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/octal_to_decimal.c) * [Octal To Hexadecimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/octal_to_hexadecimal.c) + * [Roman Numerals To Decimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/roman_numerals_to_decimal.c) * [To Decimal](https://github.com/TheAlgorithms/C/blob/HEAD/conversions/to_decimal.c) ## Data Structures @@ -190,15 +192,19 @@ * [1524](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1524.c) * [153](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/153.c) * [160](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/160.c) + * [1653](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1653.c) * [169](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/169.c) + * [1695](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1695.c) * [173](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/173.c) * [1752](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1752.c) + * [1769](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1769.c) * [189](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/189.c) * [190](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/190.c) * [191](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/191.c) * [2](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2.c) * [20](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/20.c) * [201](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/201.c) + * [2024](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2024.c) * [203](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/203.c) * [206](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/206.c) * [21](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/21.c) @@ -207,6 +213,7 @@ * [217](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/217.c) * [223](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/223.c) * [226](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/226.c) + * [2304](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2304.c) * [231](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/231.c) * [234](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/234.c) * [24](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/24.c) @@ -228,6 +235,7 @@ * [389](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/389.c) * [4](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/4.c) * [404](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/404.c) + * [42](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/42.c) * [442](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/442.c) * [461](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/461.c) * [476](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/476.c) @@ -242,6 +250,7 @@ * [63](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/63.c) * [647](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/647.c) * [66](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/66.c) + * [669](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/669.c) * [674](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/674.c) * [7](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/7.c) * [700](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/700.c) @@ -255,12 +264,15 @@ * [852](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/852.c) * [876](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/876.c) * [9](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/9.c) + * [901](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/901.c) * [905](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/905.c) * [917](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/917.c) * [938](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/938.c) * [94](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/94.c) * [965](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/965.c) * [977](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/977.c) + * [98](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/98.c) + * [985](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/985.c) ## Machine Learning * [Adaline Learning](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/adaline_learning.c) From b85a6220a90297b60196d1b934300e354d766c94 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 16 Dec 2022 14:40:29 -0600 Subject: [PATCH 056/156] chore: use `actions/checkout@v3` --- .github/workflows/gh-pages.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/workflows/gh-pages.yml b/.github/workflows/gh-pages.yml index 4d30ca99e7..134c04bb13 100644 --- a/.github/workflows/gh-pages.yml +++ b/.github/workflows/gh-pages.yml @@ -19,7 +19,7 @@ jobs: - name: build run: cmake --build build -t doc - name: gh-pages - uses: actions/checkout@master + uses: actions/checkout@v3 with: ref: "gh-pages" clean: false From c45b6faa24cb2a12d7037ebaa3adb1cb379e8181 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 16 Dec 2022 15:21:52 -0600 Subject: [PATCH 057/156] docs: remove unneeded Markdown header --- .github/ISSUE_TEMPLATE/other.yml | 9 +++------ 1 file changed, 3 insertions(+), 6 deletions(-) diff --git a/.github/ISSUE_TEMPLATE/other.yml b/.github/ISSUE_TEMPLATE/other.yml index 901d227ba9..d6dc0cfe9f 100644 --- a/.github/ISSUE_TEMPLATE/other.yml +++ b/.github/ISSUE_TEMPLATE/other.yml @@ -1,13 +1,10 @@ -name: Other +name: Other issue description: Use this for any other issues. Do NOT create blank issues title: "[OTHER]" -labels: [triage] +labels: ["awaiting triage"] body: - - type: markdown - attributes: - value: "# Other issue" - type: textarea - id: issuedescription + id: description attributes: label: What would you like to share? description: Provide a clear and concise explanation of your issue. From 1d4ccc39a9031c82a2c8a4758060a271ae95db65 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 16 Dec 2022 15:22:46 -0600 Subject: [PATCH 058/156] chore: remove LGTM and fix... ...CodeQL badge. --- README.md | 3 +-- 1 file changed, 1 insertion(+), 2 deletions(-) diff --git a/README.md b/README.md index bff102fe31..85768c923e 100644 --- a/README.md +++ b/README.md @@ -2,8 +2,7 @@ [![Gitpod Ready-to-Code](https://img.shields.io/badge/Gitpod-Ready--to--Code-blue?logo=gitpod)](https://gitpod.io/#https://github.com/TheAlgorithms/C) -[![Language grade: C/C++](https://img.shields.io/lgtm/grade/cpp/g/TheAlgorithms/C.svg?logo=lgtm&logoWidth=18)](https://lgtm.com/projects/g/TheAlgorithms/C/context:cpp) -[![CodeQL CI](https://github.com/TheAlgorithms/C/actions/workflows/codeql_analysis.yml/badge.svg)](https://github.com/TheAlgorithms/C/actions/workflows/codeql_analysis.yml) +[![CodeQL CI](https://github.com/TheAlgorithms/C/actions/workflows/codeql.yml/badge.svg)](https://github.com/TheAlgorithms/C/actions/workflows/codeql_analysis.yml) [![Gitter chat](https://img.shields.io/badge/Chat-Gitter-ff69b4.svg?label=Chat&logo=gitter&style=flat-square)](https://gitter.im/TheAlgorithms) [![contributions welcome](https://img.shields.io/static/v1.svg?label=Contributions&message=Welcome&color=0059b3&style=flat-square)](https://github.com/TheAlgorithms/C/blob/master/CONTRIBUTING.md) ![GitHub repo size](https://img.shields.io/github/repo-size/TheAlgorithms/C?color=red&style=flat-square) From 8992d267ac4f067da6b4ecfd17742b91efc0d35a Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 17 Dec 2022 01:37:54 +0400 Subject: [PATCH 059/156] feat: add Longest Valid Parentheses LeetCode problem (#1166) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/32.c | 60 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 61 insertions(+) create mode 100644 leetcode/src/32.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 3b7fd16b3e..78bddea319 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -24,6 +24,7 @@ | 27 | [Remove Element](https://leetcode.com/problems/remove-element/) | [C](./src/27.c) | Easy | | 28 | [Implement strStr()](https://leetcode.com/problems/implement-strstr/) | [C](./src/28.c) | Easy | | 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers/) | [C](./src/29.c) | Medium | +| 32 | [Longest Valid Parentheses](https://leetcode.com/problems/longest-valid-parentheses/) | [C](./src/32.c) | Hard | | 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position/) | [C](./src/35.c) | Easy | | 38 | [Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c) | Easy | | 42 | [Trapping Rain Water](https://leetcode.com/problems/trapping-rain-water/) | [C](./src/42.c) | Hard | diff --git a/leetcode/src/32.c b/leetcode/src/32.c new file mode 100644 index 0000000000..ce05249af9 --- /dev/null +++ b/leetcode/src/32.c @@ -0,0 +1,60 @@ +#define max(x,y)(((x)>(y))?(x):(y)) + +const int notCalculated = -2; +const int notValid = -1; + +int getEndValidIndexFromDp(int* dp, char* s, int index, int lenS){ + if (index >= lenS){ + return notValid; + } + + if (dp[index] == notCalculated){ + dp[index] = getEndValidIndex(dp, s, index, lenS); + } + + return dp[index]; +} + +int getEndValidIndex(int* dp, char* s, int index, int lenS){ + if (s[index] == '('){ + if (index + 1 >= lenS){ + return notValid; + } + + if (s[index + 1] == ')'){ + return max(index + 1, getEndValidIndexFromDp(dp, s, index + 2, lenS)); + } + + int nextEndValidIndex = getEndValidIndexFromDp(dp, s, index + 1, lenS); + if (nextEndValidIndex == notValid || nextEndValidIndex + 1 >= lenS || s[nextEndValidIndex + 1] != ')') { + return notValid; + } + + return max(nextEndValidIndex + 1, getEndValidIndexFromDp(dp, s, nextEndValidIndex + 2, lenS)); + } + + return notValid; +} + +// Dynamic Programming. UP -> down approach. +// Runtime: O(n) +// Space: O(n) +int longestValidParentheses(char * s){ + int lenS = strlen(s); + if (lenS == 0){ + return 0; + } + + int* dp = malloc(lenS * sizeof(int)); + for(int i = 0; i < lenS; i++){ + dp[i] = notCalculated; + } + + int result = 0; + for(int i = 0; i < lenS; i++){ + result = max(result, getEndValidIndexFromDp(dp, s, i, lenS) - i + 1); + } + + free(dp); + return result; +} From 1d07d142d07e8dca5fac0457059ca159dc9f295c Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 17 Dec 2022 01:42:57 +0400 Subject: [PATCH 060/156] feat: add Number of Ways to Split Array LeetCode (#1165) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/2270.c | 21 +++++++++++++++++++++ 2 files changed, 22 insertions(+) create mode 100644 leetcode/src/2270.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 78bddea319..c0cf88f912 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -109,4 +109,5 @@ | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | +| 2270 | [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array/) | [C](./src/2270.c) | Medium | | 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | diff --git a/leetcode/src/2270.c b/leetcode/src/2270.c new file mode 100644 index 0000000000..b797f56770 --- /dev/null +++ b/leetcode/src/2270.c @@ -0,0 +1,21 @@ +// Prefix sum. +// Collect sum fromleft part and compare it with left sum. +// Runtime: O(n) +// Space: O(1) +int waysToSplitArray(int* nums, int numsSize){ + long sumNums = 0; + for (int i = 0; i < numsSize; i++){ + sumNums += nums[i]; + } + + long prefixSum = 0; + int result = 0; + for (int i = 0; i < numsSize - 1; i++){ + prefixSum += nums[i]; + if (prefixSum >= sumNums - prefixSum){ + result += 1; + } + } + + return result; +} From bf94aff668c673c6982cd3de4df9d08eaf6c172f Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 17 Dec 2022 01:43:25 +0400 Subject: [PATCH 061/156] feat: add Determine if String Halves Are Alike LeetCode (#1168) * add leetcode Determine if String Halves Are Alike * fix variable name Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/1704.c | 38 ++++++++++++++++++++++++++++++++++++++ 2 files changed, 39 insertions(+) create mode 100644 leetcode/src/1704.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index c0cf88f912..f45ca7a6c3 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -106,6 +106,7 @@ | 1769 | [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box/) | [C](./src/1769.c) | Medium | | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | | 1653 | [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced/) | [C](./src/1653.c) | Medium | +| 1704 | [Determine if String Halves Are Alike](Determine if String Halves Are Alike) | [C](./src/1704.c) | Easy | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | diff --git a/leetcode/src/1704.c b/leetcode/src/1704.c new file mode 100644 index 0000000000..25251983bc --- /dev/null +++ b/leetcode/src/1704.c @@ -0,0 +1,38 @@ +bool isVowel(char chr){ + switch(chr){ + case 'a': + case 'e': + case 'i': + case 'o': + case 'u': + case 'A': + case 'E': + case 'I': + case 'O': + case 'U': + return true; + } + + return false; +} + +// Counting +// Runtime: O(n) +// Space: O(1) +bool halvesAreAlike(char * s){ + int lenS = strlen(s); + int halfVowels = 0; + int currVowels = 0; + + for (int i = 0; i < lenS; i++){ + if (isVowel(s[i])){ + currVowels++; + } + + if (2 * (i + 1) == lenS){ + halfVowels = currVowels; + } + } + + return 2 * halfVowels == currVowels; +} From 496e012c7010708a3fb98a278413191f5e940d67 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 17 Dec 2022 06:24:33 +0400 Subject: [PATCH 062/156] feat: add Kth Smallest Element in a BST (#1157) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/230.c | 35 +++++++++++++++++++++++++++++++++++ 2 files changed, 36 insertions(+) create mode 100644 leetcode/src/230.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index f45ca7a6c3..f14cb5c2c9 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -61,6 +61,7 @@ | 217 | [Contains Duplicate](https://leetcode.com/problems/contains-duplicate/) | [C](./src/217.c) | Easy | | 223 | [Rectangle Area](https://leetcode.com/problems/rectangle-area/) | [C](./src/223.c) | Medium | | 226 | [Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree/) | [C](./src/226.c) | Easy | +| 230 | [Kth Smallest Element in a BST](https://leetcode.com/problems/kth-smallest-element-in-a-bst/) | [C](./src/230.c) | Medium | | 231 | [Power of Two](https://leetcode.com/problems/power-of-two/) | [C](./src/231.c) | Easy | | 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list/) | [C](./src/234.c) | Easy | | 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram/) | [C](./src/242.c) | Easy | diff --git a/leetcode/src/230.c b/leetcode/src/230.c new file mode 100644 index 0000000000..61fa0e77f8 --- /dev/null +++ b/leetcode/src/230.c @@ -0,0 +1,35 @@ +/** + * Definition for a binary tree node. + * struct TreeNode { + * int val; + * struct TreeNode *left; + * struct TreeNode *right; + * }; + */ + +struct TreeNode* findKthSmallest(struct TreeNode* node, int* k){ + if (node == NULL){ + return NULL; + } + + struct TreeNode* resultNode = findKthSmallest(node->left, k); + + if (resultNode != NULL){ + return resultNode; + } + + *k -= 1; + + if (*k == 0){ + return node; + } + + return findKthSmallest(node->right, k); +} + +// Depth-First Search +// Runtime: O(n) +// Space: O(1) +int kthSmallest(struct TreeNode* root, int k){ + return findKthSmallest(root, &k)->val; +} From 50349e065ebaf7bd7c30b3a01d65e984a1dbdefd Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 17 Dec 2022 06:28:51 +0400 Subject: [PATCH 063/156] feat: add Word Search LeetCode problem (#1160) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/79.c | 60 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 61 insertions(+) create mode 100644 leetcode/src/79.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index f14cb5c2c9..872609c0a9 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -31,6 +31,7 @@ | 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | | 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | [C](./src/62.c) | Medium | | 66 | [Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c) | Easy | +| 79 | [Word Search](https://leetcode.com/problems/word-search/) | [C](./src/79.c) | Medium | | 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c) | Medium | | 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list/) | [C](./src/83.c) | Easy | | 94 | [Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal/) | [C](./src/94.c) | Medium | diff --git a/leetcode/src/79.c b/leetcode/src/79.c new file mode 100644 index 0000000000..3ac9d11fbc --- /dev/null +++ b/leetcode/src/79.c @@ -0,0 +1,60 @@ +int getPointKey(int i, int j, int boardSize, int boardColSize){ + return boardSize * boardColSize * i + j; +} + +const int directionsSize = 4; +const int directions[4][2] = {{-1, 0}, {1, 0}, {0, -1}, {0, 1}}; + +bool exitsWord(int i, int j, char** board, int boardSize, int* boardColSize, int wordIndex, char* word, int* vistedPointSet){ + if (board[i][j] != word[wordIndex]){ + return false; + } + + if (wordIndex == strlen(word) - 1){ + return true; + } + + for (int k = 0; k < directionsSize; k++){ + int nextI = i + directions[k][0]; + int nextJ = j + directions[k][1]; + + if (nextI < 0 || nextI >= boardSize || nextJ < 0 || nextJ >= boardColSize[i]){ + continue; + } + + int key = getPointKey(nextI, nextJ, boardSize, boardColSize[i]); + if (vistedPointSet[key] == 1){ + continue; + } + + vistedPointSet[key] = 1; + if (exitsWord(nextI, nextJ, board, boardSize, boardColSize, wordIndex + 1, word, vistedPointSet)){ + return true; + } + + vistedPointSet[key] = 0; + } + + return false; +} + + +// Use backtracking. +// Runtime: Runtime: O(n*m*4^len(word)) +bool exist(char** board, int boardSize, int* boardColSize, char* word){ + int* vistedPointSet = (int*) calloc(getPointKey(boardSize, boardColSize[0], boardSize, boardColSize[0]), sizeof(int)); + + for (int i = 0; i < boardSize; i++){ + for (int j = 0; j < boardColSize[i]; j++){ + int key = getPointKey(i, j, boardSize, boardColSize[i]); + vistedPointSet[key] = 1; + if (exitsWord(i, j, board, boardSize, boardColSize, 0, word, vistedPointSet)){ + return true; + }; + + vistedPointSet[key] = 0; + } + } + + return false; +} From af0ffcbd42d8b58c8269efdd0e1b298b30effbb7 Mon Sep 17 00:00:00 2001 From: David Leal Date: Sat, 17 Dec 2022 19:27:04 -0600 Subject: [PATCH 064/156] feat: improve the Awesome Workflow (#1186) * feat: improve the Awesome Workflow Co-authored-by: Taj * updating DIRECTORY.md * chore: remove/add a few spaces Co-authored-by: Taj Co-authored-by: github-actions[bot] --- .github/workflows/awesome_workflow.yml | 57 +++++++++----------------- DIRECTORY.md | 5 +++ 2 files changed, 24 insertions(+), 38 deletions(-) diff --git a/.github/workflows/awesome_workflow.yml b/.github/workflows/awesome_workflow.yml index a32b532d80..676a0b6dbe 100644 --- a/.github/workflows/awesome_workflow.yml +++ b/.github/workflows/awesome_workflow.yml @@ -1,46 +1,32 @@ name: Awesome CI Workflow - on: [push, pull_request] -# push: -# branches: [ master ] -# pull_request: -# branches: [ master ] +permissions: + contents: write jobs: MainSequence: name: Code Formatter runs-on: ubuntu-latest steps: - - uses: actions/checkout@v1 # v2 is broken for git diff - - uses: actions/setup-python@v2 + - uses: actions/checkout@v3 + with: + fetch-depth: 0 + - uses: actions/setup-python@v4 - name: requirements run: | sudo apt-get -qq update sudo apt-get -qq install clang-tidy clang-format + # checks are passing with less errors when used with this version. + # The default installs v6.0 which did not work out well in my tests - name: Setup Git Specs run: | - git config --global user.name github-actions - git config --global user.email '${GITHUB_ACTOR}@users.noreply.github.com' - git remote set-url origin https://x-access-token:${{ secrets.GITHUB_TOKEN }}@github.com/$GITHUB_REPOSITORY + git config --global user.name github-actions[bot] + git config --global user.email 'github-actions@users.noreply.github.com' - name: Filename Formatter run: | - IFS=$'\n' - for fname in `find . -type f -name '*.c' -o -name '*.h'` - do - echo "${fname}" - new_fname=`echo ${fname} | tr ' ' '_'` - echo " ${new_fname}" - new_fname=`echo ${new_fname} | tr 'A-Z' 'a-z'` - echo " ${new_fname}" - new_fname=`echo ${new_fname} | tr '-' '_'` - echo " ${new_fname}" - if [ ${fname} != ${new_fname} ] - then - echo " ${fname} --> ${new_fname}" - git "mv" "${fname}" ${new_fname} - fi - done - git commit -am "formatting filenames ${GITHUB_SHA::8}" || true + wget https://raw.githubusercontent.com/TheAlgorithms/scripts/main/filename_formatter.sh + chmod +x filename_formatter.sh + ./filename_formatter.sh . .c,.h - name: Update DIRECTORY.md run: | wget https://raw.githubusercontent.com/TheAlgorithms/scripts/main/build_directory_md.py @@ -48,9 +34,7 @@ jobs: git commit -m "updating DIRECTORY.md" DIRECTORY.md || true - name: Get file changes run: | - git remote -v git branch - git remote set-url origin https://x-access-token:${{ secrets.GITHUB_TOKEN }}@github.com/$GITHUB_REPOSITORY git diff --diff-filter=dr --name-only origin/master > git_diff.txt echo "Files changed-- `cat git_diff.txt`" - name: Configure for static lint checks @@ -75,11 +59,9 @@ jobs: print(f"{len(cpp_files)} C++ files were modified.") if not cpp_files: sys.exit(0) - - subprocess.run(["clang-tidy-10", "-p=build", "--fix", *cpp_files, "--"], + subprocess.run(["clang-tidy", "-p=build", "--fix", *cpp_files, "--"], check=True, text=True, stderr=subprocess.STDOUT) - - subprocess.run(["clang-format-10", "-i", *cpp_files], + subprocess.run(["clang-format", "-i", *cpp_files], check=True, text=True, stderr=subprocess.STDOUT) upper_files = [file for file in cpp_files if file != file.lower()] @@ -103,12 +85,11 @@ jobs: bad_files = nodir_file_bad_files + len(upper_files + space_files) if bad_files: sys.exit(bad_files) - - name: Commit and push changes run: | - git commit -am "clang-format and clang-tidy fixes for ${GITHUB_SHA::8}" || true - git push --force origin HEAD:$GITHUB_REF || true - + git diff DIRECTORY.md + git commit -am "clang-format and clang-tidy fixes for ${GITHUB_SHA::8}" || true + git push origin HEAD:$GITHUB_REF || true build: name: Compile checks runs-on: ${{ matrix.os }} @@ -117,7 +98,7 @@ jobs: matrix: os: [ubuntu-latest, macOS-latest] steps: - - uses: actions/checkout@master + - uses: actions/checkout@v3 with: submodules: true - run: cmake -B ./build -S . diff --git a/DIRECTORY.md b/DIRECTORY.md index 8dbb7a0640..a32a7e611e 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -195,6 +195,7 @@ * [1653](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1653.c) * [169](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/169.c) * [1695](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1695.c) + * [1704](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1704.c) * [173](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/173.c) * [1752](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1752.c) * [1769](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1769.c) @@ -213,6 +214,8 @@ * [217](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/217.c) * [223](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/223.c) * [226](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/226.c) + * [2270](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2270.c) + * [230](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/230.c) * [2304](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2304.c) * [231](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/231.c) * [234](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/234.c) @@ -227,6 +230,7 @@ * [287](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/287.c) * [29](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/29.c) * [3](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/3.c) + * [32](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/32.c) * [344](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/344.c) * [35](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/35.c) * [367](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/367.c) @@ -258,6 +262,7 @@ * [704](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/704.c) * [709](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/709.c) * [771](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/771.c) + * [79](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/79.c) * [8](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/8.c) * [82](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/82.c) * [83](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/83.c) From 0169283f553c1342e4646ed0c9d2a1d1871af1df Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Mon, 19 Dec 2022 07:34:24 +0400 Subject: [PATCH 065/156] feat: add Number of Ways to Select Buildings (#1140) * add Number of Ways to Select Buildings * Update 2222.c add new line at the end * Rename README.md to DIRECTORY.md * Update leetcode/src/2222.c Co-authored-by: Taj * fix review notes Co-authored-by: David Leal Co-authored-by: Taj --- leetcode/DIRECTORY.md | 1 + leetcode/src/2222.c | 30 ++++++++++++++++++++++++++++++ 2 files changed, 31 insertions(+) create mode 100644 leetcode/src/2222.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 872609c0a9..05c7c1e8c1 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -112,5 +112,6 @@ | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | +| 2222 | [Number of Ways to Select Buildings](https://leetcode.com/problems/number-of-ways-to-select-buildings/) | [C](./src/2222.c) | Medium | | 2270 | [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array/) | [C](./src/2270.c) | Medium | | 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | diff --git a/leetcode/src/2222.c b/leetcode/src/2222.c new file mode 100644 index 0000000000..795ff077d3 --- /dev/null +++ b/leetcode/src/2222.c @@ -0,0 +1,30 @@ +long numberOfWaysForChar(char * s, char c){ + long firstBuildingAppearNumber = 0; + long secondBuildingAppearNumber = 0; + long result = 0; + + int sLength = strlen(s); + for (int i = 0; i < sLength; i++){ + if (s[i] == c){ + result += secondBuildingAppearNumber; + + firstBuildingAppearNumber += 1; + continue; + } + + secondBuildingAppearNumber += firstBuildingAppearNumber; + } + + return result; + +} + +// numberOfWays returns the sum of number ways of selecting first building +// and the number of ways of selecting second building which gives us the +// number of ways of selecting three building such that no +// consecutive buildings are in the same category. +// Runtime: O(n) +// Space: O(n) +long long numberOfWays(char * s){ + return numberOfWaysForChar(s, '0') + numberOfWaysForChar(s, '1'); +} From 9f1591fbd234e52e6f7a7c443d2dc9b3959c9ef5 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Wed, 21 Dec 2022 18:44:43 +0400 Subject: [PATCH 066/156] feat: add Sudoku Solver LeetCode (#1162) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/37.c | 88 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 89 insertions(+) create mode 100644 leetcode/src/37.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 05c7c1e8c1..06e426fe51 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -26,6 +26,7 @@ | 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers/) | [C](./src/29.c) | Medium | | 32 | [Longest Valid Parentheses](https://leetcode.com/problems/longest-valid-parentheses/) | [C](./src/32.c) | Hard | | 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position/) | [C](./src/35.c) | Easy | +| 37 | [Sudoku Solver](https://leetcode.com/problems/sudoku-solver/) | [C](./src/37.c) | Hard | | 38 | [Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c) | Easy | | 42 | [Trapping Rain Water](https://leetcode.com/problems/trapping-rain-water/) | [C](./src/42.c) | Hard | | 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | diff --git a/leetcode/src/37.c b/leetcode/src/37.c new file mode 100644 index 0000000000..7d8cae115e --- /dev/null +++ b/leetcode/src/37.c @@ -0,0 +1,88 @@ +int** initSet(int size){ + int** result = (int**) malloc(size * sizeof(int*)); + for (int i = 0; i < size; i++) { + result[i] = (int*)calloc(size, sizeof(int)); + } + + return result; +} + +// Returns the id of triplet which the point (i, j) belongs to +int getTripletId(int i, int j){ + return (i / 3) * 3 + (j / 3); +} + +// Recursive function which populates sudoku board. +bool sudokuSolver(int startI, int startJ, char** board, int boardSize, int* boardColSize, int** horizontalsSets, int** verticalsSets, int** tripletsSets){ + for (int i = startI; i < boardSize; i++) { + for (int j = startJ; j < boardColSize[i]; j++) { + if (board[i][j] != '.'){ + continue; + } + + // Find the sets of the current point (i, j) + int* horizontalSet = horizontalsSets[i]; + int* verticalSet = verticalsSets[j]; + int* tripletsSet = tripletsSets[getTripletId(i, j)]; + + for (int z = 1; z < 10; z++) { + if (horizontalSet[z] || verticalSet[z] || tripletsSet[z]){ + continue; + } + + // If the z doesn't belong to occupations sets, we check this value to be in place + horizontalSet[z] = 1; + verticalSet[z] = 1; + tripletsSet[z] = 1; + + if (sudokuSolver(i, j + 1, board, boardSize, boardColSize, horizontalsSets, verticalsSets, tripletsSets)){ + board[i][j] = z + '0'; + return true; + } + + horizontalSet[z] = 0; + verticalSet[z] = 0; + tripletsSet[z] = 0; + } + + // We tried all possible values in range 1-10. No variants - returns false; + return false; + } + + // startJ to begin of the row. + startJ = 0; + } + + // Reach it when the end of the board - then all previous values are setup correctly. + return true; +} + +// Use backtracking +void solveSudoku(char** board, int boardSize, int* boardColSize){ + // Declare sets for cheking occupation of numbers by horizontals, verticals lines and triplets. + int** horizontalsSets = initSet(boardSize + 1); + int** verticalsSets = initSet(boardSize + 1); + int** tripletsSets = initSet(getTripletId(boardSize + 1, boardSize + 1)); + + // Populate sets with values from the board. + for (int i = 0; i < boardSize; i++) { + for (int j = 0; j < boardColSize[i]; j++) { + if (board[i][j] == '.'){ + continue; + } + + int value = board[i][j] - '0'; + horizontalsSets[i][value] = 1; + verticalsSets[j][value] = 1; + tripletsSets[getTripletId(i, j)][value] = 1; + } + } + + // Solving + sudokuSolver(0, 0, board, boardSize, boardColSize, horizontalsSets, verticalsSets, tripletsSets); + + // Free resources + free(horizontalsSets); + free(verticalsSets); + free(tripletsSets); +} From 7aae73495fe27adf9b5c261574978c197c0751a0 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Wed, 21 Dec 2022 18:46:34 +0400 Subject: [PATCH 067/156] feat: add Lowest Common Ancestor of a Binary Tree (#1155) * add leetcode Lowest Common Ancestor of a Binary Tree * Update leetcode/src/236.c Co-authored-by: Taj * fix function nam * update struct name. * add comments * Update leetcode/src/236.c Co-authored-by: Taj Co-authored-by: Taj Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/236.c | 82 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 83 insertions(+) create mode 100644 leetcode/src/236.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 06e426fe51..a2914f1ebe 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -66,6 +66,7 @@ | 230 | [Kth Smallest Element in a BST](https://leetcode.com/problems/kth-smallest-element-in-a-bst/) | [C](./src/230.c) | Medium | | 231 | [Power of Two](https://leetcode.com/problems/power-of-two/) | [C](./src/231.c) | Easy | | 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list/) | [C](./src/234.c) | Easy | +| 236 | [Lowest Common Ancestor of a Binary Tree](https://leetcode.com/problems/lowest-common-ancestor-of-a-binary-tree/) | [C](./src/236.c) | Medium | | 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram/) | [C](./src/242.c) | Easy | | 268 | [Missing Number](https://leetcode.com/problems/missing-number/) | [C](./src/268.c) | Easy | | 278 | [First Bad Version](https://leetcode.com/problems/first-bad-version/) | [C](./src/278.c) | Easy | diff --git a/leetcode/src/236.c b/leetcode/src/236.c new file mode 100644 index 0000000000..71235c4e64 --- /dev/null +++ b/leetcode/src/236.c @@ -0,0 +1,82 @@ +/** + * Definition for a binary tree node. + * struct TreeNode { + * int val; + * struct TreeNode *left; + * struct TreeNode *right; + * }; + */ + +// The list for TreeNodes. +struct ListItem { + struct TreeNode* node; // TreeNode pointer + struct ListItem* next; // Pointer to the next ListItem +}; + +bool findTargetPath(struct TreeNode* node, struct TreeNode* target, struct ListItem* path){ + if (node == NULL){ + return false; + } + + struct ListItem* pathItem = malloc(sizeof(struct ListItem)); + pathItem->node = node; + pathItem->next = NULL; + path->next = pathItem; + + if (node->val == target->val){ + return true; + } + + if (findTargetPath(node->left, target, pathItem)){ + return true; + } + + if (findTargetPath(node->right, target, pathItem)){ + return true; + } + + path->next = NULL; + free(pathItem); + return false; +} + +void freeList(struct ListItem* target){ + if (target->next != NULL){ + freeList(target->next); + } + + free(target); +} + + +// Find full path for p and q. +// Find the longest common path in paths. + +// Runtime: O(n) +// Space: O(n) +struct TreeNode* lowestCommonAncestor(struct TreeNode* root, struct TreeNode* p, struct TreeNode* q) { + struct ListItem* pPath = malloc(sizeof(struct ListItem)); + struct ListItem* qPath = malloc(sizeof(struct ListItem)); + + findTargetPath(root, p, pPath); + findTargetPath(root, q, qPath); + + struct TreeNode* lowestTreeNode = NULL; + struct ListItem* pPathCursor = pPath->next; + struct ListItem* qPathCursor = qPath->next; + while(pPathCursor != NULL && qPathCursor != NULL) { + if (pPathCursor->node->val == qPathCursor->node->val){ + lowestTreeNode = pPathCursor->node; + pPathCursor = pPathCursor->next; + qPathCursor = qPathCursor->next; + continue; + } + + break; + } + + freeList(pPath); + freeList(qPath); + + return lowestTreeNode; +} From 3be7198f03398edc3b7fdeb0081c8ab18a2a0f75 Mon Sep 17 00:00:00 2001 From: David Leal Date: Wed, 21 Dec 2022 08:54:33 -0600 Subject: [PATCH 068/156] docs: add guide on integrating CMake (#1163) * updating DIRECTORY.md * docs: add guide on integrating CMake * chore: apply suggestions from code review Co-authored-by: Taj Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> Co-authored-by: Taj --- CONTRIBUTING.md | 40 ++++++++++++++++++++++++++++++++++++++-- 1 file changed, 38 insertions(+), 2 deletions(-) diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index 1651d1380e..a7b81ace27 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -139,7 +139,7 @@ my_new_c_struct.c is correct format #### Directory guidelines - We recommend adding files to existing directories as much as possible. -- Use lowercase words with ``"_"`` as separator ( no spaces or ```"-"``` allowed ) +- Use lowercase words with ``"_"`` as a separator ( no spaces or ```"-"``` allowed ) - For instance ```markdown @@ -150,9 +150,45 @@ some_new_fancy_category is correct - Filepaths will be used to dynamically create a directory of our algorithms. - Filepath validation will run on GitHub Actions to ensure compliance. +##### Integrating CMake in a new directory + +In case a new directory is 100% required, `CMakeLists.txt` file in the root directory needs to be updated, and a new `CMakeLists.txt` file needs to be created within the new directory. + +An example of how your new `CMakeLists.txt` file should look like. Note that if there are any extra libraries/setup required, you must include that in this file as well. + +```cmake +# If necessary, use the RELATIVE flag, otherwise each source file may be listed +# with full pathname. The RELATIVE flag makes it easier to extract an executable's name +# automatically. + +file( GLOB APP_SOURCES RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} *.c ) +foreach( testsourcefile ${APP_SOURCES} ) + string( REPLACE ".c" "" testname ${testsourcefile} ) # File type. Example: `.c`, `.h` + add_executable( ${testname} ${testsourcefile} ) + + if(OpenMP_C_FOUND) + target_link_libraries(${testname} OpenMP::OpenMP_C) + endif() + if(MATH_LIBRARY) + target_link_libraries(${testname} ${MATH_LIBRARY}) + endif() + install(TARGETS ${testname} DESTINATION "bin/") # Folder name + +endforeach( testsourcefile ${APP_SOURCES} ) +``` + +The `CMakeLists.txt` file in the root directory should be updated to include the new directory.\ +Include your new directory after the last subdirectory. Example: + +```cmake +... +add_subdirectory(divide_and_conquer) +add_subdirectory() +``` + #### Commit Guidelines -- It is recommended to keep your changes grouped logically within individual commits. Maintainers find it easier to understand changes that are logically spilt across multiple commits. Try to modify just one or two files in the same directory. Pull requests that span multiple directories are often rejected. +- It is recommended to keep your changes grouped logically within individual commits. Maintainers find it easier to understand changes that are logically spilled across multiple commits. Try to modify just one or two files in the same directory. Pull requests that span multiple directories are often rejected. ```bash git add file_xyz.c From ad24ee1273fff16dcbb2854a8b060a7c1769755d Mon Sep 17 00:00:00 2001 From: David Leal Date: Wed, 21 Dec 2022 09:04:33 -0600 Subject: [PATCH 069/156] chore: use latest CMake subfolder name --- CONTRIBUTING.md | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index a7b81ace27..d6064dbea1 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -163,7 +163,7 @@ An example of how your new `CMakeLists.txt` file should look like. Note that if file( GLOB APP_SOURCES RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} *.c ) foreach( testsourcefile ${APP_SOURCES} ) - string( REPLACE ".c" "" testname ${testsourcefile} ) # File type. Example: `.c`, `.h` + string( REPLACE ".c" "" testname ${testsourcefile} ) # File type. Example: `.c` add_executable( ${testname} ${testsourcefile} ) if(OpenMP_C_FOUND) @@ -172,7 +172,7 @@ foreach( testsourcefile ${APP_SOURCES} ) if(MATH_LIBRARY) target_link_libraries(${testname} ${MATH_LIBRARY}) endif() - install(TARGETS ${testname} DESTINATION "bin/") # Folder name + install(TARGETS ${testname} DESTINATION "bin/") # Folder name. Do NOT include `<>` endforeach( testsourcefile ${APP_SOURCES} ) ``` @@ -182,7 +182,7 @@ Include your new directory after the last subdirectory. Example: ```cmake ... -add_subdirectory(divide_and_conquer) +add_subdirectory(numerical_methods) add_subdirectory() ``` From cafd06725cd9b4c79ff35e3130605dd7f06566e1 Mon Sep 17 00:00:00 2001 From: Taj Date: Thu, 22 Dec 2022 04:39:23 +0000 Subject: [PATCH 070/156] feat: Use the new `filename_formatter` workflow (#1190) * updating DIRECTORY.md * using script action for filename formatting Co-authored-by: github-actions[bot] --- .github/workflows/awesome_workflow.yml | 7 +++---- DIRECTORY.md | 3 +++ 2 files changed, 6 insertions(+), 4 deletions(-) diff --git a/.github/workflows/awesome_workflow.yml b/.github/workflows/awesome_workflow.yml index 676a0b6dbe..cf6212b30c 100644 --- a/.github/workflows/awesome_workflow.yml +++ b/.github/workflows/awesome_workflow.yml @@ -23,10 +23,9 @@ jobs: git config --global user.name github-actions[bot] git config --global user.email 'github-actions@users.noreply.github.com' - name: Filename Formatter - run: | - wget https://raw.githubusercontent.com/TheAlgorithms/scripts/main/filename_formatter.sh - chmod +x filename_formatter.sh - ./filename_formatter.sh . .c,.h + uses: TheAlgorithms/scripts/formatter@main + with: + filetypes: .c,.h - name: Update DIRECTORY.md run: | wget https://raw.githubusercontent.com/TheAlgorithms/scripts/main/build_directory_md.py diff --git a/DIRECTORY.md b/DIRECTORY.md index a32a7e611e..c58820dfb7 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -212,6 +212,7 @@ * [2130](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2130.c) * [215](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/215.c) * [217](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/217.c) + * [2222](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2222.c) * [223](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/223.c) * [226](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/226.c) * [2270](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2270.c) @@ -219,6 +220,7 @@ * [2304](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2304.c) * [231](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/231.c) * [234](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/234.c) + * [236](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/236.c) * [24](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/24.c) * [242](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/242.c) * [26](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/26.c) @@ -234,6 +236,7 @@ * [344](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/344.c) * [35](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/35.c) * [367](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/367.c) + * [37](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/37.c) * [38](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/38.c) * [387](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/387.c) * [389](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/389.c) From 0618d4d0073a1f265d4643c4fbccc781ad57c055 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Thu, 22 Dec 2022 08:42:07 +0400 Subject: [PATCH 071/156] feat: add H-Index LeetCode problem (#1188) * add leetcode H-Index * Update leetcode/src/274.c Co-authored-by: Taj * Update 274.c fix review notes. Co-authored-by: David Leal Co-authored-by: Taj --- leetcode/DIRECTORY.md | 1 + leetcode/src/274.c | 21 +++++++++++++++++++++ 2 files changed, 22 insertions(+) create mode 100644 leetcode/src/274.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index a2914f1ebe..6de869fa5d 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -69,6 +69,7 @@ | 236 | [Lowest Common Ancestor of a Binary Tree](https://leetcode.com/problems/lowest-common-ancestor-of-a-binary-tree/) | [C](./src/236.c) | Medium | | 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram/) | [C](./src/242.c) | Easy | | 268 | [Missing Number](https://leetcode.com/problems/missing-number/) | [C](./src/268.c) | Easy | +| 274 | [H-Index](https://leetcode.com/problems/h-index/description/) | [C](./src/274.c) | Medium | | 278 | [First Bad Version](https://leetcode.com/problems/first-bad-version/) | [C](./src/278.c) | Easy | | 283 | [Move Zeroes](https://leetcode.com/problems/move-zeroes/) | [C](./src/283.c) | Easy | | 287 | [Find the Duplicate Number](https://leetcode.com/problems/find-the-duplicate-number/) | [C](./src/287.c) | Medium | diff --git a/leetcode/src/274.c b/leetcode/src/274.c new file mode 100644 index 0000000000..e233fd04f0 --- /dev/null +++ b/leetcode/src/274.c @@ -0,0 +1,21 @@ +int diff(const int* i, const int* j) + +{ + return *i - *j; +} + + +// Sorting. +// Runtime: O(n*log(n)) +// Space: O(1) +int hIndex(int* citations, int citationsSize){ + qsort(citations, citationsSize, sizeof(int), (int(*) (const void*, const void*)) diff); + + for(int i = 0; i < citationsSize; i++){ + if (citations[citationsSize - 1 - i] <= i){ + return i; + } + } + + return citationsSize; +} From 56b72da9fb234213ce7cf32b789de2916006939f Mon Sep 17 00:00:00 2001 From: Defective Detective <71999854+SpiderMath@users.noreply.github.com> Date: Thu, 22 Dec 2022 22:56:50 +0530 Subject: [PATCH 072/156] chore: move various `misc` folder... (#1177) ...algorithms to the `math` folder. Co-authored-by: David Leal --- {misc => math}/armstrong_number.c | 0 {misc => math}/cantor_set.c | 0 {misc => math}/cartesian_to_polar.c | 0 {misc => math}/catalan.c | 0 {misc => math}/collatz.c | 0 {misc => math}/factorial.c | 0 {misc => math}/factorial_large_number.c | 0 {misc => math}/factorial_trailing_zeroes.c | 0 {misc => math}/fibonacci.c | 0 {misc => math}/fibonacci_dp.c | 0 {misc => math}/fibonacci_fast.c | 0 {misc => math}/fibonacci_formula.c | 0 {misc => math}/gcd.c | 0 {misc => math}/is_armstrong.c | 0 {misc => math}/large_factorials.c | 0 {misc => math}/lcm.c | 0 {misc => math}/lerp.c | 0 {misc => math}/palindrome.c | 0 {misc => math}/prime.c | 0 {misc => math}/prime_factoriziation.c | 0 misc/prime_seive.c => math/prime_sieve.c | 2 +- {misc => math}/strong_number.c | 0 22 files changed, 1 insertion(+), 1 deletion(-) rename {misc => math}/armstrong_number.c (100%) rename {misc => math}/cantor_set.c (100%) rename {misc => math}/cartesian_to_polar.c (100%) rename {misc => math}/catalan.c (100%) rename {misc => math}/collatz.c (100%) rename {misc => math}/factorial.c (100%) rename {misc => math}/factorial_large_number.c (100%) rename {misc => math}/factorial_trailing_zeroes.c (100%) rename {misc => math}/fibonacci.c (100%) rename {misc => math}/fibonacci_dp.c (100%) rename {misc => math}/fibonacci_fast.c (100%) rename {misc => math}/fibonacci_formula.c (100%) rename {misc => math}/gcd.c (100%) rename {misc => math}/is_armstrong.c (100%) rename {misc => math}/large_factorials.c (100%) rename {misc => math}/lcm.c (100%) rename {misc => math}/lerp.c (100%) rename {misc => math}/palindrome.c (100%) rename {misc => math}/prime.c (100%) rename {misc => math}/prime_factoriziation.c (100%) rename misc/prime_seive.c => math/prime_sieve.c (96%) rename {misc => math}/strong_number.c (100%) diff --git a/misc/armstrong_number.c b/math/armstrong_number.c similarity index 100% rename from misc/armstrong_number.c rename to math/armstrong_number.c diff --git a/misc/cantor_set.c b/math/cantor_set.c similarity index 100% rename from misc/cantor_set.c rename to math/cantor_set.c diff --git a/misc/cartesian_to_polar.c b/math/cartesian_to_polar.c similarity index 100% rename from misc/cartesian_to_polar.c rename to math/cartesian_to_polar.c diff --git a/misc/catalan.c b/math/catalan.c similarity index 100% rename from misc/catalan.c rename to math/catalan.c diff --git a/misc/collatz.c b/math/collatz.c similarity index 100% rename from misc/collatz.c rename to math/collatz.c diff --git a/misc/factorial.c b/math/factorial.c similarity index 100% rename from misc/factorial.c rename to math/factorial.c diff --git a/misc/factorial_large_number.c b/math/factorial_large_number.c similarity index 100% rename from misc/factorial_large_number.c rename to math/factorial_large_number.c diff --git a/misc/factorial_trailing_zeroes.c b/math/factorial_trailing_zeroes.c similarity index 100% rename from misc/factorial_trailing_zeroes.c rename to math/factorial_trailing_zeroes.c diff --git a/misc/fibonacci.c b/math/fibonacci.c similarity index 100% rename from misc/fibonacci.c rename to math/fibonacci.c diff --git a/misc/fibonacci_dp.c b/math/fibonacci_dp.c similarity index 100% rename from misc/fibonacci_dp.c rename to math/fibonacci_dp.c diff --git a/misc/fibonacci_fast.c b/math/fibonacci_fast.c similarity index 100% rename from misc/fibonacci_fast.c rename to math/fibonacci_fast.c diff --git a/misc/fibonacci_formula.c b/math/fibonacci_formula.c similarity index 100% rename from misc/fibonacci_formula.c rename to math/fibonacci_formula.c diff --git a/misc/gcd.c b/math/gcd.c similarity index 100% rename from misc/gcd.c rename to math/gcd.c diff --git a/misc/is_armstrong.c b/math/is_armstrong.c similarity index 100% rename from misc/is_armstrong.c rename to math/is_armstrong.c diff --git a/misc/large_factorials.c b/math/large_factorials.c similarity index 100% rename from misc/large_factorials.c rename to math/large_factorials.c diff --git a/misc/lcm.c b/math/lcm.c similarity index 100% rename from misc/lcm.c rename to math/lcm.c diff --git a/misc/lerp.c b/math/lerp.c similarity index 100% rename from misc/lerp.c rename to math/lerp.c diff --git a/misc/palindrome.c b/math/palindrome.c similarity index 100% rename from misc/palindrome.c rename to math/palindrome.c diff --git a/misc/prime.c b/math/prime.c similarity index 100% rename from misc/prime.c rename to math/prime.c diff --git a/misc/prime_factoriziation.c b/math/prime_factoriziation.c similarity index 100% rename from misc/prime_factoriziation.c rename to math/prime_factoriziation.c diff --git a/misc/prime_seive.c b/math/prime_sieve.c similarity index 96% rename from misc/prime_seive.c rename to math/prime_sieve.c index 6287bfff3c..c7a32c6502 100644 --- a/misc/prime_seive.c +++ b/math/prime_sieve.c @@ -1,6 +1,6 @@ /** * @file - * @brief [Prime Seive](https://leetcode.com/problems/count-primes/) + * @brief [Prime Sieve](https://leetcode.com/problems/count-primes/) * algorithm implementation. * @author [Divyansh Kushwaha](https://github.com/webdesignbydivyansh) */ diff --git a/misc/strong_number.c b/math/strong_number.c similarity index 100% rename from misc/strong_number.c rename to math/strong_number.c From a4e7b7bc4ba53f823693beeff61f278ceb6587cc Mon Sep 17 00:00:00 2001 From: itskurtz <7444339+itskurtz@users.noreply.github.com> Date: Sat, 24 Dec 2022 02:46:51 +0100 Subject: [PATCH 073/156] feat: add LCS algorithm (#1164) * feat: add lcs dynamic programming algorithm * updating DIRECTORY.md * updating DIRECTORY.md * fix: fix unused parameters in lcs algorithm * fix: lcs algorithm typo removed unused parameter in test * Update dynamic_programming/lcs.c Co-authored-by: David Leal * Update dynamic_programming/lcs.c Co-authored-by: David Leal * Update dynamic_programming/lcs.c Co-authored-by: David Leal * fix: comments accoring to guidelines in lcs algorithm * fix: doxygen standards * chore: apply suggestions from code review * updating DIRECTORY.md Co-authored-by: Scott Evans Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> Co-authored-by: David Leal Co-authored-by: github-actions[bot] --- DIRECTORY.md | 50 +++++++------ dynamic_programming/lcs.c | 153 ++++++++++++++++++++++++++++++++++++++ 2 files changed, 181 insertions(+), 22 deletions(-) create mode 100644 dynamic_programming/lcs.c diff --git a/DIRECTORY.md b/DIRECTORY.md index c58820dfb7..c1a12eeb04 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -121,6 +121,9 @@ * [Test Malloc Dbg](https://github.com/TheAlgorithms/C/blob/HEAD/developer_tools/test_malloc_dbg.c) * [Test Min Printf](https://github.com/TheAlgorithms/C/blob/HEAD/developer_tools/test_min_printf.c) +## Dynamic Programming + * [Lcs](https://github.com/TheAlgorithms/C/blob/HEAD/dynamic_programming/lcs.c) + ## Exercism * Acronym * [Acronym](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/acronym/acronym.c) @@ -226,6 +229,7 @@ * [26](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/26.c) * [268](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/268.c) * [27](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/27.c) + * [274](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/274.c) * [278](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/278.c) * [28](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/28.c) * [283](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/283.c) @@ -288,40 +292,42 @@ * [Kohonen Som Topology](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/kohonen_som_topology.c) * [Kohonen Som Trace](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/kohonen_som_trace.c) +## Math + * [Armstrong Number](https://github.com/TheAlgorithms/C/blob/HEAD/math/armstrong_number.c) + * [Cantor Set](https://github.com/TheAlgorithms/C/blob/HEAD/math/cantor_set.c) + * [Cartesian To Polar](https://github.com/TheAlgorithms/C/blob/HEAD/math/cartesian_to_polar.c) + * [Catalan](https://github.com/TheAlgorithms/C/blob/HEAD/math/catalan.c) + * [Collatz](https://github.com/TheAlgorithms/C/blob/HEAD/math/collatz.c) + * [Factorial](https://github.com/TheAlgorithms/C/blob/HEAD/math/factorial.c) + * [Factorial Large Number](https://github.com/TheAlgorithms/C/blob/HEAD/math/factorial_large_number.c) + * [Factorial Trailing Zeroes](https://github.com/TheAlgorithms/C/blob/HEAD/math/factorial_trailing_zeroes.c) + * [Fibonacci](https://github.com/TheAlgorithms/C/blob/HEAD/math/fibonacci.c) + * [Fibonacci Dp](https://github.com/TheAlgorithms/C/blob/HEAD/math/fibonacci_dp.c) + * [Fibonacci Fast](https://github.com/TheAlgorithms/C/blob/HEAD/math/fibonacci_fast.c) + * [Fibonacci Formula](https://github.com/TheAlgorithms/C/blob/HEAD/math/fibonacci_formula.c) + * [Gcd](https://github.com/TheAlgorithms/C/blob/HEAD/math/gcd.c) + * [Is Armstrong](https://github.com/TheAlgorithms/C/blob/HEAD/math/is_armstrong.c) + * [Large Factorials](https://github.com/TheAlgorithms/C/blob/HEAD/math/large_factorials.c) + * [Lcm](https://github.com/TheAlgorithms/C/blob/HEAD/math/lcm.c) + * [Lerp](https://github.com/TheAlgorithms/C/blob/HEAD/math/lerp.c) + * [Palindrome](https://github.com/TheAlgorithms/C/blob/HEAD/math/palindrome.c) + * [Prime](https://github.com/TheAlgorithms/C/blob/HEAD/math/prime.c) + * [Prime Factoriziation](https://github.com/TheAlgorithms/C/blob/HEAD/math/prime_factoriziation.c) + * [Prime Sieve](https://github.com/TheAlgorithms/C/blob/HEAD/math/prime_sieve.c) + * [Strong Number](https://github.com/TheAlgorithms/C/blob/HEAD/math/strong_number.c) + ## Misc - * [Armstrong Number](https://github.com/TheAlgorithms/C/blob/HEAD/misc/armstrong_number.c) - * [Cantor Set](https://github.com/TheAlgorithms/C/blob/HEAD/misc/cantor_set.c) - * [Cartesian To Polar](https://github.com/TheAlgorithms/C/blob/HEAD/misc/cartesian_to_polar.c) - * [Catalan](https://github.com/TheAlgorithms/C/blob/HEAD/misc/catalan.c) - * [Collatz](https://github.com/TheAlgorithms/C/blob/HEAD/misc/collatz.c) * [Demonetization](https://github.com/TheAlgorithms/C/blob/HEAD/misc/demonetization.c) - * [Factorial](https://github.com/TheAlgorithms/C/blob/HEAD/misc/factorial.c) - * [Factorial Large Number](https://github.com/TheAlgorithms/C/blob/HEAD/misc/factorial_large_number.c) - * [Factorial Trailing Zeroes](https://github.com/TheAlgorithms/C/blob/HEAD/misc/factorial_trailing_zeroes.c) - * [Fibonacci](https://github.com/TheAlgorithms/C/blob/HEAD/misc/fibonacci.c) - * [Fibonacci Dp](https://github.com/TheAlgorithms/C/blob/HEAD/misc/fibonacci_dp.c) - * [Fibonacci Fast](https://github.com/TheAlgorithms/C/blob/HEAD/misc/fibonacci_fast.c) - * [Fibonacci Formula](https://github.com/TheAlgorithms/C/blob/HEAD/misc/fibonacci_formula.c) - * [Gcd](https://github.com/TheAlgorithms/C/blob/HEAD/misc/gcd.c) - * [Is Armstrong](https://github.com/TheAlgorithms/C/blob/HEAD/misc/is_armstrong.c) - * [Large Factorials](https://github.com/TheAlgorithms/C/blob/HEAD/misc/large_factorials.c) - * [Lcm](https://github.com/TheAlgorithms/C/blob/HEAD/misc/lcm.c) - * [Lerp](https://github.com/TheAlgorithms/C/blob/HEAD/misc/lerp.c) * [Lexicographic Permutations](https://github.com/TheAlgorithms/C/blob/HEAD/misc/lexicographic_permutations.c) * [Longest Subsequence](https://github.com/TheAlgorithms/C/blob/HEAD/misc/longest_subsequence.c) * [Mirror](https://github.com/TheAlgorithms/C/blob/HEAD/misc/mirror.c) - * [Palindrome](https://github.com/TheAlgorithms/C/blob/HEAD/misc/palindrome.c) * [Pid](https://github.com/TheAlgorithms/C/blob/HEAD/misc/pid.c) * [Poly Add](https://github.com/TheAlgorithms/C/blob/HEAD/misc/poly_add.c) * [Postfix Evaluation](https://github.com/TheAlgorithms/C/blob/HEAD/misc/postfix_evaluation.c) - * [Prime](https://github.com/TheAlgorithms/C/blob/HEAD/misc/prime.c) - * [Prime Factoriziation](https://github.com/TheAlgorithms/C/blob/HEAD/misc/prime_factoriziation.c) - * [Prime Seive](https://github.com/TheAlgorithms/C/blob/HEAD/misc/prime_seive.c) * [Quartile](https://github.com/TheAlgorithms/C/blob/HEAD/misc/quartile.c) * [Rot13](https://github.com/TheAlgorithms/C/blob/HEAD/misc/rot13.c) * [Rselect](https://github.com/TheAlgorithms/C/blob/HEAD/misc/rselect.c) * [Run Length Encoding](https://github.com/TheAlgorithms/C/blob/HEAD/misc/run_length_encoding.c) - * [Strong Number](https://github.com/TheAlgorithms/C/blob/HEAD/misc/strong_number.c) * [Sudoku Solver](https://github.com/TheAlgorithms/C/blob/HEAD/misc/sudoku_solver.c) * [Tower Of Hanoi](https://github.com/TheAlgorithms/C/blob/HEAD/misc/tower_of_hanoi.c) * [Union Find](https://github.com/TheAlgorithms/C/blob/HEAD/misc/union_find.c) diff --git a/dynamic_programming/lcs.c b/dynamic_programming/lcs.c new file mode 100644 index 0000000000..5637a72dcd --- /dev/null +++ b/dynamic_programming/lcs.c @@ -0,0 +1,153 @@ +/** + * @file + * @brief [Longest Common Subsequence](https://en.wikipedia.org/wiki/Longest_common_subsequence_problem) algorithm + * @details + * From Wikipedia: The longest common subsequence (LCS) problem is the problem + * of finding the longest subsequence common to all sequences in a set of sequences + * (often just two sequences). + * @author [Kurtz](https://github.com/itskurtz) + */ +#include /* for io operations */ +#include /* for memory management & exit */ +#include /* for string manipulation & ooperations */ +#include /* for asserts */ + +enum {LEFT, UP, DIAG}; + +/** + * @breif Computes LCS between s1 and s2 using a dynamic-programming approach + * @param1 s1 first null-terminated string + * @param2 s2 second null-terminated string + * @param3 l1 length of s1 + * @param4 l2 length of s2 + * @param5 L matrix of size l1 x l2 + * @param6 B matrix of size l1 x l2 + * @returns void + */ +void lcslen(const char *s1, const char *s2, int l1, int l2, int **L, int **B) { + /* B is the directions matrix + L is the LCS matrix */ + int i, j; + + /* loop over the simbols in my sequences + save the directions according to the LCS */ + for (i = 1; i <= l1; ++i) + for (j = 1; j <= l2; ++j) + if (s1[i-1] == s2[j-1]) { + L[i][j] = 1 + L[i-1][j-1]; + B[i][j] = DIAG; + } + else if (L[i-1][j] < L[i][j-1]) { + L[i][j] = L[i][j-1]; + B[i][j] = LEFT; + } + else { + L[i][j] = L[i-1][j]; + B[i][j] = UP; + } +} + +/** + * @breif Builds the LCS according to B using a traceback approach + * @param1 s1 first null-terminated string + * @param2 l1 length of s1 + * @param3 l2 length of s2 + * @param4 L matrix of size l1 x l2 + * @param5 B matrix of size l1 x l2 + * @returns lcs longest common subsequence + */ +char *lcsbuild(const char *s1, int l1, int l2, int **L, int **B) { + int i, j, lcsl; + char *lcs; + lcsl = L[l1][l2]; + + /* my lcs is at least the empty symbol */ + lcs = (char *)calloc(lcsl+1, sizeof(char)); /* null-terminated \0 */ + if (!lcs) { + perror("calloc: "); + return NULL; + } + + i = l1, j = l2; + while (i > 0 && j > 0) { + /* walk the matrix backwards */ + if (B[i][j] == DIAG) { + lcs[--lcsl] = s1[i-1]; + i = i - 1; + j = j - 1; + } + else if (B[i][j] == LEFT) + j = j - 1; + else + i = i - 1; + } + return lcs; +} +/** + * @brief Self-test implementations + * @returns void + */ +static void test() { + /* https://en.wikipedia.org/wiki/Subsequence#Applications */ + int **L, **B, j, l1, l2; + + char *s1 = "ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA"; + char *s2 = "CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA"; + char *lcs; + + l1 = strlen(s1); + l2 = strlen(s2); + + L = (int **)calloc(l1+1, sizeof(int *)); + B = (int **)calloc(l1+1, sizeof(int *)); + + if (!L) { + perror("calloc: "); + exit(1); + } + if (!B) { + perror("calloc: "); + exit(1); + } + for (j = 0; j <= l1; j++) { + L[j] = (int *)calloc(l2+1, sizeof(int)); + if (!L[j]) { + perror("calloc: "); + exit(1); + } + B[j] = (int *)calloc(l2+1, sizeof(int)); + if (!L[j]) { + perror("calloc: "); + exit(1); + } + } + + lcslen(s1, s2, l1, l2, L, B); + lcs = lcsbuild(s1, l1, l2, L, B); + + assert(L[l1][l2] == 27); + assert(strcmp(lcs, "CGTTCGGCTATGCTTCTACTTATTCTA") == 0); + + printf("S1: %s\tS2: %s\n", s1, s2); + printf("LCS len:%3d\n", L[l1][l2]); + printf("LCS: %s\n", lcs); + + free(lcs); + for (j = 0; j <= l1; j++) + free(L[j]), free(B[j]); + free(L); + free(B); + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief Main function + * @param argc commandline argument count (ignored) + * @param argv commandline array of arguments (ignored) + * @returns 0 on exit + */ +int main(int argc, char *argv[]) { + test(); // run self-test implementations + return 0; +} From bed955ed406aaea4099a0b323c7120bdd60017aa Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Tue, 27 Dec 2022 11:21:10 +0400 Subject: [PATCH 074/156] feat: add Max Increase to Keep City Skyline (#1173) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/807.c | 32 ++++++++++++++++++++++++++++++++ 2 files changed, 33 insertions(+) create mode 100644 leetcode/src/807.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 6de869fa5d..968e6229c1 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -93,6 +93,7 @@ | 704 | [Binary Search](https://leetcode.com/problems/binary-search/) | [C](./src/704.c) | Easy | | 709 | [To Lower Case](https://leetcode.com/problems/to-lower-case/) | [C](./src/709.c) | Easy | | 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones/) | [C](./src/771.c) | Easy | +| 807 | [Max Increase to Keep City Skyline](https://leetcode.com/problems/max-increase-to-keep-city-skyline/description/) | [C](./src/807.c) | Medium | | 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array/) | [C](./src/852.c) | Easy | | 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list/) | [C](./src/876.c) | Easy | | 901 | [Online Stock Span](https://leetcode.com/problems/online-stock-span/) | [C](./src/901.c) | Medium | diff --git a/leetcode/src/807.c b/leetcode/src/807.c new file mode 100644 index 0000000000..1f51bdd753 --- /dev/null +++ b/leetcode/src/807.c @@ -0,0 +1,32 @@ +#define min(a,b) (((a)<(b))?(a):(b)) +#define max(a,b) (((a)>(b))?(a):(b)) + +// Collect maxes on each row and each column. +// Runtime: O(n * n) +// Space: O(n) +int maxIncreaseKeepingSkyline(int** grid, int gridSize, int* gridColSize){ + int* rowsMaxs = calloc(gridSize, sizeof(int)); + int* colsMaxs = calloc(gridSize, sizeof(int)); + + // Find max of each row and column + for(int i = 0; i < gridSize; i++){ + for (int j = 0; j < gridSize; j++){ + rowsMaxs[i] = max(rowsMaxs[i], grid[i][j]); + colsMaxs[j] = max(colsMaxs[j], grid[i][j]); + } + } + + int result = 0; + for(int i = 0; i < gridSize; i++){ + for (int j = 0; j < gridSize; j++){ + int rowMax = rowsMaxs[i]; + int colMax = colsMaxs[j]; + result += min(rowMax - grid[i][j], colMax - grid[i][j]); + } + } + + free(rowsMaxs); + free(colsMaxs); + + return result; +} From b8a8807585db7fbffdf8eedfb95b61d80edec481 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Tue, 27 Dec 2022 21:45:39 +0400 Subject: [PATCH 075/156] feat: add Minimum Average Difference (#1171) * add leetcode Minimum Average Difference * updating DIRECTORY.md Co-authored-by: David Leal Co-authored-by: github-actions[bot] --- DIRECTORY.md | 2 ++ leetcode/DIRECTORY.md | 1 + leetcode/src/2256.c | 37 +++++++++++++++++++++++++++++++++++++ 3 files changed, 40 insertions(+) create mode 100644 leetcode/src/2256.c diff --git a/DIRECTORY.md b/DIRECTORY.md index c1a12eeb04..fcfd8ab04e 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -217,6 +217,7 @@ * [217](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/217.c) * [2222](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2222.c) * [223](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/223.c) + * [2256](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2256.c) * [226](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/226.c) * [2270](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2270.c) * [230](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/230.c) @@ -271,6 +272,7 @@ * [771](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/771.c) * [79](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/79.c) * [8](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/8.c) + * [807](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/807.c) * [82](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/82.c) * [83](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/83.c) * [852](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/852.c) diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 968e6229c1..ecc199505e 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -117,5 +117,6 @@ | 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | | 2222 | [Number of Ways to Select Buildings](https://leetcode.com/problems/number-of-ways-to-select-buildings/) | [C](./src/2222.c) | Medium | +| 2256 | [Minimum Average Difference](https://leetcode.com/problems/minimum-average-difference/) | [C](./src/2256.c) | Medium | | 2270 | [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array/) | [C](./src/2270.c) | Medium | | 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | diff --git a/leetcode/src/2256.c b/leetcode/src/2256.c new file mode 100644 index 0000000000..06e4d123a5 --- /dev/null +++ b/leetcode/src/2256.c @@ -0,0 +1,37 @@ +// Prefix sum. +// - Calculate whole nums sum. +// - Calculate currIndex sum. +// - Compare averages +// Runtime: O(n) +// Space: O(1) + +int minimumAverageDifference(int* nums, int numsSize){ + long numsSum = 0; + for (int i = 0; i < numsSize; i++){ + numsSum += nums[i]; + } + + long currSum = 0; + long minAverage = 9223372036854775807; // Long max + int minIndex = 0; + + for (int i = 0; i < numsSize; i++){ + currSum += nums[i]; + + int leftItemsNumber = (numsSize - i - 1); + long leftItemsNumberAverage = 0; + if (leftItemsNumber != 0){ + leftItemsNumberAverage = (numsSum - currSum) / leftItemsNumber; + } + + long currItemsNumberAverage = currSum / (i + 1); + long averageDiff = abs(currItemsNumberAverage - leftItemsNumberAverage); + + if (averageDiff < minAverage){ + minAverage = averageDiff; + minIndex = i; + } + } + + return minIndex; +} From 60310deb9e2058590828aedaa449740a678a87c5 Mon Sep 17 00:00:00 2001 From: Saad H <105989111+Xcv27514@users.noreply.github.com> Date: Wed, 28 Dec 2022 15:35:41 -0500 Subject: [PATCH 076/156] feat: add `process_scheduling_algorithms` to CMake (#1193) * Update CMakeLists.txt * Create CMakeLists.txt Co-authored-by: David Leal --- CMakeLists.txt | 1 + process_scheduling_algorithms/CMakeLists.txt | 20 ++++++++++++++++++++ 2 files changed, 21 insertions(+) create mode 100644 process_scheduling_algorithms/CMakeLists.txt diff --git a/CMakeLists.txt b/CMakeLists.txt index dafc51c743..064fc5dc12 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -61,6 +61,7 @@ add_subdirectory(conversions) add_subdirectory(client_server) add_subdirectory(project_euler) add_subdirectory(machine_learning) +add_subdirectory(process_scheduling_algorithms) add_subdirectory(numerical_methods) ## Configure Doxygen documentation system diff --git a/process_scheduling_algorithms/CMakeLists.txt b/process_scheduling_algorithms/CMakeLists.txt new file mode 100644 index 0000000000..1d2a56e057 --- /dev/null +++ b/process_scheduling_algorithms/CMakeLists.txt @@ -0,0 +1,20 @@ +# If necessary, use the RELATIVE flag, otherwise each source file may be listed +# with full pathname. RELATIVE may makes it easier to extract an executable name +# automatically. +file( GLOB APP_SOURCES RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} *.c ) +# file( GLOB APP_SOURCES ${CMAKE_SOURCE_DIR}/*.c ) +# AUX_SOURCE_DIRECTORY(${CMAKE_CURRENT_SOURCE_DIR} APP_SOURCES) +foreach( testsourcefile ${APP_SOURCES} ) + # I used a simple string replace, to cut off .cpp. + string( REPLACE ".c" "" testname ${testsourcefile} ) + add_executable( ${testname} ${testsourcefile} ) + + if(OpenMP_C_FOUND) + target_link_libraries(${testname} OpenMP::OpenMP_C) + endif() + if(MATH_LIBRARY) + target_link_libraries(${testname} ${MATH_LIBRARY}) + endif() + install(TARGETS ${testname} DESTINATION "bin/process_scheduling_algorithms") + +endforeach( testsourcefile ${APP_SOURCES} ) From 1a5b5f522fd10ad0a7eb6d6a8b7ad9366b7a053f Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 6 Jan 2023 03:24:30 +0400 Subject: [PATCH 077/156] feat: add LeetCode folder labeler (#1191) * add labeler for Leetcode changes folder * Update labeler.yml add end line Co-authored-by: David Leal --- .github/labeler.yml | 2 ++ .github/workflows/labeler.yml | 14 ++++++++++++++ 2 files changed, 16 insertions(+) create mode 100644 .github/labeler.yml create mode 100644 .github/workflows/labeler.yml diff --git a/.github/labeler.yml b/.github/labeler.yml new file mode 100644 index 0000000000..caabb2d152 --- /dev/null +++ b/.github/labeler.yml @@ -0,0 +1,2 @@ +Leetcode folder changes: +- leetcode/**/* diff --git a/.github/workflows/labeler.yml b/.github/workflows/labeler.yml new file mode 100644 index 0000000000..fe3f22d579 --- /dev/null +++ b/.github/workflows/labeler.yml @@ -0,0 +1,14 @@ +name: "Pull Request Labeler" +on: +- pull_request_target + +jobs: + triage: + permissions: + contents: read + pull-requests: write + runs-on: ubuntu-latest + steps: + - uses: actions/labeler@v4 + with: + repo-token: "${{ secrets.GITHUB_TOKEN }}" From 3014b7352d131105cf61315f15f694bc79b02ef0 Mon Sep 17 00:00:00 2001 From: ms3939 <114799185+ManogjnaSinguluri@users.noreply.github.com> Date: Fri, 6 Jan 2023 04:58:08 +0530 Subject: [PATCH 078/156] feat: improve the Singly Link List implementation (#1092) * Update singly_link_list_deletion.c Delete function is updated to delete at any required position (not only first) * Update singly_link_list_deletion.c The code is changed as per the suggestions. Please lat me know if there are any changes to be done Thank you * Update singly_link_list_deletion.c The code is changed as per the suggestions. Please let me know if there are any changes to be done Thank you.. * Update singly_link_list_deletion.c I added inserting at any input location . Please let me know if changes need to be done * Update singly_link_list_deletion.c * Update singly_link_list_deletion.c I updated self tests for both insert and delete functions properly. Please let me know if any changes need to be done Thank you * Update singly_link_list_deletion.c As per your suggestions I updated the code. Please let me know if any changes need to be done.. * chore: apply suggestions from code review Co-authored-by: David Leal --- .../linked_list/singly_link_list_deletion.c | 163 +++++++++++++----- 1 file changed, 120 insertions(+), 43 deletions(-) diff --git a/data_structures/linked_list/singly_link_list_deletion.c b/data_structures/linked_list/singly_link_list_deletion.c index 2df425ce01..f94aef54ba 100644 --- a/data_structures/linked_list/singly_link_list_deletion.c +++ b/data_structures/linked_list/singly_link_list_deletion.c @@ -4,39 +4,64 @@ when passed with a key of the node. */ #include +#include +#include struct node { int info; struct node *link; }; struct node *start = NULL; -/////////////////////////////////////////////////////////// -struct node *createnode() // function to create node +////////////////////////////////////////////////////////////////// +struct node *createnode() // function to create node { struct node *t; t = (struct node *)malloc(sizeof(struct node)); return (t); } -//////////////////////////////////////////////////////// -void insert() // function to insert at first location +////////////////////////////////////////////////////////////////// +int insert(int pos, int d) { - struct node *p; - p = createnode(); - printf("\nenter the number to insert"); - scanf("%d", &p->info); - p->link = NULL; - if (start == NULL) + struct node *new; + new = createnode(); + new->info = d; + if (pos == 1) { - start = p; + new->link = NULL; + if (start == NULL) + { + start = new; + } + else + { + new->link = start; + start = new; + } } else { - p->link = start; - start = p; + struct node *pre = start; + for (int i = 2; i < pos; i++) + { + if (pre == NULL) + { + break; + } + pre = pre->link; + } + if(pre==NULL) + { + printf("Position not found!"); + return 0; + } + new->link = pre->link; + pre->link = new; } -} -/////////////////////////////////////////////////////////// -void deletion() // function to delete from first position + return 0; + } + +/////////////////////////////////////////////////////////////////// +int deletion(int pos) // function to delete from any position { struct node *t; if (start == NULL) @@ -45,14 +70,34 @@ void deletion() // function to delete from first position } else { - struct node *p; - p = start; - start = start->link; - free(p); + if (pos == 1) + { + struct node *p; + p = start; + start = start->link; + free(p); + } + else + { + struct node *prev = start; + for (int i = 2; i < pos; i++) + { + if (prev == NULL) + { + printf("Position not found!"); + return 0; + } + prev = prev->link; + } + struct node *n = prev->link; // n points to required node to be deleted + prev->link = n->link; + free(n); + } } + return 0; } -/////////////////////////////////////////////////////// -void viewlist() // function to display values +/////////////////////////////////////////////////////////////////// +void viewlist() // function to display values { struct node *p; if (start == NULL) @@ -69,32 +114,64 @@ void viewlist() // function to display values } } } -////////////////////////////////////////////////////////////////////// +////////////////////////////////////////////////////////////////// +static void test() +{ + insert(1, 39); + assert(start->info == 39); + insert(2, 10); + insert(3, 11); + deletion(1); + assert(start->info != 39); + printf("Self-tests successfully passed!\n"); +} +////////////////////////////////////////////////////////////////// int main() { - int n; - while (1) + int n = 0, pos = 0, p = 0, num = 0, c = 0; + printf("\n1.self test mode"); + printf("\n2.interactive mode"); + printf("\nenter your choice:"); + scanf("%d", &c); + if (c == 1) + { + test(); + } + else if (c == 2) { - printf("\n1.add value at first location"); - printf("\n2.delete value from first location"); - printf("\n3.view value"); - printf("\nenter your choice"); - scanf("%d", &n); - switch (n) + while (1) { - case 1: - insert(); - break; - case 2: - deletion(); - break; - case 3: - viewlist(); - break; - default: - printf("\ninvalid choice"); + printf("\n1.add value at the given location"); + printf("\n2.delete value at the given location"); + printf("\n3.view list"); + printf("\nenter your choice :"); + scanf("%d", &n); + switch (n) + { + case 1: + printf("enter the position where the element is to be added :"); + scanf("%d", &p); + printf("enter the element is to be added :"); + scanf("%d", &num); + insert(p, num); + break; + case 2: + printf("enter the position where the element is to be deleted :"); + scanf("%d", &pos); + deletion(pos); + break; + case 3: + viewlist(); + break; + default: + printf("\ninvalid choice"); + } } } - return (0); + else + { + printf("Invalid choice"); + } + return 0; } From 8cbb76a02b1e2123db2a8b376e4e92179a4c0e0f Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Wed, 18 Jan 2023 23:13:06 +0400 Subject: [PATCH 079/156] feat: add Number of Laser Beams in a Bank (#1174) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/2125.c | 30 ++++++++++++++++++++++++++++++ 2 files changed, 31 insertions(+) create mode 100644 leetcode/src/2125.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index ecc199505e..00e19f09d8 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -115,6 +115,7 @@ | 1704 | [Determine if String Halves Are Alike](Determine if String Halves Are Alike) | [C](./src/1704.c) | Easy | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | +| 2125 | [Number of Laser Beams in a Bank](https://leetcode.com/problems/number-of-laser-beams-in-a-bank/description/) | [C](./src/2125.c) | Medium | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | | 2222 | [Number of Ways to Select Buildings](https://leetcode.com/problems/number-of-ways-to-select-buildings/) | [C](./src/2222.c) | Medium | | 2256 | [Minimum Average Difference](https://leetcode.com/problems/minimum-average-difference/) | [C](./src/2256.c) | Medium | diff --git a/leetcode/src/2125.c b/leetcode/src/2125.c new file mode 100644 index 0000000000..0f65b24dff --- /dev/null +++ b/leetcode/src/2125.c @@ -0,0 +1,30 @@ +int coundDevices(char* bankRow){ + int result = 0; + int bankRowSize = strlen(bankRow); + for(int i = 0; i < bankRowSize; i++){ + if (bankRow[i] == '1'){ + result++; + } + } + + return result; +} + +// Counting devices in each row +// Runtime: O(n*m), n-number of bank rows, m - max size of row. +// Space: O(1) +int numberOfBeams(char ** bank, int bankSize){ + int prevRowDevices = 0; + int result = 0; + for(int i = 0; i < bankSize; i++){ + int devices = coundDevices(bank[i]); + if (devices == 0){ + continue; + } + + result += devices * prevRowDevices; + prevRowDevices = devices; + } + + return result; +} From 78d083fd84f6c167a90a6abb5cda90dd17c781ca Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Wed, 18 Jan 2023 23:15:20 +0400 Subject: [PATCH 080/156] feat: add Maximum Difference Between Node and Ancestor (#1180) * add leetcode Maximum Difference Between Node and Ancestor * chore: fix Markdown ordering Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 3 ++- leetcode/src/1026.c | 38 ++++++++++++++++++++++++++++++++++++++ 2 files changed, 40 insertions(+), 1 deletion(-) create mode 100644 leetcode/src/1026.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 00e19f09d8..2a6c4aa1c0 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -104,12 +104,13 @@ | 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | | 985 | [Sum of Even Numbers After Queries](https://leetcode.com/problems/sum-of-even-numbers-after-queries/) | [C](./src/985.c) | Medium | | 1009 | [Complement of Base 10 Integer](https://leetcode.com/problems/complement-of-base-10-integer/) | [C](./src/1009.c) | Easy | +| 1026 | [Maximum Difference Between Node and Ancestor](https://leetcode.com/problems/maximum-difference-between-node-and-ancestor/description/) | [C](./src/1026.c) | Medium | | 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | | 1695 | [Maximum Erasure Value](https://leetcode.com/problems/maximum-erasure-value/) | [C](./src/1695.c) | Medium | -| 1769 | [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box/) | [C](./src/1769.c) | Medium | +| 1769 | [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box/) | [C](./src/1769.c) | Medium | | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | | 1653 | [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced/) | [C](./src/1653.c) | Medium | | 1704 | [Determine if String Halves Are Alike](Determine if String Halves Are Alike) | [C](./src/1704.c) | Easy | diff --git a/leetcode/src/1026.c b/leetcode/src/1026.c new file mode 100644 index 0000000000..0dda623023 --- /dev/null +++ b/leetcode/src/1026.c @@ -0,0 +1,38 @@ +/** + * Definition for a binary tree node. + * struct TreeNode { + * int val; + * struct TreeNode *left; + * struct TreeNode *right; + * }; + */ + +#define max(a,b) (((a)>(b))?(a):(b)) +#define min(a,b) (((a)<(b))?(a):(b)) + +void recursiveSolve(struct TreeNode* node, int* result, int minVal, int maxVal){ + if (node == NULL){ + return; + } + + *result = max(*result, abs(minVal - node->val)); + *result = max(*result, abs(maxVal - node->val)); + + minVal = min(minVal, node->val); + maxVal = max(maxVal, node->val); + + recursiveSolve(node->left, result, minVal, maxVal); + recursiveSolve(node->right, result, minVal, maxVal); +} + +// Depth First Search +// If The maximum diff is exists it should be the difference of the MAX or MIN value in the tree path to the LEAF +// Runtime: O(n) +// Space: O(1) +int maxAncestorDiff(struct TreeNode* root){ + int result = 0; + int maxVal = root->val; + int minVal = root->val; + recursiveSolve(root, &result, minVal, maxVal); + return result; +} From 36d1b265a70e7ad98f5ce47ea9b356b98570432d Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Wed, 18 Jan 2023 23:15:47 +0400 Subject: [PATCH 081/156] feat: add Redundant Connection (#1181) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/684.c | 49 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 50 insertions(+) create mode 100644 leetcode/src/684.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 2a6c4aa1c0..5b38cdf828 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -88,6 +88,7 @@ | 647 | [Palindromic Substring](https://leetcode.com/problems/palindromic-substrings/) | [C](./src/647.c) | Medium | | 669 | [Trim a Binary Search Tree](https://leetcode.com/problems/trim-a-binary-search-tree/) | [C](./src/669.c) | Medium | | 674 | [Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence/) | [C](./src/674.c) | Easy | +| 684 | [Redundant Connection](https://leetcode.com/problems/redundant-connection/description/) | [C](./src/684.c) | Medium | | 700 | [Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree/) | [C](./src/700.c) | Easy | | 701 | [Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree/) | [C](./src/701.c) | Medium | | 704 | [Binary Search](https://leetcode.com/problems/binary-search/) | [C](./src/704.c) | Easy | diff --git a/leetcode/src/684.c b/leetcode/src/684.c new file mode 100644 index 0000000000..e5de7faa1e --- /dev/null +++ b/leetcode/src/684.c @@ -0,0 +1,49 @@ +/** + * Note: The returned array must be malloced, assume caller calls free(). + */ +int find(int* sets, int index){ + while (sets[index] != index){ + index = sets[index]; + } + + return index; +} + +void unionSet(int* sets, int i1, int i2){ + int i1Parent = find(sets, i1); + int i2Parent = find(sets, i2); + + sets[i1Parent] = i2Parent; +} + +// Union find +// Runtime: O(n) +// Space: O(n) +int* findRedundantConnection(int** edges, int edgesSize, int* edgesColSize, int* returnSize){ + int setsSize = edgesSize + 1; + int* sets = malloc(setsSize * sizeof(int)); + for (int i = 0; i < setsSize; i++){ + sets[i] = i; + } + + int* result = malloc(2 * sizeof(int)); + *returnSize = 2; + + for (int i = 0; i < edgesSize; i++){ + int* edge = edges[i]; + + int i0Parent = find(sets, edge[0]); + int i1Parent = find(sets, edge[1]); + + if (i0Parent == i1Parent){ + result[0] = edge[0]; + result[1] = edge[1]; + continue; + } + + unionSet(sets, i0Parent, i1Parent); + } + + free(sets); + return result; +} From 1b6fe6ea17d2ae0983fcff47c1aec77e2790a994 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Wed, 18 Jan 2023 23:54:30 +0400 Subject: [PATCH 082/156] feat: add Minimum Falling Path Sum (#1182) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/931.c | 37 +++++++++++++++++++++++++++++++++++++ 2 files changed, 38 insertions(+) create mode 100644 leetcode/src/931.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 5b38cdf828..8533e89943 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -100,6 +100,7 @@ | 901 | [Online Stock Span](https://leetcode.com/problems/online-stock-span/) | [C](./src/901.c) | Medium | | 905 | [Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity/) | [C](./src/905.c) | Easy | | 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters/) | [C](./src/917.c) | Easy | +| 931 | [Minimum Falling Path Sum](https://leetcode.com/problems/minimum-falling-path-sum/description/) | [C](./src/931.c) | Medium | | 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | | 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c) | Easy | | 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | diff --git a/leetcode/src/931.c b/leetcode/src/931.c new file mode 100644 index 0000000000..b257c8c33e --- /dev/null +++ b/leetcode/src/931.c @@ -0,0 +1,37 @@ +#define min(a,b) (((a)<(b))?(a):(b)) + +// Dynamic programming. +// Runtime O(n*n) +// Space O(n) +int minFallingPathSum(int** matrix, int matrixSize, int* matrixColSize){ + int* dp = calloc(matrixSize, sizeof(int)); + + for (int i = 0; i < matrixSize; i++){ + int* nextDp = calloc(matrixSize, sizeof(int)); + + for (int j = 0; j < matrixSize; j++){ + nextDp[j] = dp[j] + matrix[i][j]; + + // If not the first column - try to find minimum in prev column + if(j > 0){ + nextDp[j] = min(nextDp[j], dp[j - 1] + matrix[i][j]); + } + + // If not the last column - try to find minimum in next column + if (j < matrixSize - 1){ + nextDp[j] = min(nextDp[j], dp[j + 1] + matrix[i][j]); + } + } + + free(dp); + dp = nextDp; + } + + int result = dp[0]; + for (int j = 1; j < matrixSize; j++){ + result = min(result, dp[j]); + } + + free(dp); + return result; +} From 108fbede1617d57835be6b0bf8ab2c58b479ee5b Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Thu, 19 Jan 2023 00:06:45 +0400 Subject: [PATCH 083/156] feat: add Longest Square Streak in an Array (#1185) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/2501.c | 52 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 53 insertions(+) create mode 100644 leetcode/src/2501.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 8533e89943..1bddc04917 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -124,3 +124,4 @@ | 2256 | [Minimum Average Difference](https://leetcode.com/problems/minimum-average-difference/) | [C](./src/2256.c) | Medium | | 2270 | [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array/) | [C](./src/2270.c) | Medium | | 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | +| 2501 | [Longest Square Streak in an Array](https://leetcode.com/problems/longest-square-streak-in-an-array/description/) | [C](./src/2501.c) | Medium | diff --git a/leetcode/src/2501.c b/leetcode/src/2501.c new file mode 100644 index 0000000000..87cfa2702b --- /dev/null +++ b/leetcode/src/2501.c @@ -0,0 +1,52 @@ +#define max(a,b) (((a)>(b))?(a):(b)) + +int longestSquareStreakDp(int* numsSet, int numsSetSize, int* dp, long num){ + if (dp[num] != 0){ + return dp[num]; + } + + long numSquare = num * num; + + dp[num] = 1; + if (numSquare <= numsSetSize && numsSet[numSquare] == 1){ + dp[num] += longestSquareStreakDp(numsSet, numsSetSize, dp, numSquare); + } + + return dp[num]; +} + +// Dynamic approach. Up -> down. +// Runtime: O(numsSize) +// Space: O(max(nums)) +int longestSquareStreak(int* nums, int numsSize){ + // Find nums maximum + int numMax = 0; + for(int i = 0; i < numsSize; i++){ + numMax = max(numMax, nums[i]); + } + + int* numsSet = calloc(numMax + 1, sizeof(int)); + int* dp = calloc(numMax + 1, sizeof(int)); + + // Init set of nums + for(int i = 0; i < numsSize; i++){ + numsSet[nums[i]] = 1; + } + + // Find result + int result = -1; + for(int i = 0; i < numsSize; i++){ + long num = nums[i]; + long numSquare = num * num; + + if (numSquare > numMax || numsSet[numSquare] == 0){ + continue; + } + + result = max(result, 1 + longestSquareStreakDp(numsSet, numMax, dp, numSquare)); + } + + free(dp); + free(numsSet); + return result; +} From 02c01047a7ef8ebc3b25328e3c7d0b91e4b3918f Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Thu, 19 Jan 2023 00:34:19 +0400 Subject: [PATCH 084/156] feat: add Longest Chunked Palindrome Decomposition (#1184) * add leetcode Longest Chunked Palindrome Decomposition * Update leetcode/src/1147.c Co-authored-by: David Leal * Update 1147.c fix review Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/1147.c | 49 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 50 insertions(+) create mode 100644 leetcode/src/1147.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 1bddc04917..9288471e1f 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -108,6 +108,7 @@ | 1009 | [Complement of Base 10 Integer](https://leetcode.com/problems/complement-of-base-10-integer/) | [C](./src/1009.c) | Easy | | 1026 | [Maximum Difference Between Node and Ancestor](https://leetcode.com/problems/maximum-difference-between-node-and-ancestor/description/) | [C](./src/1026.c) | Medium | | 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | +| 1147 | [Longest Chunked Palindrome Decomposition](https://leetcode.com/problems/longest-chunked-palindrome-decomposition/description/) | [C](./src/1147.c) | Hard | | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | diff --git a/leetcode/src/1147.c b/leetcode/src/1147.c new file mode 100644 index 0000000000..501060d098 --- /dev/null +++ b/leetcode/src/1147.c @@ -0,0 +1,49 @@ +#define max(a,b) (((a)>(b))?(a):(b)) + +bool equalSubstrings(char* text, int firstIndex, int secondIndex, int length){ + for (int i = 0; i < length; i++){ + if (text[firstIndex + i] != text[secondIndex + i]){ + return false; + } + } + + return true; +} + +int longestDecompositionDpCached(char* text, int textLen, int index, int* dp){ + if (2 * index >= textLen){ + return 0; + } + + if (dp[index] == 0){ + dp[index] = longestDecompositionDp(text, textLen, index, dp); + } + + return dp[index]; +} + +int longestDecompositionDp(char* text, int textLen, int index, int* dp){ + char ch = text[index]; + int result = 1; + + for (int i = 0; i < (textLen - 2 * index) / 2; i++){ + if (ch == text[textLen - 1 - index - i] + && equalSubstrings(text, index, textLen - 1 - index - i, i + 1)){ + return max(result, 2 + longestDecompositionDpCached(text, textLen, index + i + 1, dp)); + } + } + + return result; +} + +// Dynamic programming. Up -> down approach. +// Runtime: O(n*n) +// Space: O(n) +int longestDecomposition(char * text){ + int textLen = strlen(text); + int* dp = calloc(textLen, sizeof(int)); + int result = longestDecompositionDpCached(text, textLen, 0, dp); + + free(dp); + return result; +} From 103361de543902df1a63c991e0774c1a455e72fd Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 20 Jan 2023 08:09:32 +0400 Subject: [PATCH 085/156] feat: add Keys and Rooms LeetCode problem (#1189) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/841.c | 27 +++++++++++++++++++++++++++ 2 files changed, 28 insertions(+) create mode 100644 leetcode/src/841.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 9288471e1f..3392c183bb 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -95,6 +95,7 @@ | 709 | [To Lower Case](https://leetcode.com/problems/to-lower-case/) | [C](./src/709.c) | Easy | | 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones/) | [C](./src/771.c) | Easy | | 807 | [Max Increase to Keep City Skyline](https://leetcode.com/problems/max-increase-to-keep-city-skyline/description/) | [C](./src/807.c) | Medium | +| 841 | [Keys and Rooms](https://leetcode.com/problems/keys-and-rooms/description/) | [C](./src/841.c) | Medium | | 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array/) | [C](./src/852.c) | Easy | | 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list/) | [C](./src/876.c) | Easy | | 901 | [Online Stock Span](https://leetcode.com/problems/online-stock-span/) | [C](./src/901.c) | Medium | diff --git a/leetcode/src/841.c b/leetcode/src/841.c new file mode 100644 index 0000000000..cae224887e --- /dev/null +++ b/leetcode/src/841.c @@ -0,0 +1,27 @@ +void visitRooms(int key, int** rooms, int roomsSize, int* roomsColSize, int* visitedRooms){ + if (visitedRooms[key] == 1){ + return; + } + + visitedRooms[key] = 1; + for (int i = 0; i < roomsColSize[key]; i++){ + visitRooms(rooms[key][i], rooms, roomsSize, roomsColSize, visitedRooms); + } +} + +// Depth-first search +// Runtime: O(n) +// Space: O(n) +bool canVisitAllRooms(int** rooms, int roomsSize, int* roomsColSize){ + int* visitedRooms = calloc(roomsSize, sizeof(int)); + visitRooms(0, rooms, roomsSize, roomsColSize, visitedRooms); + + int visitedRoomsNumber = 0; + for (int i = 0; i < roomsSize; i++){ + if (visitedRooms[i] == 1){ + visitedRoomsNumber++; + } + } + + return visitedRoomsNumber == roomsSize; +} From e68296c07c030c7969338807195c1b4ae7172918 Mon Sep 17 00:00:00 2001 From: Sindhu Inti <89198083+Sindhuinti@users.noreply.github.com> Date: Fri, 20 Jan 2023 09:59:34 +0530 Subject: [PATCH 086/156] feat: add delete the Middle Node of a Linked List solution (#1023) * feat:leetcode Delete the Middle Node of a Linked List solution (2095) * Update README.md * Update README.md * Update DIRECTORY.md Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/README.md | 2 +- leetcode/src/2095.c | 38 ++++++++++++++++++++++++++++++++++++++ 3 files changed, 40 insertions(+), 1 deletion(-) create mode 100644 leetcode/src/2095.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 3392c183bb..b0e2e764f5 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -120,6 +120,7 @@ | 1704 | [Determine if String Halves Are Alike](Determine if String Halves Are Alike) | [C](./src/1704.c) | Easy | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | +| 2095 | [Delete the Middle Node of a Linked List](https://leetcode.com/problems/delete-the-middle-node-of-a-linked-list/) | [C](./src/2095.c) | Medium | | 2125 | [Number of Laser Beams in a Bank](https://leetcode.com/problems/number-of-laser-beams-in-a-bank/description/) | [C](./src/2125.c) | Medium | | 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | | 2222 | [Number of Ways to Select Buildings](https://leetcode.com/problems/number-of-ways-to-select-buildings/) | [C](./src/2222.c) | Medium | diff --git a/leetcode/README.md b/leetcode/README.md index 53931eaf90..47c2b5836e 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -74,4 +74,4 @@ git push origin solution/your-solution-name:solution/your-solution-name 4. You're done now! You just have to make a [**pull request**](https://github.com/TheAlgorithms/C/compare). 🎉 -If you need any help, don't hesitate to ask and join our [**Discord server**](https://the-algorithms.com/discord)! 🙂 \ No newline at end of file +If you need any help, don't hesitate to ask and join our [**Discord server**](https://the-algorithms.com/discord)! 🙂 diff --git a/leetcode/src/2095.c b/leetcode/src/2095.c new file mode 100644 index 0000000000..196b0892a7 --- /dev/null +++ b/leetcode/src/2095.c @@ -0,0 +1,38 @@ +/** + * Definition for singly-linked list. + * struct ListNode { + * int val; + * struct ListNode *next; + * }; + */ + +struct ListNode* deleteMiddle(struct ListNode* head) +{ + if (head == NULL || head->next == NULL) + return NULL; + struct ListNode *fast, *slow, *prev; + int n = 0; + fast = head; + slow = head; + while (fast != NULL) + { + n = n + 1; + fast = fast->next; + } + fast = head; + while (fast->next != NULL && fast->next->next != NULL) // finds mid node + { + prev = slow; + slow = slow->next; + fast = fast->next->next; + } + if (n % 2 == 0) + { + prev = slow; + slow = slow->next; + prev->next = slow->next; + } + else + prev->next = slow->next; + return head; +} From 60a0c5947d4fa9d2d5851d8e6a04b184a3703b54 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 20 Jan 2023 08:43:10 +0400 Subject: [PATCH 087/156] feat: add Difference Between Ones and Zeros in Row and Column (#1183) * add leetcode Difference Between Ones and Zeros in Row and Column * Update leetcode/DIRECTORY.md Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/2482.c | 42 ++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 43 insertions(+) create mode 100644 leetcode/src/2482.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index b0e2e764f5..da68aa6ab4 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -127,4 +127,5 @@ | 2256 | [Minimum Average Difference](https://leetcode.com/problems/minimum-average-difference/) | [C](./src/2256.c) | Medium | | 2270 | [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array/) | [C](./src/2270.c) | Medium | | 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | +| 2482 | [Difference Between Ones and Zeros in Row and Column](https://leetcode.com/problems/difference-between-ones-and-zeros-in-row-and-column/description/) | [C](./src/2482.c) | Medium | | 2501 | [Longest Square Streak in an Array](https://leetcode.com/problems/longest-square-streak-in-an-array/description/) | [C](./src/2501.c) | Medium | diff --git a/leetcode/src/2482.c b/leetcode/src/2482.c new file mode 100644 index 0000000000..df9f702dec --- /dev/null +++ b/leetcode/src/2482.c @@ -0,0 +1,42 @@ +/** + * Return an array of arrays of size *returnSize. + * The sizes of the arrays are returned as *returnColumnSizes array. + * Note: Both returned array and *columnSizes array must be malloced, assume caller calls free(). + */ + +// Calculating ones on each row and column. +// Runtime: O(n * m) +// Space: O(n + m) +int** onesMinusZeros(int** grid, int gridSize, int* gridColSize, int* returnSize, int** returnColumnSizes){ + int n = gridSize; + int m = gridColSize[0]; + + int** result = malloc(gridSize * sizeof(int*)); + for (int i = 0; i < n; i++){ + result[i] = malloc(m * sizeof(int)); + } + + int* onesRows = calloc(n, sizeof(int)); + int* onesCols = calloc(m, sizeof(int)); + for (int i = 0; i < n; i++){ + for (int j = 0; j < m; j++){ + if (grid[i][j] == 1){ + onesRows[i] += 1; + onesCols[j] += 1; + } + } + } + + for (int i = 0; i < gridSize; i++){ + for (int j = 0; j < gridColSize[i]; j++){ + result[i][j] = onesRows[i] + onesCols[j] - (m - onesRows[i]) - (n - onesCols[j]); + } + } + + free(onesRows); + free(onesCols); + + *returnSize = gridSize; + *returnColumnSizes = gridColSize; + return result; +} From b819ddf3e60d3d287e4ea8bffc324837c98d465b Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 21 Jan 2023 01:42:23 +0400 Subject: [PATCH 088/156] feat: add Frequency of the Most Frequent Element (#1195) * add leetcode Frequency of the Most Frequent Element * Update 1838.c small fix * Update leetcode/src/1838.c Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/1838.c | 36 ++++++++++++++++++++++++++++++++++++ 2 files changed, 37 insertions(+) create mode 100644 leetcode/src/1838.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index da68aa6ab4..195140b43e 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -118,6 +118,7 @@ | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | | 1653 | [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced/) | [C](./src/1653.c) | Medium | | 1704 | [Determine if String Halves Are Alike](Determine if String Halves Are Alike) | [C](./src/1704.c) | Easy | +| 1838 | [Frequency of the Most Frequent Element](https://leetcode.com/problems/frequency-of-the-most-frequent-element/) | [C](./src/1838.c) | Medium | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | | 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | | 2095 | [Delete the Middle Node of a Linked List](https://leetcode.com/problems/delete-the-middle-node-of-a-linked-list/) | [C](./src/2095.c) | Medium | diff --git a/leetcode/src/1838.c b/leetcode/src/1838.c new file mode 100644 index 0000000000..fe4469bf3b --- /dev/null +++ b/leetcode/src/1838.c @@ -0,0 +1,36 @@ +#define max(a,b) (((a)>(b))?(a):(b)) + +int compare(const int* i, const int* j) +{ + return *i - *j; +} + +// Sort + prefix sum + windows sliding +// Runtime: O(n*log(n)) +// Space: O(n) +int maxFrequency(int* nums, int numsSize, int k){ + qsort(nums, numsSize, sizeof (int), (int(*) (const void*, const void*)) compare); + long* prefixSum = malloc(numsSize * sizeof(long)); + + prefixSum[0] = nums[0]; + for(int i = 0; i < numsSize - 1; i++){ + prefixSum[i + 1] = prefixSum[i] + nums[i]; + } + + int leftWindowPosition = 0; + int result = 0; + + for(int rightWindowPosition = 0; rightWindowPosition < numsSize; rightWindowPosition++){ + long rightSum = prefixSum[rightWindowPosition]; + long leftSum = prefixSum[leftWindowPosition]; + + while ((long)nums[rightWindowPosition] * (rightWindowPosition - leftWindowPosition) - (rightSum - leftSum) > k){ + leftWindowPosition += 1; + } + + result = max(result, rightWindowPosition - leftWindowPosition + 1); + } + + free(prefixSum); + return result; +} From 73913ac4a8e5808eeae96d94fb4cc988f699aa99 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 21 Jan 2023 03:39:35 +0400 Subject: [PATCH 089/156] feat: add Find the Smallest Divisor Given a Threshold (#1175) * add leetcode Find the Smallest Divisor Given a Threshold * Update leetcode/DIRECTORY.md Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/1283.c | 44 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 45 insertions(+) create mode 100644 leetcode/src/1283.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 195140b43e..f8207684ac 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -113,6 +113,7 @@ | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | +| 1283 | [Find the Smallest Divisor Given a Threshold]https://leetcode.com/problems/find-the-smallest-divisor-given-a-threshold/description/) | [C](./src/1283.c) | Medium | | 1695 | [Maximum Erasure Value](https://leetcode.com/problems/maximum-erasure-value/) | [C](./src/1695.c) | Medium | | 1769 | [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box/) | [C](./src/1769.c) | Medium | | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | diff --git a/leetcode/src/1283.c b/leetcode/src/1283.c new file mode 100644 index 0000000000..ccdf9e2980 --- /dev/null +++ b/leetcode/src/1283.c @@ -0,0 +1,44 @@ +#define max(a,b) (((a)>(b))?(a):(b)) + +long getSum(int* nums, int numsSize, int divizor){ + long result = 0; + for (int i = 0; i < numsSize; i++){ + int value = nums[i] / divizor; + if (value * divizor != nums[i]){ + value++; + } + + result += value; + } + + return result; +} + +// Divide and conquer +// Runtime: O(n*log(n)) +// Space: O(1) +int smallestDivisor(int* nums, int numsSize, int threshold){ + int maxNum = 0; + for (int i = 0; i < numsSize; i++){ + maxNum = max(maxNum, nums[i]); + } + + int left = 1; + int right = maxNum; + while (left <= right){ + int middle = (left + right) / 2; + long middleSum = getSum(nums, numsSize, middle); + if (middleSum <= threshold && (middle == 1 || getSum(nums, numsSize, middle - 1) > threshold)){ + return middle; + } + + if (middleSum > threshold){ + left = middle + 1; + } + else{ + right = middle - 1; + } + } + + return -1; +} From b98296e02fcf0dbd6c3e1ea17def57f94638aebb Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 21 Jan 2023 03:46:02 +0400 Subject: [PATCH 090/156] feat: add Determine if Two Strings Are Close (#1192) * add leetcode Determine if Two Strings Are Close * Update 1657.c add comments * Update leetcode/src/1657.c Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/1657.c | 51 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 52 insertions(+) create mode 100644 leetcode/src/1657.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index f8207684ac..0918a6232d 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -114,6 +114,7 @@ | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | | 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | | 1283 | [Find the Smallest Divisor Given a Threshold]https://leetcode.com/problems/find-the-smallest-divisor-given-a-threshold/description/) | [C](./src/1283.c) | Medium | +| 1657 | [Determine if Two Strings Are Close](https://leetcode.com/problems/determine-if-two-strings-are-close/description/) | [C](./src/1657.c) | Medium | | 1695 | [Maximum Erasure Value](https://leetcode.com/problems/maximum-erasure-value/) | [C](./src/1695.c) | Medium | | 1769 | [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box/) | [C](./src/1769.c) | Medium | | 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | diff --git a/leetcode/src/1657.c b/leetcode/src/1657.c new file mode 100644 index 0000000000..10aa60d258 --- /dev/null +++ b/leetcode/src/1657.c @@ -0,0 +1,51 @@ +const charLength = 26; + +int* charsCount(char* word){ + int* result = calloc(charLength, sizeof(int)); + int wordLen = strlen(word); + for (int i = 0; i < wordLen; i++){ + result[word[i] - 'a']++; + } + + return result; +} + +int diff(const int *i, const int *j) +{ + return *i - *j; +} + +// Counting +// Runtime: O(n) +// Space: O(1) +bool closeStrings(char * word1, char * word2){ + int* word1CharsCounter = charsCount(word1); + int* word2CharsCounter = charsCount(word2); + + // The lengths of both string should be equal + if (strlen(word1) != strlen(word2)){ + return false; + } + + // The char should appear in both strings + for (int i = 0; i < charLength; i++){ + if ((word1CharsCounter[i] != 0 && word2CharsCounter[i] == 0) || + (word1CharsCounter[i] == 0 && word2CharsCounter[i] != 0)){ + return false; + } + } + + qsort(word1CharsCounter, charLength, sizeof (int), (int(*) (const void *, const void *)) diff); + qsort(word2CharsCounter, charLength, sizeof (int), (int(*) (const void *, const void *)) diff); + + // appearing of chars should be the same in both strings. + for (int i = 0; i < charLength; i++){ + if (word1CharsCounter[i] != word2CharsCounter[i]){ + return false; + } + } + + free(word1CharsCounter); + free(word2CharsCounter); + return true; +} From 17b7131873dbbe1fdad26b750eeea14e6944f982 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 21 Jan 2023 03:48:26 +0400 Subject: [PATCH 091/156] add leetcode Maximum Bags With Full Capacity of Rocks (#1196) * add leetcode Maximum Bags With Full Capacity of Rocks * Update leetcode/src/2279.c Co-authored-by: David Leal * Update leetcode/src/2279.c Co-authored-by: David Leal * Update leetcode/src/2279.c Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/2279.c | 29 +++++++++++++++++++++++++++++ 2 files changed, 30 insertions(+) create mode 100644 leetcode/src/2279.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 0918a6232d..f37d64fcd4 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -129,6 +129,7 @@ | 2222 | [Number of Ways to Select Buildings](https://leetcode.com/problems/number-of-ways-to-select-buildings/) | [C](./src/2222.c) | Medium | | 2256 | [Minimum Average Difference](https://leetcode.com/problems/minimum-average-difference/) | [C](./src/2256.c) | Medium | | 2270 | [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array/) | [C](./src/2270.c) | Medium | +| 2279 | [Maximum Bags With Full Capacity of Rocks](https://leetcode.com/problems/maximum-bags-with-full-capacity-of-rocks/) | [C](./src/2279.c) | Medium | | 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | | 2482 | [Difference Between Ones and Zeros in Row and Column](https://leetcode.com/problems/difference-between-ones-and-zeros-in-row-and-column/description/) | [C](./src/2482.c) | Medium | | 2501 | [Longest Square Streak in an Array](https://leetcode.com/problems/longest-square-streak-in-an-array/description/) | [C](./src/2501.c) | Medium | diff --git a/leetcode/src/2279.c b/leetcode/src/2279.c new file mode 100644 index 0000000000..8dc05d981e --- /dev/null +++ b/leetcode/src/2279.c @@ -0,0 +1,29 @@ +int compare(const int* i, const int* j) +{ + return *i - *j; +} + +// Sorting. +// Runtime: O(n*log(n)) +// Space: O(n) +int maximumBags(int* capacity, int capacitySize, int* rocks, int rocksSize, int additionalRocks) { + int* capacityLeft = malloc(capacitySize * sizeof(int)); + for (int i = 0; i < capacitySize; i++) { + capacityLeft[i] = capacity[i] - rocks[i]; + } + + qsort(capacityLeft, capacitySize, sizeof (int), (int(*) (const void*, const void*)) compare); + + int bags = 0; + for (int i = 0; i < capacitySize; i++) { + if (additionalRocks < capacityLeft[i]){ + break; + } + + additionalRocks -= capacityLeft[i]; + bags++; + } + + free(capacityLeft); + return bags; +} From a680c83b838468c6cffd3dd95945828d47795d36 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 21 Jan 2023 03:49:15 +0400 Subject: [PATCH 092/156] feat: add Maximum Ice Cream Bars (#1197) Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/1833.c | 24 ++++++++++++++++++++++++ 2 files changed, 25 insertions(+) create mode 100644 leetcode/src/1833.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index f37d64fcd4..972d814313 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -122,6 +122,7 @@ | 1704 | [Determine if String Halves Are Alike](Determine if String Halves Are Alike) | [C](./src/1704.c) | Easy | | 1838 | [Frequency of the Most Frequent Element](https://leetcode.com/problems/frequency-of-the-most-frequent-element/) | [C](./src/1838.c) | Medium | | 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | +| 1833 | [Maximum Ice Cream Bars](https://leetcode.com/problems/maximum-ice-cream-bars/) | [C](./src/1833.c) | Medium | | 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | | 2095 | [Delete the Middle Node of a Linked List](https://leetcode.com/problems/delete-the-middle-node-of-a-linked-list/) | [C](./src/2095.c) | Medium | | 2125 | [Number of Laser Beams in a Bank](https://leetcode.com/problems/number-of-laser-beams-in-a-bank/description/) | [C](./src/2125.c) | Medium | diff --git a/leetcode/src/1833.c b/leetcode/src/1833.c new file mode 100644 index 0000000000..e77d8a2921 --- /dev/null +++ b/leetcode/src/1833.c @@ -0,0 +1,24 @@ +int compare(const void* i, const void* j) +{ + return *((int*)i) - *((int*)j); +} + +// Greedy + sorting +// Runtime: O(n*log(n)) +// Space: O(1) +int maxIceCream(int* costs, int costsSize, int coins){ + qsort(costs, costsSize, sizeof(int), compare); + + int result = 0; + int leftCoins = coins; + for (int i = 0; i < costsSize; i++){ + if (costs[i] > leftCoins){ + break; + } + + leftCoins -= costs[i]; + result++; + } + + return result; +} From 5ac30afa86fa13290d048897e023423b2fec72b2 Mon Sep 17 00:00:00 2001 From: Satvik <115653938+satvik202@users.noreply.github.com> Date: Sat, 21 Jan 2023 05:20:49 +0530 Subject: [PATCH 093/156] feat: add LeetCode problem 75 (#1113) * added leetcode problem 75 * Update 75.c resolved issues * Update 75.c * updating DIRECTORY.md * Update 75.c Removed the header file * chore: apply suggestions from code review Co-authored-by: Taj * updating DIRECTORY.md Co-authored-by: David Leal Co-authored-by: Taj Co-authored-by: github-actions[bot] --- DIRECTORY.md | 15 +++++++++++++++ leetcode/DIRECTORY.md | 1 + leetcode/src/75.c | 24 ++++++++++++++++++++++++ 3 files changed, 40 insertions(+) create mode 100644 leetcode/src/75.c diff --git a/DIRECTORY.md b/DIRECTORY.md index fcfd8ab04e..aa6a378e85 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -172,6 +172,7 @@ * [1009](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1009.c) * [101](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/101.c) * [1019](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1019.c) + * [1026](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1026.c) * [104](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/104.c) * [108](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/108.c) * [1089](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1089.c) @@ -179,6 +180,7 @@ * [11](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/11.c) * [110](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/110.c) * [112](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/112.c) + * [1147](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1147.c) * [118](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/118.c) * [1184](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1184.c) * [1189](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1189.c) @@ -187,6 +189,7 @@ * [1207](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1207.c) * [121](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/121.c) * [125](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/125.c) + * [1283](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1283.c) * [13](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/13.c) * [136](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/136.c) * [14](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/14.c) @@ -196,12 +199,15 @@ * [153](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/153.c) * [160](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/160.c) * [1653](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1653.c) + * [1657](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1657.c) * [169](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/169.c) * [1695](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1695.c) * [1704](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1704.c) * [173](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/173.c) * [1752](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1752.c) * [1769](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1769.c) + * [1833](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1833.c) + * [1838](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1838.c) * [189](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/189.c) * [190](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/190.c) * [191](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/191.c) @@ -211,7 +217,9 @@ * [2024](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2024.c) * [203](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/203.c) * [206](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/206.c) + * [2095](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2095.c) * [21](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/21.c) + * [2125](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2125.c) * [2130](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2130.c) * [215](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/215.c) * [217](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/217.c) @@ -220,6 +228,7 @@ * [2256](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2256.c) * [226](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/226.c) * [2270](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2270.c) + * [2279](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2279.c) * [230](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/230.c) * [2304](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2304.c) * [231](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/231.c) @@ -227,6 +236,8 @@ * [236](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/236.c) * [24](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/24.c) * [242](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/242.c) + * [2482](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2482.c) + * [2501](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2501.c) * [26](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/26.c) * [268](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/268.c) * [27](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/27.c) @@ -264,23 +275,27 @@ * [66](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/66.c) * [669](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/669.c) * [674](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/674.c) + * [684](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/684.c) * [7](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/7.c) * [700](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/700.c) * [701](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/701.c) * [704](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/704.c) * [709](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/709.c) + * [75](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/75.c) * [771](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/771.c) * [79](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/79.c) * [8](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/8.c) * [807](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/807.c) * [82](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/82.c) * [83](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/83.c) + * [841](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/841.c) * [852](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/852.c) * [876](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/876.c) * [9](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/9.c) * [901](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/901.c) * [905](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/905.c) * [917](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/917.c) + * [931](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/931.c) * [938](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/938.c) * [94](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/94.c) * [965](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/965.c) diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 972d814313..132469e0ea 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -32,6 +32,7 @@ | 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | | 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | [C](./src/62.c) | Medium | | 66 | [Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c) | Easy | +| 75 | [Sort Colors](https://leetcode.com/problems/sort-colors/) | [C](./src/75.c) | Medium | | 79 | [Word Search](https://leetcode.com/problems/word-search/) | [C](./src/79.c) | Medium | | 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c) | Medium | | 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list/) | [C](./src/83.c) | Easy | diff --git a/leetcode/src/75.c b/leetcode/src/75.c new file mode 100644 index 0000000000..2cf402f2c8 --- /dev/null +++ b/leetcode/src/75.c @@ -0,0 +1,24 @@ +void swap(int *x, int *y){ + if (x==y) + return; + *x = *x + *y; + *y= *x - *y; + *x= *x - *y; +} + +void sortColors(int* arr, int n){ + int start=0, mid=0, end=n-1; + while(mid<=end){ + if(arr[mid]==1) + mid++; + else if(arr[mid]==0){ + swap(&arr[mid],&arr[start]); + mid++; + start++; + } + else{ + swap(&arr[mid],&arr[end]); + end--; + } + } +} From 74ef8f5806d4a87de3a577847a9bc7857c208963 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sun, 22 Jan 2023 04:42:07 +0400 Subject: [PATCH 094/156] feat: add Binary Tree Maximum Path Sum (#1179) * add leetcode Binary Tree Maximum Path Sum * Update leetcode/src/124.c Co-authored-by: Taj Co-authored-by: David Leal Co-authored-by: Taj --- leetcode/DIRECTORY.md | 1 + leetcode/src/124.c | 36 ++++++++++++++++++++++++++++++++++++ 2 files changed, 37 insertions(+) create mode 100644 leetcode/src/124.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 132469e0ea..a574736ec0 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -46,6 +46,7 @@ | 112 | [Path Sum](https://leetcode.com/problems/path-sum/) | [C](./src/112.c) | Easy | | 118 | [Pascal's Triangle](https://leetcode.com/problems/pascals-triangle/) | [C](./src/118.c) | Easy | | 121 | [Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock/) | [C](./src/121.c) | Easy | +| 124 | [Binary Tree Maximum Path Sum](https://leetcode.com/problems/binary-tree-maximum-path-sum/description/) | [C](./src/124.c) | Hard | | 125 | [Valid Palindrome](https://leetcode.com/problems/valid-palindrome/) | [C](./src/125.c) | Easy | | 136 | [Single Number](https://leetcode.com/problems/single-number/) | [C](./src/136.c) | Easy | | 141 | [Linked List Cycle](https://leetcode.com/problems/linked-list-cycle/) | [C](./src/141.c) | Easy | diff --git a/leetcode/src/124.c b/leetcode/src/124.c new file mode 100644 index 0000000000..a846dfcb44 --- /dev/null +++ b/leetcode/src/124.c @@ -0,0 +1,36 @@ +/** + * Definition for a binary tree node. + * struct TreeNode { + * int val; + * struct TreeNode *left; + * struct TreeNode *right; + * }; + */ + +#define max(a,b) (((a)>(b))?(a):(b)) + +int recursiveSolve(struct TreeNode* node, int* result){ + if (node == NULL){ + return 0; + } + + int leftSum = max(recursiveSolve(node->left, result), 0); + int rightSum = max(recursiveSolve(node->right, result), 0); + + // Check if it's possible to make a maximum path from left right and current node + int maxValueNode = node->val + leftSum + rightSum; + *result = max(maxValueNode, *result); + + // Choose the max sum val path + return node->val + max(leftSum, rightSum); +} + +// Depth First Search +// Runtime: O(n), n - the number of nodes in tree. +// Space: O(1) +int maxPathSum(struct TreeNode* root){ + const int LOWER_BOUND = -2147483648 + int result = LOWER_BOUND; + recursiveSolve(root, &result); + return result; +} From 90d7d8180743a6f78b3206bc1756c06deb3bac2b Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Mon, 23 Jan 2023 21:24:50 +0400 Subject: [PATCH 095/156] feat: Add LeetCode directory writer (#1187) * add leetcode_directory_writer * updating DIRECTORY.md * Update leetcode_directory_md.py add script header * updating DIRECTORY.md * updating DIRECTORY.md * Update .github/workflows/leetcode_directory_writer.yml Co-authored-by: David Leal * Update .github/workflows/leetcode_directory_writer.yml Co-authored-by: David Leal * Update .github/workflows/leetcode_directory_writer.yml Co-authored-by: David Leal * Update .github/workflows/leetcode_directory_writer.yml Co-authored-by: David Leal * Update .github/workflows/leetcode_directory_writer.yml Co-authored-by: David Leal * updating DIRECTORY.md * Update .github/workflows/leetcode_directory_writer.yml Co-authored-by: David Leal * updating DIRECTORY.md * Update .github/workflows/leetcode_directory_writer.yml Co-authored-by: David Leal * updating DIRECTORY.md * updating DIRECTORY.md * Update .github/workflows/leetcode_directory_writer.yml Co-authored-by: Taj * Update scripts/leetcode_directory_md.py Co-authored-by: Taj * Update scripts/leetcode_directory_md.py Co-authored-by: Taj * Update scripts/leetcode_directory_md.py Co-authored-by: Taj * fix formating * updating DIRECTORY.md * updating DIRECTORY.md Co-authored-by: github-actions <${GITHUB_ACTOR}@users.noreply.github.com> Co-authored-by: David Leal Co-authored-by: github-actions[bot] Co-authored-by: Taj --- .../workflows/leetcode_directory_writer.yml | 30 ++ leetcode/DIRECTORY.md | 274 +++++++++--------- scripts/leetcode_directory_md.py | 124 ++++++++ 3 files changed, 294 insertions(+), 134 deletions(-) create mode 100644 .github/workflows/leetcode_directory_writer.yml create mode 100644 scripts/leetcode_directory_md.py diff --git a/.github/workflows/leetcode_directory_writer.yml b/.github/workflows/leetcode_directory_writer.yml new file mode 100644 index 0000000000..16cb656b98 --- /dev/null +++ b/.github/workflows/leetcode_directory_writer.yml @@ -0,0 +1,30 @@ +# The objective of this GitHub Action is to update the leetcode DIRECTORY.md file (if needed) +# when doing a git push +name: leetcode_directory_writer +on: + push: + paths: + - "leetcode/src/**.c" +jobs: + build: + runs-on: ubuntu-latest + steps: + - uses: actions/checkout@v3 + with: + fetch-depth: 0 + - uses: actions/setup-python@v4 + with: + python-version: 3.x + - name: Add python dependencies + run: | + pip install requests + - name: Write leectode DIRECTORY.md + run: | + python3 scripts/leetcode_directory_md.py 2>&1 | tee leetcode/DIRECTORY.md + git config --global user.name github-actions[bot] + git config --global user.email 'github-actions@users.noreply.github.com' + - name: Update LeetCode's directory + run: | + git add leetcode/DIRECTORY.md + git commit -am "updating DIRECTORY.md" || true + git push origin HEAD:$GITHUB_REF || true diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index a574736ec0..5fee0e8a88 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -1,138 +1,144 @@ + # LeetCode ### LeetCode Algorithm -| # | Title | Solution | Difficulty | -| ---- | ------------------------------------------------------------------------------------------------------------------------------- | ----------------- | ---------- | -| 1 | [Two Sum](https://leetcode.com/problems/two-sum/) | [C](./src/1.c) | Easy | -| 2 | [Add Two Numbers](https://leetcode.com/problems/add-two-numbers/) | [C](./src/2.c) | Medium | -| 3 | [Longest Substring Without Repeating Characters](https://leetcode.com/problems/longest-substring-without-repeating-characters/) | [C](./src/3.c) | Medium | -| 4 | [Median of Two Sorted Arrays](https://leetcode.com/problems/median-of-two-sorted-arrays/) | [C](./src/4.c) | Hard | -| 6 | [ZigZag conversion](https://leetcode.com/problems/zigzag-conversion/) | [C](./src/4.c) | Medium | -| 7 | [Reverse Integer](https://leetcode.com/problems/reverse-integer/) | [C](./src/7.c) | Easy | -| 8 | [String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c) | Medium | -| 9 | [Palindrome Number](https://leetcode.com/problems/palindrome-number/) | [C](./src/9.c) | Easy | -| 10 | [Regular Expression Matching](https://leetcode.com/problems/regular-expression-matching/) | [C](./src/10.c) | Hard | -| 11 | [Container With Most Water](https://leetcode.com/problems/container-with-most-water/) | [C](./src/11.c) | Medium | -| 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | -| 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer/) | [C](./src/13.c) | Easy | -| 14 | [Max Consecutive Ones](https://leetcode.com/problems/max-consecutive-ones/) | [C](./src/14.c) | Easy | -| 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses/) | [C](./src/20.c) | Easy | -| 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists/) | [C](./src/21.c) | Easy | -| 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs/) | [C](./src/24.c) | Medium | -| 26 | [Remove Duplicates from Sorted Array](https://leetcode.com/problems/remove-duplicates-from-sorted-array/) | [C](./src/26.c) | Easy | -| 27 | [Remove Element](https://leetcode.com/problems/remove-element/) | [C](./src/27.c) | Easy | -| 28 | [Implement strStr()](https://leetcode.com/problems/implement-strstr/) | [C](./src/28.c) | Easy | -| 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers/) | [C](./src/29.c) | Medium | -| 32 | [Longest Valid Parentheses](https://leetcode.com/problems/longest-valid-parentheses/) | [C](./src/32.c) | Hard | -| 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position/) | [C](./src/35.c) | Easy | -| 37 | [Sudoku Solver](https://leetcode.com/problems/sudoku-solver/) | [C](./src/37.c) | Hard | -| 38 | [Count and Say](https://leetcode.com/problems/count-and-say/) | [C](./src/38.c) | Easy | -| 42 | [Trapping Rain Water](https://leetcode.com/problems/trapping-rain-water/) | [C](./src/42.c) | Hard | -| 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray/) | [C](./src/53.c) | Easy | -| 62 | [Unique Paths](https://leetcode.com/problems/unique-paths/description/) | [C](./src/62.c) | Medium | -| 66 | [Plus One](https://leetcode.com/problems/plus-one/) | [C](./src/66.c) | Easy | -| 75 | [Sort Colors](https://leetcode.com/problems/sort-colors/) | [C](./src/75.c) | Medium | -| 79 | [Word Search](https://leetcode.com/problems/word-search/) | [C](./src/79.c) | Medium | -| 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii/) | [C](./src/82.c) | Medium | -| 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list/) | [C](./src/83.c) | Easy | -| 94 | [Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal/) | [C](./src/94.c) | Medium | -| 98 | [Validate Binary Search Tree](https://leetcode.com/problems/validate-binary-search-tree/) | [C](./src/98.c) | Medium | -| 101 | [Symmetric Tree](https://leetcode.com/problems/symmetric-tree/) | [C](./src/101.c) | Easy | -| 104 | [Maximum Depth of Binary Tree](https://leetcode.com/problems/maximum-depth-of-binary-tree/) | [C](./src/104.c) | Easy | -| 108 | [Convert Sorted Array to Binary Search Tree](https://leetcode.com/problems/convert-sorted-array-to-binary-search-tree/) | [C](./src/108.c) | Easy | -| 109 | [Convert Sorted List to Binary Search Tree](https://leetcode.com/problems/convert-sorted-list-to-binary-search-tree/) | [C](./src/109.c) | Medium | -| 110 | [Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree/) | [C](./src/110.c) | Easy | -| 112 | [Path Sum](https://leetcode.com/problems/path-sum/) | [C](./src/112.c) | Easy | -| 118 | [Pascal's Triangle](https://leetcode.com/problems/pascals-triangle/) | [C](./src/118.c) | Easy | -| 121 | [Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock/) | [C](./src/121.c) | Easy | -| 124 | [Binary Tree Maximum Path Sum](https://leetcode.com/problems/binary-tree-maximum-path-sum/description/) | [C](./src/124.c) | Hard | -| 125 | [Valid Palindrome](https://leetcode.com/problems/valid-palindrome/) | [C](./src/125.c) | Easy | -| 136 | [Single Number](https://leetcode.com/problems/single-number/) | [C](./src/136.c) | Easy | -| 141 | [Linked List Cycle](https://leetcode.com/problems/linked-list-cycle/) | [C](./src/141.c) | Easy | -| 142 | [Linked List Cycle II](https://leetcode.com/problems/linked-list-cycle-ii/) | [C](./src/142.c) | Medium | -| 153 | [Find Minimum in Rotated Sorted Array](https://leetcode.com/problems/find-minimum-in-rotated-sorted-array/) | [C](./src/153.c) | Medium | -| 160 | [Intersection of Two Linked Lists](https://leetcode.com/problems/intersection-of-two-linked-lists/) | [C](./src/160.c) | Easy | -| 169 | [Majority Element](https://leetcode.com/problems/majority-element/) | [C](./src/169.c) | Easy | -| 173 | [Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator/) | [C](./src/173.c) | Medium | -| 189 | [Rotate Array](https://leetcode.com/problems/rotate-array) | [C](./src/189.c) | Easy | -| 190 | [Reverse Bits](https://leetcode.com/problems/reverse-bits/) | [C](./src/190.c) | Easy | -| 191 | [Number of 1 Bits](https://leetcode.com/problems/number-of-1-bits/) | [C](./src/191.c) | Easy | -| 201 | [Bitwise AND of Numbers Range](https://leetcode.com/problems/bitwise-and-of-numbers-range/) | [C](./src/201.c) | Medium | -| 203 | [Remove Linked List Elements](https://leetcode.com/problems/remove-linked-list-elements/) | [C](./src/203.c) | Easy | -| 206 | [Reverse Linked List](https://leetcode.com/problems/reverse-linked-list/) | [C](./src/206.c) | Easy | -| 215 | [Kth Largest Element in an Array](https://leetcode.com/problems/kth-largest-element-in-an-array/) | [C](./src/215.c) | Medium | -| 217 | [Contains Duplicate](https://leetcode.com/problems/contains-duplicate/) | [C](./src/217.c) | Easy | -| 223 | [Rectangle Area](https://leetcode.com/problems/rectangle-area/) | [C](./src/223.c) | Medium | -| 226 | [Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree/) | [C](./src/226.c) | Easy | -| 230 | [Kth Smallest Element in a BST](https://leetcode.com/problems/kth-smallest-element-in-a-bst/) | [C](./src/230.c) | Medium | -| 231 | [Power of Two](https://leetcode.com/problems/power-of-two/) | [C](./src/231.c) | Easy | -| 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list/) | [C](./src/234.c) | Easy | -| 236 | [Lowest Common Ancestor of a Binary Tree](https://leetcode.com/problems/lowest-common-ancestor-of-a-binary-tree/) | [C](./src/236.c) | Medium | -| 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram/) | [C](./src/242.c) | Easy | -| 268 | [Missing Number](https://leetcode.com/problems/missing-number/) | [C](./src/268.c) | Easy | -| 274 | [H-Index](https://leetcode.com/problems/h-index/description/) | [C](./src/274.c) | Medium | -| 278 | [First Bad Version](https://leetcode.com/problems/first-bad-version/) | [C](./src/278.c) | Easy | -| 283 | [Move Zeroes](https://leetcode.com/problems/move-zeroes/) | [C](./src/283.c) | Easy | -| 287 | [Find the Duplicate Number](https://leetcode.com/problems/find-the-duplicate-number/) | [C](./src/287.c) | Medium | -| 344 | [Reverse String](https://leetcode.com/problems/reverse-string/) | [C](./src/344.c) | Easy | -| 367 | [Valid Perfect Square](https://leetcode.com/problems/valid-perfect-square/) | [C](./src/367.c) | Easy | -| 387 | [First Unique Character in a String](https://leetcode.com/problems/first-unique-character-in-a-string/) | [C](./src/387.c) | Easy | -| 389 | [Find the Difference](https://leetcode.com/problems/find-the-difference/) | [C](./src/389.c) | Easy | -| 404 | [Sum of Left Leaves](https://leetcode.com/problems/sum-of-left-leaves/) | [C](./src/404.c) | Easy | -| 442 | [Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array/) | [C](./src/442.c) | Medium | -| 461 | [Hamming Distance](https://leetcode.com/problems/hamming-distance/) | [C](./src/461.c) | Easy | -| 476 | [Number Complement](https://leetcode.com/problems/number-complement/) | [C](./src/476.c) | Easy | -| 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number/) | [C](./src/509.c) | Easy | -| 520 | [Detect Capital](https://leetcode.com/problems/detect-capital/) | [C](./src/520.c) | Easy | -| 561 | [Array Partition I](https://leetcode.com/problems/array-partition-i/) | [C](./src/561.c) | Easy | -| 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees/) | [C](./src/617.c) | Easy | -| 647 | [Palindromic Substring](https://leetcode.com/problems/palindromic-substrings/) | [C](./src/647.c) | Medium | -| 669 | [Trim a Binary Search Tree](https://leetcode.com/problems/trim-a-binary-search-tree/) | [C](./src/669.c) | Medium | -| 674 | [Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence/) | [C](./src/674.c) | Easy | -| 684 | [Redundant Connection](https://leetcode.com/problems/redundant-connection/description/) | [C](./src/684.c) | Medium | -| 700 | [Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree/) | [C](./src/700.c) | Easy | -| 701 | [Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree/) | [C](./src/701.c) | Medium | -| 704 | [Binary Search](https://leetcode.com/problems/binary-search/) | [C](./src/704.c) | Easy | -| 709 | [To Lower Case](https://leetcode.com/problems/to-lower-case/) | [C](./src/709.c) | Easy | -| 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones/) | [C](./src/771.c) | Easy | -| 807 | [Max Increase to Keep City Skyline](https://leetcode.com/problems/max-increase-to-keep-city-skyline/description/) | [C](./src/807.c) | Medium | -| 841 | [Keys and Rooms](https://leetcode.com/problems/keys-and-rooms/description/) | [C](./src/841.c) | Medium | -| 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array/) | [C](./src/852.c) | Easy | -| 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list/) | [C](./src/876.c) | Easy | -| 901 | [Online Stock Span](https://leetcode.com/problems/online-stock-span/) | [C](./src/901.c) | Medium | -| 905 | [Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity/) | [C](./src/905.c) | Easy | -| 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters/) | [C](./src/917.c) | Easy | -| 931 | [Minimum Falling Path Sum](https://leetcode.com/problems/minimum-falling-path-sum/description/) | [C](./src/931.c) | Medium | -| 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst/) | [C](./src/938.c) | Easy | -| 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree/) | [C](./src/965.c) | Easy | -| 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array/) | [C](./src/977.c) | Easy | -| 985 | [Sum of Even Numbers After Queries](https://leetcode.com/problems/sum-of-even-numbers-after-queries/) | [C](./src/985.c) | Medium | -| 1009 | [Complement of Base 10 Integer](https://leetcode.com/problems/complement-of-base-10-integer/) | [C](./src/1009.c) | Easy | -| 1026 | [Maximum Difference Between Node and Ancestor](https://leetcode.com/problems/maximum-difference-between-node-and-ancestor/description/) | [C](./src/1026.c) | Medium | -| 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros/) | [C](./src/1089.c) | Easy | -| 1147 | [Longest Chunked Palindrome Decomposition](https://leetcode.com/problems/longest-chunked-palindrome-decomposition/description/) | [C](./src/1147.c) | Hard | -| 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops/) | [C](./src/1184.c) | Easy | -| 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons/) | [C](./src/1189.c) | Easy | -| 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences/) | [C](./src/1207.c) | Easy | -| 1283 | [Find the Smallest Divisor Given a Threshold]https://leetcode.com/problems/find-the-smallest-divisor-given-a-threshold/description/) | [C](./src/1283.c) | Medium | -| 1657 | [Determine if Two Strings Are Close](https://leetcode.com/problems/determine-if-two-strings-are-close/description/) | [C](./src/1657.c) | Medium | -| 1695 | [Maximum Erasure Value](https://leetcode.com/problems/maximum-erasure-value/) | [C](./src/1695.c) | Medium | -| 1769 | [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box/) | [C](./src/1769.c) | Medium | -| 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum/) | [C](./src/1524.c) | Medium | -| 1653 | [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced/) | [C](./src/1653.c) | Medium | -| 1704 | [Determine if String Halves Are Alike](Determine if String Halves Are Alike) | [C](./src/1704.c) | Easy | -| 1838 | [Frequency of the Most Frequent Element](https://leetcode.com/problems/frequency-of-the-most-frequent-element/) | [C](./src/1838.c) | Medium | -| 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated/) | [C](./src/1752.c) | Easy | -| 1833 | [Maximum Ice Cream Bars](https://leetcode.com/problems/maximum-ice-cream-bars/) | [C](./src/1833.c) | Medium | -| 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam/) | [C](./src/2024.c) | Medium | -| 2095 | [Delete the Middle Node of a Linked List](https://leetcode.com/problems/delete-the-middle-node-of-a-linked-list/) | [C](./src/2095.c) | Medium | -| 2125 | [Number of Laser Beams in a Bank](https://leetcode.com/problems/number-of-laser-beams-in-a-bank/description/) | [C](./src/2125.c) | Medium | -| 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list/) | [C](./src/2130.c) | Medium | -| 2222 | [Number of Ways to Select Buildings](https://leetcode.com/problems/number-of-ways-to-select-buildings/) | [C](./src/2222.c) | Medium | -| 2256 | [Minimum Average Difference](https://leetcode.com/problems/minimum-average-difference/) | [C](./src/2256.c) | Medium | -| 2270 | [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array/) | [C](./src/2270.c) | Medium | -| 2279 | [Maximum Bags With Full Capacity of Rocks](https://leetcode.com/problems/maximum-bags-with-full-capacity-of-rocks/) | [C](./src/2279.c) | Medium | -| 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid/) | [C](./src/2304.c) | Medium | -| 2482 | [Difference Between Ones and Zeros in Row and Column](https://leetcode.com/problems/difference-between-ones-and-zeros-in-row-and-column/description/) | [C](./src/2482.c) | Medium | -| 2501 | [Longest Square Streak in an Array](https://leetcode.com/problems/longest-square-streak-in-an-array/description/) | [C](./src/2501.c) | Medium | +| # | Title | Solution | Difficulty | +| ----| ------------------------------------------------------------------------------------------------------------------------------------------------------| ----------------- | ---------- | +| 1 | [Two Sum](https://leetcode.com/problems/two-sum) | [C](./src/1.c) | Easy | +| 2 | [Add Two Numbers](https://leetcode.com/problems/add-two-numbers) | [C](./src/2.c) | Medium | +| 3 | [Longest Substring Without Repeating Characters](https://leetcode.com/problems/longest-substring-without-repeating-characters) | [C](./src/3.c) | Medium | +| 4 | [Median of Two Sorted Arrays](https://leetcode.com/problems/median-of-two-sorted-arrays) | [C](./src/4.c) | Hard | +| 6 | [Zigzag Conversion](https://leetcode.com/problems/zigzag-conversion) | [C](./src/6.c) | Medium | +| 7 | [Reverse Integer](https://leetcode.com/problems/reverse-integer) | [C](./src/7.c) | Medium | +| 8 | [String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c) | Medium | +| 9 | [Palindrome Number](https://leetcode.com/problems/palindrome-number) | [C](./src/9.c) | Easy | +| 10 | [Regular Expression Matching](https://leetcode.com/problems/regular-expression-matching) | [C](./src/10.c) | Hard | +| 11 | [Container With Most Water](https://leetcode.com/problems/container-with-most-water) | [C](./src/11.c) | Medium | +| 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | +| 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer) | [C](./src/13.c) | Easy | +| 14 | [Longest Common Prefix](https://leetcode.com/problems/longest-common-prefix) | [C](./src/14.c) | Easy | +| 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses) | [C](./src/20.c) | Easy | +| 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists) | [C](./src/21.c) | Easy | +| 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs) | [C](./src/24.c) | Medium | +| 26 | [Remove Duplicates from Sorted Array](https://leetcode.com/problems/remove-duplicates-from-sorted-array) | [C](./src/26.c) | Easy | +| 27 | [Remove Element](https://leetcode.com/problems/remove-element) | [C](./src/27.c) | Easy | +| 28 | [Find the Index of the First Occurrence in a String](https://leetcode.com/problems/find-the-index-of-the-first-occurrence-in-a-string) | [C](./src/28.c) | Medium | +| 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers) | [C](./src/29.c) | Medium | +| 32 | [Longest Valid Parentheses](https://leetcode.com/problems/longest-valid-parentheses) | [C](./src/32.c) | Hard | +| 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position) | [C](./src/35.c) | Easy | +| 37 | [Sudoku Solver](https://leetcode.com/problems/sudoku-solver) | [C](./src/37.c) | Hard | +| 38 | [Count and Say](https://leetcode.com/problems/count-and-say) | [C](./src/38.c) | Medium | +| 42 | [Trapping Rain Water](https://leetcode.com/problems/trapping-rain-water) | [C](./src/42.c) | Hard | +| 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray) | [C](./src/53.c) | Medium | +| 62 | [Unique Paths](https://leetcode.com/problems/unique-paths) | [C](./src/62.c) | Medium | +| 63 | [Unique Paths II](https://leetcode.com/problems/unique-paths-ii) | [C](./src/63.c) | Medium | +| 66 | [Plus One](https://leetcode.com/problems/plus-one) | [C](./src/66.c) | Easy | +| 75 | [Sort Colors](https://leetcode.com/problems/sort-colors) | [C](./src/75.c) | Medium | +| 79 | [Word Search](https://leetcode.com/problems/word-search) | [C](./src/79.c) | Medium | +| 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii) | [C](./src/82.c) | Medium | +| 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list) | [C](./src/83.c) | Easy | +| 94 | [Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal) | [C](./src/94.c) | Easy | +| 98 | [Validate Binary Search Tree](https://leetcode.com/problems/validate-binary-search-tree) | [C](./src/98.c) | Medium | +| 101 | [Symmetric Tree](https://leetcode.com/problems/symmetric-tree) | [C](./src/101.c) | Easy | +| 104 | [Maximum Depth of Binary Tree](https://leetcode.com/problems/maximum-depth-of-binary-tree) | [C](./src/104.c) | Easy | +| 108 | [Convert Sorted Array to Binary Search Tree](https://leetcode.com/problems/convert-sorted-array-to-binary-search-tree) | [C](./src/108.c) | Easy | +| 109 | [Convert Sorted List to Binary Search Tree](https://leetcode.com/problems/convert-sorted-list-to-binary-search-tree) | [C](./src/109.c) | Medium | +| 110 | [Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree) | [C](./src/110.c) | Easy | +| 112 | [Path Sum](https://leetcode.com/problems/path-sum) | [C](./src/112.c) | Easy | +| 118 | [Pascal's Triangle](https://leetcode.com/problems/pascals-triangle) | [C](./src/118.c) | Easy | +| 119 | [Pascal's Triangle II](https://leetcode.com/problems/pascals-triangle-ii) | [C](./src/119.c) | Easy | +| 121 | [Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock) | [C](./src/121.c) | Easy | +| 124 | [Binary Tree Maximum Path Sum](https://leetcode.com/problems/binary-tree-maximum-path-sum) | [C](./src/124.c) | Hard | +| 125 | [Valid Palindrome](https://leetcode.com/problems/valid-palindrome) | [C](./src/125.c) | Easy | +| 136 | [Single Number](https://leetcode.com/problems/single-number) | [C](./src/136.c) | Easy | +| 141 | [Linked List Cycle](https://leetcode.com/problems/linked-list-cycle) | [C](./src/141.c) | Easy | +| 142 | [Linked List Cycle II](https://leetcode.com/problems/linked-list-cycle-ii) | [C](./src/142.c) | Medium | +| 153 | [Find Minimum in Rotated Sorted Array](https://leetcode.com/problems/find-minimum-in-rotated-sorted-array) | [C](./src/153.c) | Medium | +| 160 | [Intersection of Two Linked Lists](https://leetcode.com/problems/intersection-of-two-linked-lists) | [C](./src/160.c) | Easy | +| 169 | [Majority Element](https://leetcode.com/problems/majority-element) | [C](./src/169.c) | Easy | +| 173 | [Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator) | [C](./src/173.c) | Medium | +| 189 | [Rotate Array](https://leetcode.com/problems/rotate-array) | [C](./src/189.c) | Medium | +| 190 | [Reverse Bits](https://leetcode.com/problems/reverse-bits) | [C](./src/190.c) | Easy | +| 191 | [Number of 1 Bits](https://leetcode.com/problems/number-of-1-bits) | [C](./src/191.c) | Easy | +| 201 | [Bitwise AND of Numbers Range](https://leetcode.com/problems/bitwise-and-of-numbers-range) | [C](./src/201.c) | Medium | +| 203 | [Remove Linked List Elements](https://leetcode.com/problems/remove-linked-list-elements) | [C](./src/203.c) | Easy | +| 206 | [Reverse Linked List](https://leetcode.com/problems/reverse-linked-list) | [C](./src/206.c) | Easy | +| 215 | [Kth Largest Element in an Array](https://leetcode.com/problems/kth-largest-element-in-an-array) | [C](./src/215.c) | Medium | +| 217 | [Contains Duplicate](https://leetcode.com/problems/contains-duplicate) | [C](./src/217.c) | Easy | +| 223 | [Rectangle Area](https://leetcode.com/problems/rectangle-area) | [C](./src/223.c) | Medium | +| 226 | [Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree) | [C](./src/226.c) | Easy | +| 230 | [Kth Smallest Element in a BST](https://leetcode.com/problems/kth-smallest-element-in-a-bst) | [C](./src/230.c) | Medium | +| 231 | [Power of Two](https://leetcode.com/problems/power-of-two) | [C](./src/231.c) | Easy | +| 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list) | [C](./src/234.c) | Easy | +| 236 | [Lowest Common Ancestor of a Binary Tree](https://leetcode.com/problems/lowest-common-ancestor-of-a-binary-tree) | [C](./src/236.c) | Medium | +| 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram) | [C](./src/242.c) | Easy | +| 268 | [Missing Number](https://leetcode.com/problems/missing-number) | [C](./src/268.c) | Easy | +| 274 | [H-Index](https://leetcode.com/problems/h-index) | [C](./src/274.c) | Medium | +| 278 | [First Bad Version](https://leetcode.com/problems/first-bad-version) | [C](./src/278.c) | Easy | +| 283 | [Move Zeroes](https://leetcode.com/problems/move-zeroes) | [C](./src/283.c) | Easy | +| 287 | [Find the Duplicate Number](https://leetcode.com/problems/find-the-duplicate-number) | [C](./src/287.c) | Medium | +| 344 | [Reverse String](https://leetcode.com/problems/reverse-string) | [C](./src/344.c) | Easy | +| 367 | [Valid Perfect Square](https://leetcode.com/problems/valid-perfect-square) | [C](./src/367.c) | Easy | +| 387 | [First Unique Character in a String](https://leetcode.com/problems/first-unique-character-in-a-string) | [C](./src/387.c) | Easy | +| 389 | [Find the Difference](https://leetcode.com/problems/find-the-difference) | [C](./src/389.c) | Easy | +| 404 | [Sum of Left Leaves](https://leetcode.com/problems/sum-of-left-leaves) | [C](./src/404.c) | Easy | +| 442 | [Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array) | [C](./src/442.c) | Medium | +| 461 | [Hamming Distance](https://leetcode.com/problems/hamming-distance) | [C](./src/461.c) | Easy | +| 476 | [Number Complement](https://leetcode.com/problems/number-complement) | [C](./src/476.c) | Easy | +| 485 | [Max Consecutive Ones](https://leetcode.com/problems/max-consecutive-ones) | [C](./src/485.c) | Easy | +| 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number) | [C](./src/509.c) | Easy | +| 520 | [Detect Capital](https://leetcode.com/problems/detect-capital) | [C](./src/520.c) | Easy | +| 561 | [Array Partition](https://leetcode.com/problems/array-partition) | [C](./src/561.c) | Easy | +| 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees) | [C](./src/617.c) | Easy | +| 647 | [Palindromic Substrings](https://leetcode.com/problems/palindromic-substrings) | [C](./src/647.c) | Medium | +| 669 | [Trim a Binary Search Tree](https://leetcode.com/problems/trim-a-binary-search-tree) | [C](./src/669.c) | Medium | +| 674 | [Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence) | [C](./src/674.c) | Easy | +| 684 | [Redundant Connection](https://leetcode.com/problems/redundant-connection) | [C](./src/684.c) | Medium | +| 700 | [Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree) | [C](./src/700.c) | Easy | +| 701 | [Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree) | [C](./src/701.c) | Medium | +| 704 | [Binary Search](https://leetcode.com/problems/binary-search) | [C](./src/704.c) | Easy | +| 709 | [To Lower Case](https://leetcode.com/problems/to-lower-case) | [C](./src/709.c) | Easy | +| 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones) | [C](./src/771.c) | Easy | +| 807 | [Max Increase to Keep City Skyline](https://leetcode.com/problems/max-increase-to-keep-city-skyline) | [C](./src/807.c) | Medium | +| 841 | [Keys and Rooms](https://leetcode.com/problems/keys-and-rooms) | [C](./src/841.c) | Medium | +| 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array) | [C](./src/852.c) | Medium | +| 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list) | [C](./src/876.c) | Easy | +| 901 | [Online Stock Span](https://leetcode.com/problems/online-stock-span) | [C](./src/901.c) | Medium | +| 905 | [Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity) | [C](./src/905.c) | Easy | +| 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters) | [C](./src/917.c) | Easy | +| 931 | [Minimum Falling Path Sum](https://leetcode.com/problems/minimum-falling-path-sum) | [C](./src/931.c) | Medium | +| 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst) | [C](./src/938.c) | Easy | +| 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree) | [C](./src/965.c) | Easy | +| 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array) | [C](./src/977.c) | Easy | +| 985 | [Sum of Even Numbers After Queries](https://leetcode.com/problems/sum-of-even-numbers-after-queries) | [C](./src/985.c) | Medium | +| 1008| [Construct Binary Search Tree from Preorder Traversal](https://leetcode.com/problems/construct-binary-search-tree-from-preorder-traversal) | [C](./src/1008.c) | Medium | +| 1009| [Complement of Base 10 Integer](https://leetcode.com/problems/complement-of-base-10-integer) | [C](./src/1009.c) | Easy | +| 1019| [Next Greater Node In Linked List](https://leetcode.com/problems/next-greater-node-in-linked-list) | [C](./src/1019.c) | Medium | +| 1026| [Maximum Difference Between Node and Ancestor](https://leetcode.com/problems/maximum-difference-between-node-and-ancestor) | [C](./src/1026.c) | Medium | +| 1089| [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros) | [C](./src/1089.c) | Easy | +| 1147| [Longest Chunked Palindrome Decomposition](https://leetcode.com/problems/longest-chunked-palindrome-decomposition) | [C](./src/1147.c) | Hard | +| 1184| [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops) | [C](./src/1184.c) | Easy | +| 1189| [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons) | [C](./src/1189.c) | Easy | +| 1207| [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences) | [C](./src/1207.c) | Easy | +| 1283| [Find the Smallest Divisor Given a Threshold](https://leetcode.com/problems/find-the-smallest-divisor-given-a-threshold) | [C](./src/1283.c) | Medium | +| 1524| [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum) | [C](./src/1524.c) | Medium | +| 1653| [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced) | [C](./src/1653.c) | Medium | +| 1657| [Determine if Two Strings Are Close](https://leetcode.com/problems/determine-if-two-strings-are-close) | [C](./src/1657.c) | Medium | +| 1695| [Maximum Erasure Value](https://leetcode.com/problems/maximum-erasure-value) | [C](./src/1695.c) | Medium | +| 1704| [Determine if String Halves Are Alike](https://leetcode.com/problems/determine-if-string-halves-are-alike) | [C](./src/1704.c) | Easy | +| 1752| [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated) | [C](./src/1752.c) | Easy | +| 1769| [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box)| [C](./src/1769.c) | Medium | +| 1833| [Maximum Ice Cream Bars](https://leetcode.com/problems/maximum-ice-cream-bars) | [C](./src/1833.c) | Medium | +| 1838| [Frequency of the Most Frequent Element](https://leetcode.com/problems/frequency-of-the-most-frequent-element) | [C](./src/1838.c) | Medium | +| 2024| [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam) | [C](./src/2024.c) | Medium | +| 2095| [Delete the Middle Node of a Linked List](https://leetcode.com/problems/delete-the-middle-node-of-a-linked-list) | [C](./src/2095.c) | Medium | +| 2125| [Number of Laser Beams in a Bank](https://leetcode.com/problems/number-of-laser-beams-in-a-bank) | [C](./src/2125.c) | Medium | +| 2130| [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list) | [C](./src/2130.c) | Medium | +| 2222| [Number of Ways to Select Buildings](https://leetcode.com/problems/number-of-ways-to-select-buildings) | [C](./src/2222.c) | Medium | +| 2256| [Minimum Average Difference](https://leetcode.com/problems/minimum-average-difference) | [C](./src/2256.c) | Medium | +| 2270| [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array) | [C](./src/2270.c) | Medium | +| 2279| [Maximum Bags With Full Capacity of Rocks](https://leetcode.com/problems/maximum-bags-with-full-capacity-of-rocks) | [C](./src/2279.c) | Medium | +| 2304| [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid) | [C](./src/2304.c) | Medium | +| 2482| [Difference Between Ones and Zeros in Row and Column](https://leetcode.com/problems/difference-between-ones-and-zeros-in-row-and-column) | [C](./src/2482.c) | Medium | +| 2501| [Longest Square Streak in an Array](https://leetcode.com/problems/longest-square-streak-in-an-array) | [C](./src/2501.c) | Medium | diff --git a/scripts/leetcode_directory_md.py b/scripts/leetcode_directory_md.py new file mode 100644 index 0000000000..42d6b1c7a5 --- /dev/null +++ b/scripts/leetcode_directory_md.py @@ -0,0 +1,124 @@ +#!/usr/bin/env python3 + +from dataclasses import dataclass +from os import listdir +from pathlib import Path + +import requests + + +@dataclass +class Task: + """The task dataclass. Container for task info""" + + id: str + title: str + solution: str + difficulty: str + + +def fetch_leetcode_folder_tasks(solutions_folder: Path) -> list[Task]: + """Fetch leetcode tasks from the Leetcode""" + + # Fetch tasks info from the leetcode API. + resp = requests.get("https://leetcode.com/api/problems/algorithms/", timeout=10) + content_dict = resp.json() + + raw_tasks_id_dict = {} + + for task in content_dict["stat_status_pairs"]: + task_stat = task["stat"] + raw_tasks_id_dict[str(task_stat["frontend_question_id"])] = task + + # Generate result tasks info to be inserted into the document + tasks_list = [] + + difficulty = {1: "Easy", 2: "Medium", 3: "Hard"} + + for fl in listdir(solutions_folder): + task_id = fl.split(".")[0] + + raw_task = raw_tasks_id_dict.get(task_id, None) + if raw_task is None: + continue + + raw_task_stat = raw_task["stat"] + tasks_list.append( + Task( + id=f'{raw_task_stat["frontend_question_id"]}', + title=f'[{raw_task_stat["question__title"]}](https://leetcode.com/problems/{raw_task_stat["question__title_slug"]})', + solution=f"[C](./src/{fl})", + difficulty=f'{difficulty.get(raw_task["difficulty"]["level"], "")}', + ) + ) + + return tasks_list + + +HEADER_ID = "#" +HEADER_TITLE = "Title" +HEADER_SOLUTION = "Solution" +HEADER_DIFFICULTY = "Difficulty" +SEPARATOR = "-" + + +def print_directory_md(tasks_list: list[Task]) -> None: + """Print tasks into the stdout""" + + def get_max_len(get_item): + return max(list(map(lambda x: len(get_item(x)), tasks_list))) + + id_max_length = max(get_max_len(lambda x: x.id), len(HEADER_ID)) + title_max_length = max(get_max_len(lambda x: x.title), len(HEADER_TITLE)) + solution_max_length = max(get_max_len(lambda x: x.solution), len(HEADER_SOLUTION)) + difficulty_max_length = max( + get_max_len(lambda x: x.difficulty), len(HEADER_DIFFICULTY) + ) + + def formatted_string(header, title, solution, difficulty): + return ( + f"| {header.ljust(id_max_length)}" + + f"| {title.ljust(title_max_length)}" + + f"| {solution.ljust(solution_max_length)}" + + f" | {difficulty.ljust(difficulty_max_length)} |" + ) + + tasks_rows = [] + + tasks_rows.append( + formatted_string(HEADER_ID, HEADER_TITLE, HEADER_SOLUTION, HEADER_DIFFICULTY) + ) + tasks_rows.append( + formatted_string( + id_max_length * SEPARATOR, + title_max_length * SEPARATOR, + solution_max_length * SEPARATOR, + difficulty_max_length * SEPARATOR, + ) + ) + + tasks_list.sort(key=lambda x: int(x.id.strip())) + + for task in tasks_list: + tasks_rows.append( + formatted_string(task.id, task.title, task.solution, task.difficulty) + ) + + print( + """ +# LeetCode + +### LeetCode Algorithm +""" + ) + + for item in tasks_rows: + print(item) + + +if __name__ == "__main__": + top_dir = Path(".") + solutions_folder = top_dir / "leetcode" / "src" + + tasks_list = fetch_leetcode_folder_tasks(solutions_folder) + print_directory_md(tasks_list) From 88d29872f974da2d93e87ec7fe9d9f223c8811cd Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Tue, 24 Jan 2023 09:06:49 +0400 Subject: [PATCH 096/156] feat: add LeetCode Pow(x, n) (#1194) * add leetcode Pow(x, n) * Update 50.c fix comment * Update 50.c simplification * add lower_bound const. * updating DIRECTORY.md Co-authored-by: David Leal Co-authored-by: github-actions[bot] --- leetcode/DIRECTORY.md | 1 + leetcode/src/50.c | 39 +++++++++++++++++++++++++++++++++++++++ 2 files changed, 40 insertions(+) create mode 100644 leetcode/src/50.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 5fee0e8a88..eea7a8efe5 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -30,6 +30,7 @@ | 37 | [Sudoku Solver](https://leetcode.com/problems/sudoku-solver) | [C](./src/37.c) | Hard | | 38 | [Count and Say](https://leetcode.com/problems/count-and-say) | [C](./src/38.c) | Medium | | 42 | [Trapping Rain Water](https://leetcode.com/problems/trapping-rain-water) | [C](./src/42.c) | Hard | +| 50 | [Pow(x, n)](https://leetcode.com/problems/powx-n) | [C](./src/50.c) | Medium | | 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray) | [C](./src/53.c) | Medium | | 62 | [Unique Paths](https://leetcode.com/problems/unique-paths) | [C](./src/62.c) | Medium | | 63 | [Unique Paths II](https://leetcode.com/problems/unique-paths-ii) | [C](./src/63.c) | Medium | diff --git a/leetcode/src/50.c b/leetcode/src/50.c new file mode 100644 index 0000000000..1e539e0421 --- /dev/null +++ b/leetcode/src/50.c @@ -0,0 +1,39 @@ +double powPositive(double x, int n){ + if (n == 1){ + return x; + } + + double val = powPositive(x, n / 2); + double result = val * val; + + // if n is odd + if (n & 1 > 0){ + result *= x; + } + + return result; +} + +// Divide and conquer. +// Runtime: O(log(n)) +// Space: O(1) +double myPow(double x, int n){ + if (n == 0){ + return 1; + } + + const int LOWER_BOUND = -2147483648; + + // n is the minimum int, couldn't be converted in -n because maximum is 2147483647. + // this case we use (1 / pow(x, -(n + 1))) * n + if (n == LOWER_BOUND){ + return 1 / (powPositive(x, -(n + 1)) * x); + } + + // 1 / pow(x, -(n + 1)) + if (n < 0){ + return 1 / powPositive(x, -n); + } + + return powPositive(x, n); +} From 5ef38b30f625b2eb26a780c7e0662d42c29e4f2e Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Tue, 31 Jan 2023 23:14:36 +0400 Subject: [PATCH 097/156] fix: indentation for `leetcode_directory_md.py` (#1203) * fix indentation for leetcode_directory_md.py * small fix --- scripts/leetcode_directory_md.py | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/scripts/leetcode_directory_md.py b/scripts/leetcode_directory_md.py index 42d6b1c7a5..4c9a7dc01b 100644 --- a/scripts/leetcode_directory_md.py +++ b/scripts/leetcode_directory_md.py @@ -77,10 +77,10 @@ def get_max_len(get_item): def formatted_string(header, title, solution, difficulty): return ( - f"| {header.ljust(id_max_length)}" - + f"| {title.ljust(title_max_length)}" - + f"| {solution.ljust(solution_max_length)}" - + f" | {difficulty.ljust(difficulty_max_length)} |" + f"| {header.rjust(id_max_length)} " + + f"| {title.ljust(title_max_length)} " + + f"| {solution.ljust(solution_max_length)} " + + f"| {difficulty.ljust(difficulty_max_length)} |" ) tasks_rows = [] From e8d3811f129a7253136a6704ffbf02bc7c895caa Mon Sep 17 00:00:00 2001 From: Aybars Nazlica Date: Wed, 1 Feb 2023 04:24:50 +0900 Subject: [PATCH 098/156] feat: add hamming distance (#1200) * feat: add hamming distance * Update misc/hamming_distance.c Co-authored-by: David Leal * Update misc/hamming_distance.c Co-authored-by: David Leal * updating DIRECTORY.md * Add curly braces to the while loop * Fix character comparison * Add a one-line description for library/header * Update misc/hamming_distance.c Co-authored-by: Taj * Fix function names in test --------- Co-authored-by: David Leal Co-authored-by: github-actions[bot] Co-authored-by: Taj --- DIRECTORY.md | 3 ++ misc/hamming_distance.c | 62 +++++++++++++++++++++++++++++++++++++++++ 2 files changed, 65 insertions(+) create mode 100644 misc/hamming_distance.c diff --git a/DIRECTORY.md b/DIRECTORY.md index aa6a378e85..3fbbde138a 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -188,6 +188,7 @@ * [12](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/12.c) * [1207](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1207.c) * [121](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/121.c) + * [124](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/124.c) * [125](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/125.c) * [1283](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1283.c) * [13](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/13.c) @@ -263,6 +264,7 @@ * [461](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/461.c) * [476](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/476.c) * [485](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/485.c) + * [50](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/50.c) * [509](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/509.c) * [520](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/520.c) * [53](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/53.c) @@ -335,6 +337,7 @@ ## Misc * [Demonetization](https://github.com/TheAlgorithms/C/blob/HEAD/misc/demonetization.c) + * [Hamming Distance](https://github.com/TheAlgorithms/C/blob/HEAD/misc/hamming_distance.c) * [Lexicographic Permutations](https://github.com/TheAlgorithms/C/blob/HEAD/misc/lexicographic_permutations.c) * [Longest Subsequence](https://github.com/TheAlgorithms/C/blob/HEAD/misc/longest_subsequence.c) * [Mirror](https://github.com/TheAlgorithms/C/blob/HEAD/misc/mirror.c) diff --git a/misc/hamming_distance.c b/misc/hamming_distance.c new file mode 100644 index 0000000000..e479bf144e --- /dev/null +++ b/misc/hamming_distance.c @@ -0,0 +1,62 @@ +/** + * @file + * @brief [Hamming distance](https://en.wikipedia.org/wiki/Hamming_distance) + * algorithm implementation. + * @details + * In information theory, the Hamming distance between two strings of + * equal length is the number of positions at which the corresponding symbols + * are different. + * @author [Aybars Nazlica](https://github.com/aybarsnazlica) + */ + +#include /// for assert +#include /// for IO operations + +/** + * @brief Function to calculate the Hamming distance between two strings + * @param param1 string 1 + * @param param2 string 2 + * @returns Hamming distance + */ +int hamming_distance(char* str1, char* str2) +{ + int i = 0, distance = 0; + + while (str1[i] != '\0') + { + if (str1[i] != str2[i]) + { + distance++; + } + i++; + } + + return distance; +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() +{ + char str1[] = "karolin"; + char str2[] = "kathrin"; + + assert(hamming_distance(str1, str2) == 3); + + char str3[] = "00000"; + char str4[] = "11111"; + + assert(hamming_distance(str3, str4) == 5); + printf("All tests have successfully passed!\n"); +} +/** + * @brief Main function + * @returns 0 on exit + */ +int main() +{ + test(); // run self-test implementations + return 0; +} From e2b8a617d6a4f54eace85f00decd658793e530e9 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Tue, 31 Jan 2023 23:26:17 +0400 Subject: [PATCH 099/156] feat: add Find the Town Judge LeetCode problem (#1199) * add leetcode Find the Town Judge * updating DIRECTORY.md * Update leetcode/src/997.c Co-authored-by: David Leal * updating DIRECTORY.md --------- Co-authored-by: David Leal Co-authored-by: github-actions[bot] --- leetcode/DIRECTORY.md | 281 +++++++++++++++++++++--------------------- leetcode/src/997.c | 29 +++++ 2 files changed, 170 insertions(+), 140 deletions(-) create mode 100644 leetcode/src/997.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index eea7a8efe5..f9a4f8d776 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -3,143 +3,144 @@ ### LeetCode Algorithm -| # | Title | Solution | Difficulty | -| ----| ------------------------------------------------------------------------------------------------------------------------------------------------------| ----------------- | ---------- | -| 1 | [Two Sum](https://leetcode.com/problems/two-sum) | [C](./src/1.c) | Easy | -| 2 | [Add Two Numbers](https://leetcode.com/problems/add-two-numbers) | [C](./src/2.c) | Medium | -| 3 | [Longest Substring Without Repeating Characters](https://leetcode.com/problems/longest-substring-without-repeating-characters) | [C](./src/3.c) | Medium | -| 4 | [Median of Two Sorted Arrays](https://leetcode.com/problems/median-of-two-sorted-arrays) | [C](./src/4.c) | Hard | -| 6 | [Zigzag Conversion](https://leetcode.com/problems/zigzag-conversion) | [C](./src/6.c) | Medium | -| 7 | [Reverse Integer](https://leetcode.com/problems/reverse-integer) | [C](./src/7.c) | Medium | -| 8 | [String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c) | Medium | -| 9 | [Palindrome Number](https://leetcode.com/problems/palindrome-number) | [C](./src/9.c) | Easy | -| 10 | [Regular Expression Matching](https://leetcode.com/problems/regular-expression-matching) | [C](./src/10.c) | Hard | -| 11 | [Container With Most Water](https://leetcode.com/problems/container-with-most-water) | [C](./src/11.c) | Medium | -| 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | -| 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer) | [C](./src/13.c) | Easy | -| 14 | [Longest Common Prefix](https://leetcode.com/problems/longest-common-prefix) | [C](./src/14.c) | Easy | -| 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses) | [C](./src/20.c) | Easy | -| 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists) | [C](./src/21.c) | Easy | -| 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs) | [C](./src/24.c) | Medium | -| 26 | [Remove Duplicates from Sorted Array](https://leetcode.com/problems/remove-duplicates-from-sorted-array) | [C](./src/26.c) | Easy | -| 27 | [Remove Element](https://leetcode.com/problems/remove-element) | [C](./src/27.c) | Easy | -| 28 | [Find the Index of the First Occurrence in a String](https://leetcode.com/problems/find-the-index-of-the-first-occurrence-in-a-string) | [C](./src/28.c) | Medium | -| 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers) | [C](./src/29.c) | Medium | -| 32 | [Longest Valid Parentheses](https://leetcode.com/problems/longest-valid-parentheses) | [C](./src/32.c) | Hard | -| 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position) | [C](./src/35.c) | Easy | -| 37 | [Sudoku Solver](https://leetcode.com/problems/sudoku-solver) | [C](./src/37.c) | Hard | -| 38 | [Count and Say](https://leetcode.com/problems/count-and-say) | [C](./src/38.c) | Medium | -| 42 | [Trapping Rain Water](https://leetcode.com/problems/trapping-rain-water) | [C](./src/42.c) | Hard | -| 50 | [Pow(x, n)](https://leetcode.com/problems/powx-n) | [C](./src/50.c) | Medium | -| 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray) | [C](./src/53.c) | Medium | -| 62 | [Unique Paths](https://leetcode.com/problems/unique-paths) | [C](./src/62.c) | Medium | -| 63 | [Unique Paths II](https://leetcode.com/problems/unique-paths-ii) | [C](./src/63.c) | Medium | -| 66 | [Plus One](https://leetcode.com/problems/plus-one) | [C](./src/66.c) | Easy | -| 75 | [Sort Colors](https://leetcode.com/problems/sort-colors) | [C](./src/75.c) | Medium | -| 79 | [Word Search](https://leetcode.com/problems/word-search) | [C](./src/79.c) | Medium | -| 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii) | [C](./src/82.c) | Medium | -| 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list) | [C](./src/83.c) | Easy | -| 94 | [Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal) | [C](./src/94.c) | Easy | -| 98 | [Validate Binary Search Tree](https://leetcode.com/problems/validate-binary-search-tree) | [C](./src/98.c) | Medium | -| 101 | [Symmetric Tree](https://leetcode.com/problems/symmetric-tree) | [C](./src/101.c) | Easy | -| 104 | [Maximum Depth of Binary Tree](https://leetcode.com/problems/maximum-depth-of-binary-tree) | [C](./src/104.c) | Easy | -| 108 | [Convert Sorted Array to Binary Search Tree](https://leetcode.com/problems/convert-sorted-array-to-binary-search-tree) | [C](./src/108.c) | Easy | -| 109 | [Convert Sorted List to Binary Search Tree](https://leetcode.com/problems/convert-sorted-list-to-binary-search-tree) | [C](./src/109.c) | Medium | -| 110 | [Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree) | [C](./src/110.c) | Easy | -| 112 | [Path Sum](https://leetcode.com/problems/path-sum) | [C](./src/112.c) | Easy | -| 118 | [Pascal's Triangle](https://leetcode.com/problems/pascals-triangle) | [C](./src/118.c) | Easy | -| 119 | [Pascal's Triangle II](https://leetcode.com/problems/pascals-triangle-ii) | [C](./src/119.c) | Easy | -| 121 | [Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock) | [C](./src/121.c) | Easy | -| 124 | [Binary Tree Maximum Path Sum](https://leetcode.com/problems/binary-tree-maximum-path-sum) | [C](./src/124.c) | Hard | -| 125 | [Valid Palindrome](https://leetcode.com/problems/valid-palindrome) | [C](./src/125.c) | Easy | -| 136 | [Single Number](https://leetcode.com/problems/single-number) | [C](./src/136.c) | Easy | -| 141 | [Linked List Cycle](https://leetcode.com/problems/linked-list-cycle) | [C](./src/141.c) | Easy | -| 142 | [Linked List Cycle II](https://leetcode.com/problems/linked-list-cycle-ii) | [C](./src/142.c) | Medium | -| 153 | [Find Minimum in Rotated Sorted Array](https://leetcode.com/problems/find-minimum-in-rotated-sorted-array) | [C](./src/153.c) | Medium | -| 160 | [Intersection of Two Linked Lists](https://leetcode.com/problems/intersection-of-two-linked-lists) | [C](./src/160.c) | Easy | -| 169 | [Majority Element](https://leetcode.com/problems/majority-element) | [C](./src/169.c) | Easy | -| 173 | [Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator) | [C](./src/173.c) | Medium | -| 189 | [Rotate Array](https://leetcode.com/problems/rotate-array) | [C](./src/189.c) | Medium | -| 190 | [Reverse Bits](https://leetcode.com/problems/reverse-bits) | [C](./src/190.c) | Easy | -| 191 | [Number of 1 Bits](https://leetcode.com/problems/number-of-1-bits) | [C](./src/191.c) | Easy | -| 201 | [Bitwise AND of Numbers Range](https://leetcode.com/problems/bitwise-and-of-numbers-range) | [C](./src/201.c) | Medium | -| 203 | [Remove Linked List Elements](https://leetcode.com/problems/remove-linked-list-elements) | [C](./src/203.c) | Easy | -| 206 | [Reverse Linked List](https://leetcode.com/problems/reverse-linked-list) | [C](./src/206.c) | Easy | -| 215 | [Kth Largest Element in an Array](https://leetcode.com/problems/kth-largest-element-in-an-array) | [C](./src/215.c) | Medium | -| 217 | [Contains Duplicate](https://leetcode.com/problems/contains-duplicate) | [C](./src/217.c) | Easy | -| 223 | [Rectangle Area](https://leetcode.com/problems/rectangle-area) | [C](./src/223.c) | Medium | -| 226 | [Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree) | [C](./src/226.c) | Easy | -| 230 | [Kth Smallest Element in a BST](https://leetcode.com/problems/kth-smallest-element-in-a-bst) | [C](./src/230.c) | Medium | -| 231 | [Power of Two](https://leetcode.com/problems/power-of-two) | [C](./src/231.c) | Easy | -| 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list) | [C](./src/234.c) | Easy | -| 236 | [Lowest Common Ancestor of a Binary Tree](https://leetcode.com/problems/lowest-common-ancestor-of-a-binary-tree) | [C](./src/236.c) | Medium | -| 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram) | [C](./src/242.c) | Easy | -| 268 | [Missing Number](https://leetcode.com/problems/missing-number) | [C](./src/268.c) | Easy | -| 274 | [H-Index](https://leetcode.com/problems/h-index) | [C](./src/274.c) | Medium | -| 278 | [First Bad Version](https://leetcode.com/problems/first-bad-version) | [C](./src/278.c) | Easy | -| 283 | [Move Zeroes](https://leetcode.com/problems/move-zeroes) | [C](./src/283.c) | Easy | -| 287 | [Find the Duplicate Number](https://leetcode.com/problems/find-the-duplicate-number) | [C](./src/287.c) | Medium | -| 344 | [Reverse String](https://leetcode.com/problems/reverse-string) | [C](./src/344.c) | Easy | -| 367 | [Valid Perfect Square](https://leetcode.com/problems/valid-perfect-square) | [C](./src/367.c) | Easy | -| 387 | [First Unique Character in a String](https://leetcode.com/problems/first-unique-character-in-a-string) | [C](./src/387.c) | Easy | -| 389 | [Find the Difference](https://leetcode.com/problems/find-the-difference) | [C](./src/389.c) | Easy | -| 404 | [Sum of Left Leaves](https://leetcode.com/problems/sum-of-left-leaves) | [C](./src/404.c) | Easy | -| 442 | [Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array) | [C](./src/442.c) | Medium | -| 461 | [Hamming Distance](https://leetcode.com/problems/hamming-distance) | [C](./src/461.c) | Easy | -| 476 | [Number Complement](https://leetcode.com/problems/number-complement) | [C](./src/476.c) | Easy | -| 485 | [Max Consecutive Ones](https://leetcode.com/problems/max-consecutive-ones) | [C](./src/485.c) | Easy | -| 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number) | [C](./src/509.c) | Easy | -| 520 | [Detect Capital](https://leetcode.com/problems/detect-capital) | [C](./src/520.c) | Easy | -| 561 | [Array Partition](https://leetcode.com/problems/array-partition) | [C](./src/561.c) | Easy | -| 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees) | [C](./src/617.c) | Easy | -| 647 | [Palindromic Substrings](https://leetcode.com/problems/palindromic-substrings) | [C](./src/647.c) | Medium | -| 669 | [Trim a Binary Search Tree](https://leetcode.com/problems/trim-a-binary-search-tree) | [C](./src/669.c) | Medium | -| 674 | [Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence) | [C](./src/674.c) | Easy | -| 684 | [Redundant Connection](https://leetcode.com/problems/redundant-connection) | [C](./src/684.c) | Medium | -| 700 | [Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree) | [C](./src/700.c) | Easy | -| 701 | [Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree) | [C](./src/701.c) | Medium | -| 704 | [Binary Search](https://leetcode.com/problems/binary-search) | [C](./src/704.c) | Easy | -| 709 | [To Lower Case](https://leetcode.com/problems/to-lower-case) | [C](./src/709.c) | Easy | -| 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones) | [C](./src/771.c) | Easy | -| 807 | [Max Increase to Keep City Skyline](https://leetcode.com/problems/max-increase-to-keep-city-skyline) | [C](./src/807.c) | Medium | -| 841 | [Keys and Rooms](https://leetcode.com/problems/keys-and-rooms) | [C](./src/841.c) | Medium | -| 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array) | [C](./src/852.c) | Medium | -| 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list) | [C](./src/876.c) | Easy | -| 901 | [Online Stock Span](https://leetcode.com/problems/online-stock-span) | [C](./src/901.c) | Medium | -| 905 | [Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity) | [C](./src/905.c) | Easy | -| 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters) | [C](./src/917.c) | Easy | -| 931 | [Minimum Falling Path Sum](https://leetcode.com/problems/minimum-falling-path-sum) | [C](./src/931.c) | Medium | -| 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst) | [C](./src/938.c) | Easy | -| 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree) | [C](./src/965.c) | Easy | -| 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array) | [C](./src/977.c) | Easy | -| 985 | [Sum of Even Numbers After Queries](https://leetcode.com/problems/sum-of-even-numbers-after-queries) | [C](./src/985.c) | Medium | -| 1008| [Construct Binary Search Tree from Preorder Traversal](https://leetcode.com/problems/construct-binary-search-tree-from-preorder-traversal) | [C](./src/1008.c) | Medium | -| 1009| [Complement of Base 10 Integer](https://leetcode.com/problems/complement-of-base-10-integer) | [C](./src/1009.c) | Easy | -| 1019| [Next Greater Node In Linked List](https://leetcode.com/problems/next-greater-node-in-linked-list) | [C](./src/1019.c) | Medium | -| 1026| [Maximum Difference Between Node and Ancestor](https://leetcode.com/problems/maximum-difference-between-node-and-ancestor) | [C](./src/1026.c) | Medium | -| 1089| [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros) | [C](./src/1089.c) | Easy | -| 1147| [Longest Chunked Palindrome Decomposition](https://leetcode.com/problems/longest-chunked-palindrome-decomposition) | [C](./src/1147.c) | Hard | -| 1184| [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops) | [C](./src/1184.c) | Easy | -| 1189| [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons) | [C](./src/1189.c) | Easy | -| 1207| [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences) | [C](./src/1207.c) | Easy | -| 1283| [Find the Smallest Divisor Given a Threshold](https://leetcode.com/problems/find-the-smallest-divisor-given-a-threshold) | [C](./src/1283.c) | Medium | -| 1524| [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum) | [C](./src/1524.c) | Medium | -| 1653| [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced) | [C](./src/1653.c) | Medium | -| 1657| [Determine if Two Strings Are Close](https://leetcode.com/problems/determine-if-two-strings-are-close) | [C](./src/1657.c) | Medium | -| 1695| [Maximum Erasure Value](https://leetcode.com/problems/maximum-erasure-value) | [C](./src/1695.c) | Medium | -| 1704| [Determine if String Halves Are Alike](https://leetcode.com/problems/determine-if-string-halves-are-alike) | [C](./src/1704.c) | Easy | -| 1752| [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated) | [C](./src/1752.c) | Easy | -| 1769| [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box)| [C](./src/1769.c) | Medium | -| 1833| [Maximum Ice Cream Bars](https://leetcode.com/problems/maximum-ice-cream-bars) | [C](./src/1833.c) | Medium | -| 1838| [Frequency of the Most Frequent Element](https://leetcode.com/problems/frequency-of-the-most-frequent-element) | [C](./src/1838.c) | Medium | -| 2024| [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam) | [C](./src/2024.c) | Medium | -| 2095| [Delete the Middle Node of a Linked List](https://leetcode.com/problems/delete-the-middle-node-of-a-linked-list) | [C](./src/2095.c) | Medium | -| 2125| [Number of Laser Beams in a Bank](https://leetcode.com/problems/number-of-laser-beams-in-a-bank) | [C](./src/2125.c) | Medium | -| 2130| [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list) | [C](./src/2130.c) | Medium | -| 2222| [Number of Ways to Select Buildings](https://leetcode.com/problems/number-of-ways-to-select-buildings) | [C](./src/2222.c) | Medium | -| 2256| [Minimum Average Difference](https://leetcode.com/problems/minimum-average-difference) | [C](./src/2256.c) | Medium | -| 2270| [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array) | [C](./src/2270.c) | Medium | -| 2279| [Maximum Bags With Full Capacity of Rocks](https://leetcode.com/problems/maximum-bags-with-full-capacity-of-rocks) | [C](./src/2279.c) | Medium | -| 2304| [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid) | [C](./src/2304.c) | Medium | -| 2482| [Difference Between Ones and Zeros in Row and Column](https://leetcode.com/problems/difference-between-ones-and-zeros-in-row-and-column) | [C](./src/2482.c) | Medium | -| 2501| [Longest Square Streak in an Array](https://leetcode.com/problems/longest-square-streak-in-an-array) | [C](./src/2501.c) | Medium | +| # | Title | Solution | Difficulty | +| ---- | ------------------------------------------------------------------------------------------------------------------------------------------------------ | ----------------- | ---------- | +| 1 | [Two Sum](https://leetcode.com/problems/two-sum) | [C](./src/1.c) | Easy | +| 2 | [Add Two Numbers](https://leetcode.com/problems/add-two-numbers) | [C](./src/2.c) | Medium | +| 3 | [Longest Substring Without Repeating Characters](https://leetcode.com/problems/longest-substring-without-repeating-characters) | [C](./src/3.c) | Medium | +| 4 | [Median of Two Sorted Arrays](https://leetcode.com/problems/median-of-two-sorted-arrays) | [C](./src/4.c) | Hard | +| 6 | [Zigzag Conversion](https://leetcode.com/problems/zigzag-conversion) | [C](./src/6.c) | Medium | +| 7 | [Reverse Integer](https://leetcode.com/problems/reverse-integer) | [C](./src/7.c) | Medium | +| 8 | [String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c) | Medium | +| 9 | [Palindrome Number](https://leetcode.com/problems/palindrome-number) | [C](./src/9.c) | Easy | +| 10 | [Regular Expression Matching](https://leetcode.com/problems/regular-expression-matching) | [C](./src/10.c) | Hard | +| 11 | [Container With Most Water](https://leetcode.com/problems/container-with-most-water) | [C](./src/11.c) | Medium | +| 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | +| 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer) | [C](./src/13.c) | Easy | +| 14 | [Longest Common Prefix](https://leetcode.com/problems/longest-common-prefix) | [C](./src/14.c) | Easy | +| 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses) | [C](./src/20.c) | Easy | +| 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists) | [C](./src/21.c) | Easy | +| 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs) | [C](./src/24.c) | Medium | +| 26 | [Remove Duplicates from Sorted Array](https://leetcode.com/problems/remove-duplicates-from-sorted-array) | [C](./src/26.c) | Easy | +| 27 | [Remove Element](https://leetcode.com/problems/remove-element) | [C](./src/27.c) | Easy | +| 28 | [Find the Index of the First Occurrence in a String](https://leetcode.com/problems/find-the-index-of-the-first-occurrence-in-a-string) | [C](./src/28.c) | Medium | +| 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers) | [C](./src/29.c) | Medium | +| 32 | [Longest Valid Parentheses](https://leetcode.com/problems/longest-valid-parentheses) | [C](./src/32.c) | Hard | +| 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position) | [C](./src/35.c) | Easy | +| 37 | [Sudoku Solver](https://leetcode.com/problems/sudoku-solver) | [C](./src/37.c) | Hard | +| 38 | [Count and Say](https://leetcode.com/problems/count-and-say) | [C](./src/38.c) | Medium | +| 42 | [Trapping Rain Water](https://leetcode.com/problems/trapping-rain-water) | [C](./src/42.c) | Hard | +| 50 | [Pow(x, n)](https://leetcode.com/problems/powx-n) | [C](./src/50.c) | Medium | +| 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray) | [C](./src/53.c) | Medium | +| 62 | [Unique Paths](https://leetcode.com/problems/unique-paths) | [C](./src/62.c) | Medium | +| 63 | [Unique Paths II](https://leetcode.com/problems/unique-paths-ii) | [C](./src/63.c) | Medium | +| 66 | [Plus One](https://leetcode.com/problems/plus-one) | [C](./src/66.c) | Easy | +| 75 | [Sort Colors](https://leetcode.com/problems/sort-colors) | [C](./src/75.c) | Medium | +| 79 | [Word Search](https://leetcode.com/problems/word-search) | [C](./src/79.c) | Medium | +| 82 | [Remove Duplicates from Sorted List II](https://leetcode.com/problems/remove-duplicates-from-sorted-list-ii) | [C](./src/82.c) | Medium | +| 83 | [Remove Duplicates from Sorted List](https://leetcode.com/problems/remove-duplicates-from-sorted-list) | [C](./src/83.c) | Easy | +| 94 | [Binary Tree Inorder Traversal](https://leetcode.com/problems/binary-tree-inorder-traversal) | [C](./src/94.c) | Easy | +| 98 | [Validate Binary Search Tree](https://leetcode.com/problems/validate-binary-search-tree) | [C](./src/98.c) | Medium | +| 101 | [Symmetric Tree](https://leetcode.com/problems/symmetric-tree) | [C](./src/101.c) | Easy | +| 104 | [Maximum Depth of Binary Tree](https://leetcode.com/problems/maximum-depth-of-binary-tree) | [C](./src/104.c) | Easy | +| 108 | [Convert Sorted Array to Binary Search Tree](https://leetcode.com/problems/convert-sorted-array-to-binary-search-tree) | [C](./src/108.c) | Easy | +| 109 | [Convert Sorted List to Binary Search Tree](https://leetcode.com/problems/convert-sorted-list-to-binary-search-tree) | [C](./src/109.c) | Medium | +| 110 | [Balanced Binary Tree](https://leetcode.com/problems/balanced-binary-tree) | [C](./src/110.c) | Easy | +| 112 | [Path Sum](https://leetcode.com/problems/path-sum) | [C](./src/112.c) | Easy | +| 118 | [Pascal's Triangle](https://leetcode.com/problems/pascals-triangle) | [C](./src/118.c) | Easy | +| 119 | [Pascal's Triangle II](https://leetcode.com/problems/pascals-triangle-ii) | [C](./src/119.c) | Easy | +| 121 | [Best Time to Buy and Sell Stock](https://leetcode.com/problems/best-time-to-buy-and-sell-stock) | [C](./src/121.c) | Easy | +| 124 | [Binary Tree Maximum Path Sum](https://leetcode.com/problems/binary-tree-maximum-path-sum) | [C](./src/124.c) | Hard | +| 125 | [Valid Palindrome](https://leetcode.com/problems/valid-palindrome) | [C](./src/125.c) | Easy | +| 136 | [Single Number](https://leetcode.com/problems/single-number) | [C](./src/136.c) | Easy | +| 141 | [Linked List Cycle](https://leetcode.com/problems/linked-list-cycle) | [C](./src/141.c) | Easy | +| 142 | [Linked List Cycle II](https://leetcode.com/problems/linked-list-cycle-ii) | [C](./src/142.c) | Medium | +| 153 | [Find Minimum in Rotated Sorted Array](https://leetcode.com/problems/find-minimum-in-rotated-sorted-array) | [C](./src/153.c) | Medium | +| 160 | [Intersection of Two Linked Lists](https://leetcode.com/problems/intersection-of-two-linked-lists) | [C](./src/160.c) | Easy | +| 169 | [Majority Element](https://leetcode.com/problems/majority-element) | [C](./src/169.c) | Easy | +| 173 | [Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator) | [C](./src/173.c) | Medium | +| 189 | [Rotate Array](https://leetcode.com/problems/rotate-array) | [C](./src/189.c) | Medium | +| 190 | [Reverse Bits](https://leetcode.com/problems/reverse-bits) | [C](./src/190.c) | Easy | +| 191 | [Number of 1 Bits](https://leetcode.com/problems/number-of-1-bits) | [C](./src/191.c) | Easy | +| 201 | [Bitwise AND of Numbers Range](https://leetcode.com/problems/bitwise-and-of-numbers-range) | [C](./src/201.c) | Medium | +| 203 | [Remove Linked List Elements](https://leetcode.com/problems/remove-linked-list-elements) | [C](./src/203.c) | Easy | +| 206 | [Reverse Linked List](https://leetcode.com/problems/reverse-linked-list) | [C](./src/206.c) | Easy | +| 215 | [Kth Largest Element in an Array](https://leetcode.com/problems/kth-largest-element-in-an-array) | [C](./src/215.c) | Medium | +| 217 | [Contains Duplicate](https://leetcode.com/problems/contains-duplicate) | [C](./src/217.c) | Easy | +| 223 | [Rectangle Area](https://leetcode.com/problems/rectangle-area) | [C](./src/223.c) | Medium | +| 226 | [Invert Binary Tree](https://leetcode.com/problems/invert-binary-tree) | [C](./src/226.c) | Easy | +| 230 | [Kth Smallest Element in a BST](https://leetcode.com/problems/kth-smallest-element-in-a-bst) | [C](./src/230.c) | Medium | +| 231 | [Power of Two](https://leetcode.com/problems/power-of-two) | [C](./src/231.c) | Easy | +| 234 | [Palindrome Linked List](https://leetcode.com/problems/palindrome-linked-list) | [C](./src/234.c) | Easy | +| 236 | [Lowest Common Ancestor of a Binary Tree](https://leetcode.com/problems/lowest-common-ancestor-of-a-binary-tree) | [C](./src/236.c) | Medium | +| 242 | [Valid Anagram](https://leetcode.com/problems/valid-anagram) | [C](./src/242.c) | Easy | +| 268 | [Missing Number](https://leetcode.com/problems/missing-number) | [C](./src/268.c) | Easy | +| 274 | [H-Index](https://leetcode.com/problems/h-index) | [C](./src/274.c) | Medium | +| 278 | [First Bad Version](https://leetcode.com/problems/first-bad-version) | [C](./src/278.c) | Easy | +| 283 | [Move Zeroes](https://leetcode.com/problems/move-zeroes) | [C](./src/283.c) | Easy | +| 287 | [Find the Duplicate Number](https://leetcode.com/problems/find-the-duplicate-number) | [C](./src/287.c) | Medium | +| 344 | [Reverse String](https://leetcode.com/problems/reverse-string) | [C](./src/344.c) | Easy | +| 367 | [Valid Perfect Square](https://leetcode.com/problems/valid-perfect-square) | [C](./src/367.c) | Easy | +| 387 | [First Unique Character in a String](https://leetcode.com/problems/first-unique-character-in-a-string) | [C](./src/387.c) | Easy | +| 389 | [Find the Difference](https://leetcode.com/problems/find-the-difference) | [C](./src/389.c) | Easy | +| 404 | [Sum of Left Leaves](https://leetcode.com/problems/sum-of-left-leaves) | [C](./src/404.c) | Easy | +| 442 | [Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array) | [C](./src/442.c) | Medium | +| 461 | [Hamming Distance](https://leetcode.com/problems/hamming-distance) | [C](./src/461.c) | Easy | +| 476 | [Number Complement](https://leetcode.com/problems/number-complement) | [C](./src/476.c) | Easy | +| 485 | [Max Consecutive Ones](https://leetcode.com/problems/max-consecutive-ones) | [C](./src/485.c) | Easy | +| 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number) | [C](./src/509.c) | Easy | +| 520 | [Detect Capital](https://leetcode.com/problems/detect-capital) | [C](./src/520.c) | Easy | +| 561 | [Array Partition](https://leetcode.com/problems/array-partition) | [C](./src/561.c) | Easy | +| 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees) | [C](./src/617.c) | Easy | +| 647 | [Palindromic Substrings](https://leetcode.com/problems/palindromic-substrings) | [C](./src/647.c) | Medium | +| 669 | [Trim a Binary Search Tree](https://leetcode.com/problems/trim-a-binary-search-tree) | [C](./src/669.c) | Medium | +| 674 | [Longest Continuous Increasing Subsequence](https://leetcode.com/problems/longest-continuous-increasing-subsequence) | [C](./src/674.c) | Easy | +| 684 | [Redundant Connection](https://leetcode.com/problems/redundant-connection) | [C](./src/684.c) | Medium | +| 700 | [Search in a Binary Search Tree](https://leetcode.com/problems/search-in-a-binary-search-tree) | [C](./src/700.c) | Easy | +| 701 | [Insert into a Binary Search Tree](https://leetcode.com/problems/insert-into-a-binary-search-tree) | [C](./src/701.c) | Medium | +| 704 | [Binary Search](https://leetcode.com/problems/binary-search) | [C](./src/704.c) | Easy | +| 709 | [To Lower Case](https://leetcode.com/problems/to-lower-case) | [C](./src/709.c) | Easy | +| 771 | [Jewels and Stones](https://leetcode.com/problems/jewels-and-stones) | [C](./src/771.c) | Easy | +| 807 | [Max Increase to Keep City Skyline](https://leetcode.com/problems/max-increase-to-keep-city-skyline) | [C](./src/807.c) | Medium | +| 841 | [Keys and Rooms](https://leetcode.com/problems/keys-and-rooms) | [C](./src/841.c) | Medium | +| 852 | [Peak Index in a Mountain Array](https://leetcode.com/problems/peak-index-in-a-mountain-array) | [C](./src/852.c) | Medium | +| 876 | [Middle of the Linked List](https://leetcode.com/problems/middle-of-the-linked-list) | [C](./src/876.c) | Easy | +| 901 | [Online Stock Span](https://leetcode.com/problems/online-stock-span) | [C](./src/901.c) | Medium | +| 905 | [Sort Array By Parity](https://leetcode.com/problems/sort-array-by-parity) | [C](./src/905.c) | Easy | +| 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters) | [C](./src/917.c) | Easy | +| 931 | [Minimum Falling Path Sum](https://leetcode.com/problems/minimum-falling-path-sum) | [C](./src/931.c) | Medium | +| 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst) | [C](./src/938.c) | Easy | +| 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree) | [C](./src/965.c) | Easy | +| 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array) | [C](./src/977.c) | Easy | +| 985 | [Sum of Even Numbers After Queries](https://leetcode.com/problems/sum-of-even-numbers-after-queries) | [C](./src/985.c) | Medium | +| 997 | [Find the Town Judge](https://leetcode.com/problems/find-the-town-judge) | [C](./src/997.c) | Easy | +| 1008 | [Construct Binary Search Tree from Preorder Traversal](https://leetcode.com/problems/construct-binary-search-tree-from-preorder-traversal) | [C](./src/1008.c) | Medium | +| 1009 | [Complement of Base 10 Integer](https://leetcode.com/problems/complement-of-base-10-integer) | [C](./src/1009.c) | Easy | +| 1019 | [Next Greater Node In Linked List](https://leetcode.com/problems/next-greater-node-in-linked-list) | [C](./src/1019.c) | Medium | +| 1026 | [Maximum Difference Between Node and Ancestor](https://leetcode.com/problems/maximum-difference-between-node-and-ancestor) | [C](./src/1026.c) | Medium | +| 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros) | [C](./src/1089.c) | Easy | +| 1147 | [Longest Chunked Palindrome Decomposition](https://leetcode.com/problems/longest-chunked-palindrome-decomposition) | [C](./src/1147.c) | Hard | +| 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops) | [C](./src/1184.c) | Easy | +| 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons) | [C](./src/1189.c) | Easy | +| 1207 | [Unique Number of Occurrences](https://leetcode.com/problems/unique-number-of-occurrences) | [C](./src/1207.c) | Easy | +| 1283 | [Find the Smallest Divisor Given a Threshold](https://leetcode.com/problems/find-the-smallest-divisor-given-a-threshold) | [C](./src/1283.c) | Medium | +| 1524 | [Number of Sub-arrays With Odd Sum](https://leetcode.com/problems/number-of-sub-arrays-with-odd-sum) | [C](./src/1524.c) | Medium | +| 1653 | [Minimum Deletions to Make String Balanced](https://leetcode.com/problems/minimum-deletions-to-make-string-balanced) | [C](./src/1653.c) | Medium | +| 1657 | [Determine if Two Strings Are Close](https://leetcode.com/problems/determine-if-two-strings-are-close) | [C](./src/1657.c) | Medium | +| 1695 | [Maximum Erasure Value](https://leetcode.com/problems/maximum-erasure-value) | [C](./src/1695.c) | Medium | +| 1704 | [Determine if String Halves Are Alike](https://leetcode.com/problems/determine-if-string-halves-are-alike) | [C](./src/1704.c) | Easy | +| 1752 | [Check if Array Is Sorted and Rotated](https://leetcode.com/problems/check-if-array-is-sorted-and-rotated) | [C](./src/1752.c) | Easy | +| 1769 | [Minimum Number of Operations to Move All Balls to Each Box](https://leetcode.com/problems/minimum-number-of-operations-to-move-all-balls-to-each-box) | [C](./src/1769.c) | Medium | +| 1833 | [Maximum Ice Cream Bars](https://leetcode.com/problems/maximum-ice-cream-bars) | [C](./src/1833.c) | Medium | +| 1838 | [Frequency of the Most Frequent Element](https://leetcode.com/problems/frequency-of-the-most-frequent-element) | [C](./src/1838.c) | Medium | +| 2024 | [Maximize the Confusion of an Exam](https://leetcode.com/problems/maximize-the-confusion-of-an-exam) | [C](./src/2024.c) | Medium | +| 2095 | [Delete the Middle Node of a Linked List](https://leetcode.com/problems/delete-the-middle-node-of-a-linked-list) | [C](./src/2095.c) | Medium | +| 2125 | [Number of Laser Beams in a Bank](https://leetcode.com/problems/number-of-laser-beams-in-a-bank) | [C](./src/2125.c) | Medium | +| 2130 | [Maximum Twin Sum of a Linked List](https://leetcode.com/problems/maximum-twin-sum-of-a-linked-list) | [C](./src/2130.c) | Medium | +| 2222 | [Number of Ways to Select Buildings](https://leetcode.com/problems/number-of-ways-to-select-buildings) | [C](./src/2222.c) | Medium | +| 2256 | [Minimum Average Difference](https://leetcode.com/problems/minimum-average-difference) | [C](./src/2256.c) | Medium | +| 2270 | [Number of Ways to Split Array](https://leetcode.com/problems/number-of-ways-to-split-array) | [C](./src/2270.c) | Medium | +| 2279 | [Maximum Bags With Full Capacity of Rocks](https://leetcode.com/problems/maximum-bags-with-full-capacity-of-rocks) | [C](./src/2279.c) | Medium | +| 2304 | [Minimum Path Cost in a Grid](https://leetcode.com/problems/minimum-path-cost-in-a-grid) | [C](./src/2304.c) | Medium | +| 2482 | [Difference Between Ones and Zeros in Row and Column](https://leetcode.com/problems/difference-between-ones-and-zeros-in-row-and-column) | [C](./src/2482.c) | Medium | +| 2501 | [Longest Square Streak in an Array](https://leetcode.com/problems/longest-square-streak-in-an-array) | [C](./src/2501.c) | Medium | diff --git a/leetcode/src/997.c b/leetcode/src/997.c new file mode 100644 index 0000000000..a599555fc3 --- /dev/null +++ b/leetcode/src/997.c @@ -0,0 +1,29 @@ +// Using hashtable. +// Runtime: O(n + len(trust)) +// Space: O(n) +int findJudge(int n, int** trust, int trustSize, int* trustColSize){ + int* personsToTrust = calloc(n + 1, sizeof(int)); + int* personsFromTrust = calloc(n + 1, sizeof(int)); + + for(int i = 0; i < trustSize; i++){ + int* currentTrust = trust[i]; + personsToTrust[currentTrust[1]] += 1; + personsFromTrust[currentTrust[0]] += 1; + } + + int potentialJudjeNumber = -1; + for(int i = 1; i < n + 1; i++){ + if (personsToTrust[i] == n - 1 && personsFromTrust[i] == 0){ + if (potentialJudjeNumber > -1){ + return -1; + } + + potentialJudjeNumber = i; + } + } + + free(personsToTrust); + free(personsFromTrust); + + return potentialJudjeNumber; +} From 9fa578d4b5c299fe839c474a4f6c65f9e5f85472 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Fri, 3 Feb 2023 05:58:32 +0400 Subject: [PATCH 100/156] feat: add N-th Tribonacci number (#1202) * add leetcode n-th Tribonacci number * updating DIRECTORY.md * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] --- leetcode/DIRECTORY.md | 1 + leetcode/src/1137.c | 29 +++++++++++++++++++++++++++++ 2 files changed, 30 insertions(+) create mode 100644 leetcode/src/1137.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index f9a4f8d776..5d1843f7e4 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -119,6 +119,7 @@ | 1019 | [Next Greater Node In Linked List](https://leetcode.com/problems/next-greater-node-in-linked-list) | [C](./src/1019.c) | Medium | | 1026 | [Maximum Difference Between Node and Ancestor](https://leetcode.com/problems/maximum-difference-between-node-and-ancestor) | [C](./src/1026.c) | Medium | | 1089 | [Duplicate Zeros](https://leetcode.com/problems/duplicate-zeros) | [C](./src/1089.c) | Easy | +| 1137 | [N-th Tribonacci Number](https://leetcode.com/problems/n-th-tribonacci-number) | [C](./src/1137.c) | Easy | | 1147 | [Longest Chunked Palindrome Decomposition](https://leetcode.com/problems/longest-chunked-palindrome-decomposition) | [C](./src/1147.c) | Hard | | 1184 | [Distance Between Bus Stops](https://leetcode.com/problems/distance-between-bus-stops) | [C](./src/1184.c) | Easy | | 1189 | [Maximum Number of Balloons](https://leetcode.com/problems/maximum-number-of-balloons) | [C](./src/1189.c) | Easy | diff --git a/leetcode/src/1137.c b/leetcode/src/1137.c new file mode 100644 index 0000000000..0bb7fdc38a --- /dev/null +++ b/leetcode/src/1137.c @@ -0,0 +1,29 @@ +// Dynamic Programming +// Runtime: O(n) +// Space: O(1) +int tribonacci(int n){ + int t0 = 0; + int t1 = 1; + int t2 = 1; + + if (n == 0) { + return t0; + } + + if (n == 1){ + return t1; + } + + if (n == 2){ + return t2; + } + + for (int i = 0; i < n - 2; i++){ + int nextT = t0 + t1 + t2; + t0 = t1; + t1 = t2; + t2 = nextT; + } + + return t2; +} From 55d8023f06aea109d47fa7a833112c2096319726 Mon Sep 17 00:00:00 2001 From: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> Date: Sat, 4 Feb 2023 02:38:35 +0800 Subject: [PATCH 101/156] feat: add matrix chain order (#1198) * feat: add Matrix Chain Order * updating DIRECTORY.md * Update dynamic_programming/matrix_chain_order.c Co-authored-by: David Leal * Update dynamic_programming/matrix_chain_order.c Co-authored-by: David Leal * Update dynamic_programming/matrix_chain_order.c Co-authored-by: David Leal * Update matrix_chain_order.c * chore: apply suggestions from code review * chore: apply suggestions from code review * updating DIRECTORY.md * Update dynamic_programming/matrix_chain_order.c Co-authored-by: Taj * updating DIRECTORY.md * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] Co-authored-by: David Leal Co-authored-by: Taj --- DIRECTORY.md | 3 + dynamic_programming/matrix_chain_order.c | 91 ++++++++++++++++++++++++ 2 files changed, 94 insertions(+) create mode 100644 dynamic_programming/matrix_chain_order.c diff --git a/DIRECTORY.md b/DIRECTORY.md index 3fbbde138a..e460e5a517 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -123,6 +123,7 @@ ## Dynamic Programming * [Lcs](https://github.com/TheAlgorithms/C/blob/HEAD/dynamic_programming/lcs.c) + * [Matrix Chain Order](https://github.com/TheAlgorithms/C/blob/HEAD/dynamic_programming/matrix_chain_order.c) ## Exercism * Acronym @@ -180,6 +181,7 @@ * [11](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/11.c) * [110](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/110.c) * [112](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/112.c) + * [1137](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1137.c) * [1147](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1147.c) * [118](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/118.c) * [1184](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1184.c) @@ -304,6 +306,7 @@ * [977](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/977.c) * [98](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/98.c) * [985](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/985.c) + * [997](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/997.c) ## Machine Learning * [Adaline Learning](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/adaline_learning.c) diff --git a/dynamic_programming/matrix_chain_order.c b/dynamic_programming/matrix_chain_order.c new file mode 100644 index 0000000000..76c29bf1a4 --- /dev/null +++ b/dynamic_programming/matrix_chain_order.c @@ -0,0 +1,91 @@ +/** + * @file + * @brief [Matrix Chain Order](https://en.wikipedia.org/wiki/Matrix_chain_multiplication) + * @details + * From Wikipedia: Matrix chain multiplication (or the matrix chain ordering problem) + * is an optimization problem concerning the most efficient way to multiply a given sequence of matrices. + * The problem is not actually to perform the multiplications, + * but merely to decide the sequence of the matrix multiplications involved. + * @author [CascadingCascade](https://github.com/CascadingCascade) + */ + +#include /// for assert +#include /// for IO operations +#include /// for INT_MAX macro +#include /// for malloc() and free() + +/** + * @brief Finds the optimal sequence using the classic O(n^3) algorithm. + * @param l length of cost array + * @param p costs of each matrix + * @param s location to store results + * @returns number of operations + */ +int matrixChainOrder(int l,const int *p, int *s) { + // mat stores the cost for a chain that starts at i and ends on j (inclusive on both ends) + int mat[l][l]; + for (int i = 0; i < l; ++i) { + mat[i][i] = 0; + } + // cl denotes the difference between start / end indices, cl + 1 would be chain length. + for (int cl = 1; cl < l; ++cl) { + for (int i = 0; i < l - cl; ++i) { + int j = i + cl; + mat[i][j] = INT_MAX; + for (int div = i; div < j; ++div) { + int q = mat[i][div] + mat[div + 1][j] + p[i] * p[div] * p[j]; + if (q < mat[i][j]) { + mat[i][j] = q; + s[i * l + j] = div; + } + } + } + } + return mat[0][l - 1]; +} + +/** + * @brief Recursively prints the solution + * @param l dimension of the solutions array + * @param s solutions + * @param i starting index + * @param j ending index + * @returns void + */ +void printSolution(int l,int *s,int i,int j) { + if(i == j) { + printf("A%d",i); + return + } + putchar('('); + printSolution(l,s,i,s[i * l + j]); + printSolution(l,s,s[i * l + j] + 1,j); + putchar(')'); +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() { + int sizes[] = {35,15,5,10,20,25}; + int len = 6; + int *sol = malloc(len * len * sizeof(int)); + int r = matrixChainOrder(len,sizes,sol); + assert(r == 18625); + printf("Result : %d\n",r); + printf("Optimal ordering : "); + printSolution(len,sol,0,5); + free(sol); + + printf("\n"); +} + +/** + * @brief Main function + * @returns 0 + */ +int main() { + test(); // run self-test implementations + return 0; +} From 55f73501eac842ac12213aec766406562d603e49 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 4 Feb 2023 04:11:43 +0400 Subject: [PATCH 102/156] feat: add Distribute Coins in Binary Tree LeetCode (#1206) * add leetcode Distribute Coins in Binary Tree * updating DIRECTORY.md * Update 979.c fix review notes * Update leetcode/src/979.c Co-authored-by: David Leal * Update leetcode/src/979.c Co-authored-by: David Leal * Update leetcode/src/979.c Co-authored-by: David Leal * Update leetcode/src/979.c Co-authored-by: David Leal --------- Co-authored-by: github-actions[bot] Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/979.c | 47 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 48 insertions(+) create mode 100644 leetcode/src/979.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 5d1843f7e4..7e76feed98 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -112,6 +112,7 @@ | 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst) | [C](./src/938.c) | Easy | | 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree) | [C](./src/965.c) | Easy | | 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array) | [C](./src/977.c) | Easy | +| 979 | [Distribute Coins in Binary Tree](https://leetcode.com/problems/distribute-coins-in-binary-tree) | [C](./src/979.c) | Medium | | 985 | [Sum of Even Numbers After Queries](https://leetcode.com/problems/sum-of-even-numbers-after-queries) | [C](./src/985.c) | Medium | | 997 | [Find the Town Judge](https://leetcode.com/problems/find-the-town-judge) | [C](./src/997.c) | Easy | | 1008 | [Construct Binary Search Tree from Preorder Traversal](https://leetcode.com/problems/construct-binary-search-tree-from-preorder-traversal) | [C](./src/1008.c) | Medium | diff --git a/leetcode/src/979.c b/leetcode/src/979.c new file mode 100644 index 0000000000..b6ad8b1b95 --- /dev/null +++ b/leetcode/src/979.c @@ -0,0 +1,47 @@ +/** + * Definition for a binary tree node. + * struct TreeNode { + * int val; + * struct TreeNode *left; + * struct TreeNode *right; + * }; + */ + +struct NodeDistributeInfo { + int distributeMoves; + int distributeExcess; +}; + +struct NodeDistributeInfo* getDisturb(struct TreeNode* node) { + struct NodeDistributeInfo* result = malloc(sizeof(struct NodeDistributeInfo)); + + if (node == NULL) { + result->distributeMoves = 0; + result->distributeExcess = 1; + return result; + } + + struct NodeDistributeInfo* leftDistribute = getDisturb(node->left); + struct NodeDistributeInfo* rightDistribute = getDisturb(node->right); + + int coinsToLeft = 1 - leftDistribute->distributeExcess; + int coinsToRight = 1 - rightDistribute->distributeExcess; + + // Calculate moves as excess and depth between left and right subtrees. + result->distributeMoves = leftDistribute->distributeMoves + rightDistribute->distributeMoves + abs(coinsToLeft) + abs(coinsToRight); + result->distributeExcess = node->val - coinsToLeft - coinsToRight; + + free(leftDistribute); + free(rightDistribute); + + return result; +} + +// Depth-first search . +// On each node-step we try to recombinate coins between left and right subtree. +// We know that coins are the same number that nodes, and we can get coins by depth +// Runtime: O(n) +// Space: O(1) +int distributeCoins(struct TreeNode* root) { + return getDisturb(root)->distributeMoves; +} From 4830210f692894edbb851c0c51e4c732b9143fff Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Sat, 4 Feb 2023 16:51:01 +0400 Subject: [PATCH 103/156] add leetcode Verifying an Alien Dictionary (#1205) * add leetcode Verifying an Alien Dictionary * updating DIRECTORY.md * Update 953.c add blank line at the end --------- Co-authored-by: github-actions[bot] Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/953.c | 40 ++++++++++++++++++++++++++++++++++++++++ 2 files changed, 41 insertions(+) create mode 100644 leetcode/src/953.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 7e76feed98..8e0d621bf5 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -110,6 +110,7 @@ | 917 | [Reverse Only Letters](https://leetcode.com/problems/reverse-only-letters) | [C](./src/917.c) | Easy | | 931 | [Minimum Falling Path Sum](https://leetcode.com/problems/minimum-falling-path-sum) | [C](./src/931.c) | Medium | | 938 | [Range Sum of BST](https://leetcode.com/problems/range-sum-of-bst) | [C](./src/938.c) | Easy | +| 953 | [Verifying an Alien Dictionary](https://leetcode.com/problems/verifying-an-alien-dictionary) | [C](./src/953.c) | Easy | | 965 | [Univalued Binary Tree](https://leetcode.com/problems/univalued-binary-tree) | [C](./src/965.c) | Easy | | 977 | [Squares of a Sorted Array](https://leetcode.com/problems/squares-of-a-sorted-array) | [C](./src/977.c) | Easy | | 979 | [Distribute Coins in Binary Tree](https://leetcode.com/problems/distribute-coins-in-binary-tree) | [C](./src/979.c) | Medium | diff --git a/leetcode/src/953.c b/leetcode/src/953.c new file mode 100644 index 0000000000..cb13d85d1e --- /dev/null +++ b/leetcode/src/953.c @@ -0,0 +1,40 @@ +#define min(x, y) (((x) < (y)) ? (x) : (y)) + +bool isWordLess(char* word1, char* word2, int* charOrder){ + int word1Length = strlen(word1); + int word2Length = strlen(word2); + + for(int i = 0; i < min(word1Length, word2Length); i++) { + int charWordsDiff = (charOrder[word1[i] - 'a'] - charOrder[word2[i] - 'a']); + + if (charWordsDiff < 0){ + return true; + } + + if (charWordsDiff > 0){ + return false; + } + } + + return word1Length <= word2Length; +} + +// Keep array-hashtable of order letters. +// Runtime: O(n) +// Space: O(1) +bool isAlienSorted(char ** words, int wordsSize, char * order){ + const int lowerCaseLettersNumber = 26; + int charorder[lowerCaseLettersNumber]; + + for(int i = 0; i < lowerCaseLettersNumber; i++) { + charorder[order[i] - 'a'] = i; + } + + for(int i = 0; i < wordsSize - 1; i++) { + if (!isWordLess(words[i], words[i + 1], charorder)){ + return false; + } + } + + return true; +} From 2d505ccf1394c033e8441649aa573cabeb9d69d5 Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Mon, 6 Feb 2023 14:52:24 +0400 Subject: [PATCH 104/156] add leetcode Permutation in String (#1207) * add leetcode Permutation in String * updating DIRECTORY.md * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update leetcode/src/567.c Co-authored-by: Stepfen Shawn * Update 567.c fix review notes * Update 567.c remove redundant line --------- Co-authored-by: github-actions[bot] Co-authored-by: Stepfen Shawn --- leetcode/DIRECTORY.md | 1 + leetcode/src/567.c | 67 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 68 insertions(+) create mode 100644 leetcode/src/567.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 8e0d621bf5..a66c0a8269 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -91,6 +91,7 @@ | 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number) | [C](./src/509.c) | Easy | | 520 | [Detect Capital](https://leetcode.com/problems/detect-capital) | [C](./src/520.c) | Easy | | 561 | [Array Partition](https://leetcode.com/problems/array-partition) | [C](./src/561.c) | Easy | +| 567 | [Permutation in String](https://leetcode.com/problems/permutation-in-string) | [C](./src/567.c) | Medium | | 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees) | [C](./src/617.c) | Easy | | 647 | [Palindromic Substrings](https://leetcode.com/problems/palindromic-substrings) | [C](./src/647.c) | Medium | | 669 | [Trim a Binary Search Tree](https://leetcode.com/problems/trim-a-binary-search-tree) | [C](./src/669.c) | Medium | diff --git a/leetcode/src/567.c b/leetcode/src/567.c new file mode 100644 index 0000000000..268579a03d --- /dev/null +++ b/leetcode/src/567.c @@ -0,0 +1,67 @@ +const int EnglishLettersNumber = 26; + +void countCharsForStringSlice(int* charsCounter, char* s, int length, int sign) { + for (int i = 0; i < length; i++) { + + charsCounter[s[i] - 'a'] += sign; + } +} + +// Sliding window +// Calculate number of chars in the current slide. +// Runtime: O(n) +// Space: O(1) - only number of english lowercase letters. +bool checkInclusion(char* s1, char* s2) { + int lengthS1 = strlen(s1); + int lengthS2 = strlen(s2); + + if (lengthS1 > lengthS2) { + + return false; + } + + int* charsCounter = calloc(EnglishLettersNumber, sizeof(int)); + + // We keep counters of s1 with '-' sign. It has to be offset by s2 chars + countCharsForStringSlice(charsCounter, s1, lengthS1, -1); + countCharsForStringSlice(charsCounter, s2, lengthS1, 1); + + int diffChars = 0; + for (int i = 0; i < EnglishLettersNumber; i++) { + if (charsCounter[i] != 0) { + diffChars++; + } + } + + if (diffChars == 0) { + return true; + } + + for (int i = 0; i < lengthS2 - lengthS1; i++) { + int charNumberLeft = s2[i] - 'a'; + int charNumberRight = s2[i + lengthS1] - 'a'; + + charsCounter[charNumberLeft] -= 1; + if (charsCounter[charNumberLeft] == 0) { + diffChars -= 1; + } + else if (charsCounter[charNumberLeft] == -1) { + diffChars += 1; + } + + charsCounter[charNumberRight] += 1; + if (charsCounter[charNumberRight] == 0) { + diffChars -= 1; + } + else if (charsCounter[charNumberRight] == 1) { + diffChars += 1; + } + + if (diffChars == 0) { + return true; + } + } + + free(charsCounter); + return false; +} From 521db035ca251667011c424326acd0f9929e4f33 Mon Sep 17 00:00:00 2001 From: wtz Date: Tue, 21 Feb 2023 06:19:47 +0800 Subject: [PATCH 105/156] docs: fix minor typos in `data_structures/avl_tree.c` (#1218) --- data_structures/binary_trees/avl_tree.c | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/data_structures/binary_trees/avl_tree.c b/data_structures/binary_trees/avl_tree.c index 67d24ae0c6..604638735d 100644 --- a/data_structures/binary_trees/avl_tree.c +++ b/data_structures/binary_trees/avl_tree.c @@ -169,12 +169,12 @@ avlNode *delete (avlNode *node, int queryNum) delete (node->right, queryNum); /*Recursive deletion in R subtree*/ else { - /*Single or No Child*/ + /*Single or No Children*/ if ((node->left == NULL) || (node->right == NULL)) { avlNode *temp = node->left ? node->left : node->right; - /* No Child*/ + /* No Children*/ if (temp == NULL) { temp = node; @@ -187,7 +187,7 @@ avlNode *delete (avlNode *node, int queryNum) } else { - /*Two Child*/ + /*Two Children*/ /*Get the smallest key in the R subtree*/ avlNode *temp = minNode(node->right); From 5bf2c42bff08f215d73a2daf8d133b39765aef37 Mon Sep 17 00:00:00 2001 From: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> Date: Tue, 21 Feb 2023 06:47:26 +0800 Subject: [PATCH 106/156] feat: add Patience Sort algorithm (#1212) * updating DIRECTORY.md * updating DIRECTORY.md * feat: Add Patience Sort https://en.wikipedia.org/wiki/Patience_sorting * updating DIRECTORY.md * Update sorting/patience_sort.c Co-authored-by: David Leal * Update sorting/patience_sort.c Co-authored-by: David Leal --------- Co-authored-by: github-actions[bot] Co-authored-by: David Leal --- DIRECTORY.md | 4 + sorting/patience_sort.c | 160 ++++++++++++++++++++++++++++++++++++++++ 2 files changed, 164 insertions(+) create mode 100644 sorting/patience_sort.c diff --git a/DIRECTORY.md b/DIRECTORY.md index e460e5a517..399667690b 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -271,6 +271,7 @@ * [520](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/520.c) * [53](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/53.c) * [561](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/561.c) + * [567](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/567.c) * [6](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/6.c) * [617](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/617.c) * [62](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/62.c) @@ -302,8 +303,10 @@ * [931](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/931.c) * [938](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/938.c) * [94](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/94.c) + * [953](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/953.c) * [965](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/965.c) * [977](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/977.c) + * [979](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/979.c) * [98](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/98.c) * [985](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/985.c) * [997](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/997.c) @@ -476,6 +479,7 @@ * [Odd Even Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/odd_even_sort.c) * [Pancake Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/pancake_sort.c) * [Partition Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/partition_sort.c) + * [Patience Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/patience_sort.c) * [Pigeonhole Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/pigeonhole_sort.c) * [Quick Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/quick_sort.c) * [Radix Sort](https://github.com/TheAlgorithms/C/blob/HEAD/sorting/radix_sort.c) diff --git a/sorting/patience_sort.c b/sorting/patience_sort.c new file mode 100644 index 0000000000..5e069bf240 --- /dev/null +++ b/sorting/patience_sort.c @@ -0,0 +1,160 @@ +/** + * @file + * @brief [Patience Sort](https://en.wikipedia.org/wiki/Patience_sorting) + * @details From Wikipedia: + * In computer science, patience sorting is a sorting algorithm inspired by, and named after, the card game patience. + * Given an array of n elements from some totally ordered domain, consider this array as a collection of cards and simulate the patience sorting game. + * When the game is over, recover the sorted sequence by repeatedly picking off the minimum visible card; + * in other words, perform a k-way merge of the p piles, each of which is internally sorted. + * @author [CascadingCascade](https://github.com/CascadingCascade) + */ + +#include /// for assertions +#include /// for IO operations +#include /// for memory management + +/** + * @brief Sorts the target array by dividing it into a variable number of internally sorted piles then merge the piles + * @param array pointer to the array to be sorted + * @param length length of the target array + * @returns void + */ +void patienceSort(int *array, int length) { + // An array of pointers used to store each pile + int* *piles = (int* *) malloc(sizeof(int*) * length); + for (int i = 0; i < length; ++i) { + piles[i] = malloc(sizeof(int) * length); + } + + // pileSizes keep track of the indices of each pile's topmost element, hence 0 means only one element + // Note how calloc() is used to initialize the sizes of all piles to zero + int *pileSizes = (int*) calloc(length,sizeof(int)); + + // This initializes the first pile, note how using an array of pointers allowed us to access elements through two subscripts + // The first subscript indicates which pile we are accessing, the second subscript indicates the location being accessed in that pile + piles[0][0] = array[0]; + int pileCount = 1; + + for (int i = 1; i < length; ++i) { + // This will be used to keep track whether an element has been added to an existing pile + int flag = 1; + + for (int j = 0; j < pileCount; ++j) { + if(piles[j][pileSizes[j]] > array[i]) { + // We have found a pile this element can be added to + piles[j][pileSizes[j] + 1] = array[i]; + pileSizes[j]++; + flag--; + break; + } + } + + if(flag) { + // The element in question can not be added to any existing piles, creating a new pile + piles[pileCount][0] = array[i]; + pileCount++; + } + } + + // This will keep track of the minimum value of all 'exposed' elements and which pile that value is from + int min, minLocation; + + for (int i = 0; i < length; ++i) { + // Since there's no guarantee the first pile will be depleted slower than other piles, + // Example: when all elements are equal, in that case the first pile will be depleted immediately + // We can't simply initialize min to the top most element of the first pile, + // this loop finds a value to initialize min to. + for (int j = 0; j < pileCount; ++j) { + if(pileSizes[j] < 0) { + continue; + } + min = piles[j][pileSizes[j]]; + minLocation = j; + break; + } + + for (int j = 0; j < pileCount; ++j) { + if(pileSizes[j] < 0) { + continue; + } + if(piles[j][pileSizes[j]] < min) { + min = piles[j][pileSizes[j]]; + minLocation = j; + } + } + + array[i] = min; + pileSizes[minLocation]--; + } + + // Deallocate memory + free(pileSizes); + for (int i = 0; i < length; ++i) { + free(piles[i]); + } + free(piles); +} + +/** + * @brief Helper function to print an array + * @param array pointer to the array + * @param length length of the target array + * @returns void + */ +void printArray(int *array,int length) { + printf("Array:"); + for (int i = 0; i < length; ++i) { + printf("%d",array[i]); + if (i != length - 1) putchar(','); + } + putchar('\n'); +} + +/** + * @brief Testing Helper function + * @param array pointer to the array to be used for testing + * @param length length of the target array + * @returns void + */ + +void testArray(int *array,int length) { + printf("Before sorting:\n"); + printArray(array,length); + + patienceSort(array,length); + + printf("After sorting:\n"); + printArray(array,length); + + for (int i = 0; i < length - 1; ++i) { + assert(array[i] <= array[i + 1]); + } + printf("All assertions have passed!\n\n"); +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() { + int testArray1[] = {2,8,7,1,3,5,6,4}; + int testArray2[] = {2,2,5,1,3,5,6,4}; + int testArray3[] = {1,2,3,4,5,6,7,8}; + int testArray4[] = {8,7,6,5,4,3,2,1}; + + testArray(testArray1,8); + testArray(testArray2,8); + testArray(testArray3,8); + testArray(testArray4,8); + + printf("Testing successfully completed!\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() { + test(); // run self-test implementations + return 0; +} From 5d3a841aa6256308f2e15206ab44b522c9e72034 Mon Sep 17 00:00:00 2001 From: Mindaugas <76015221+mindaugl@users.noreply.github.com> Date: Tue, 21 Feb 2023 10:55:09 +0000 Subject: [PATCH 107/156] feat: add solution for the 3Sum Closest problem (#16) (#1216) * feat: add solution for the 3Sum Closest problem (#16) * fix: Update formatting * fix: update compare function to avoid overflow in generic case * chore: apply suggestions from code review --------- Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/16.c | 30 ++++++++++++++++++++++++++++++ 2 files changed, 31 insertions(+) create mode 100644 leetcode/src/16.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index a66c0a8269..87489a6d25 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -18,6 +18,7 @@ | 12 | [Integer to Roman](https://leetcode.com/problems/integer-to-roman) | [C](./src/12.c) | Medium | | 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer) | [C](./src/13.c) | Easy | | 14 | [Longest Common Prefix](https://leetcode.com/problems/longest-common-prefix) | [C](./src/14.c) | Easy | +| 16 | [3Sum Closest](https://leetcode.com/problems/3sum-closest) | [C](./src/16.c) | Medium | | 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses) | [C](./src/20.c) | Easy | | 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists) | [C](./src/21.c) | Easy | | 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs) | [C](./src/24.c) | Medium | diff --git a/leetcode/src/16.c b/leetcode/src/16.c new file mode 100644 index 0000000000..a3d1cd7ea6 --- /dev/null +++ b/leetcode/src/16.c @@ -0,0 +1,30 @@ +#include // for qsort() + +int cmp(const void* a, const void* b) { + const int *A = a, *B = b; + return (*A > *B) - (*A < *B); +} + +int threeSumClosest(int* nums, int nums_size, int target) { + int i, j, k, result, sum3; + qsort(nums, nums_size, sizeof(int), cmp); + result = nums[0] + nums[1] + nums[2]; + for (i = 0; i < nums_size - 2; i++) { + j = i + 1; + k = nums_size - 1; + while (j < k) { + sum3 = nums[i] + nums[j] + nums[k]; + if (abs(target - sum3) < abs(target - result)) { + result = sum3; + } + if (sum3 < target) { + j++; + } else if (sum3 > target) { + k--; + } else { + return sum3; + } + } + } + return result; +} From f6a326b268b3e1a0213bdff57d3fb044ce3f8b8a Mon Sep 17 00:00:00 2001 From: Heber Alturria <110596115+HeberDamianAlturria@users.noreply.github.com> Date: Thu, 23 Feb 2023 14:32:04 -0300 Subject: [PATCH 108/156] feat: add LeetCode problem 540 (#1217) * feat: add LeetCode problem 540 * feat: Added a description to the LeetCode problem 540 * feat: Added details in the description of the LeetCode problem 540 * feat: Changed a word in @details of the LeetCode problem 540 --- leetcode/DIRECTORY.md | 1 + leetcode/src/540.c | 32 ++++++++++++++++++++++++++++++++ 2 files changed, 33 insertions(+) create mode 100644 leetcode/src/540.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 87489a6d25..a7ccca3ad8 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -91,6 +91,7 @@ | 485 | [Max Consecutive Ones](https://leetcode.com/problems/max-consecutive-ones) | [C](./src/485.c) | Easy | | 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number) | [C](./src/509.c) | Easy | | 520 | [Detect Capital](https://leetcode.com/problems/detect-capital) | [C](./src/520.c) | Easy | +| 540 | [Single Element in a Sorted Array](https://leetcode.com/problems/single-element-in-a-sorted-array/) | [C](./src/540.c) | Medium | | 561 | [Array Partition](https://leetcode.com/problems/array-partition) | [C](./src/561.c) | Easy | | 567 | [Permutation in String](https://leetcode.com/problems/permutation-in-string) | [C](./src/567.c) | Medium | | 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees) | [C](./src/617.c) | Easy | diff --git a/leetcode/src/540.c b/leetcode/src/540.c new file mode 100644 index 0000000000..094bb132b0 --- /dev/null +++ b/leetcode/src/540.c @@ -0,0 +1,32 @@ +/** + * Time complexity: O(log n). + * Space complexity: O(1). + * @details The array has a pattern that consists in of the existing sub-array to + * the left of the non-repeating number will satisfy the condition that + * each pair of repeated elements have their first occurrence at the even index + * and their second occurrence at the odd index, and that the sub-array to + * the right of the non-repeating number will satisfy the condition that + * each pair of repeated elements have their first occurrence at the odd index + * and their second occurrence at the even index. With this pattern in mind, + * we can solve the problem using binary search. + */ + +int singleNonDuplicate(int* nums, int numsSize) { + int left = 0, right = numsSize - 1; + while (left < right) { + int mid = (right + left) / 2; + if (mid % 2 == 0) { + if (nums[mid] == nums[mid + 1]) + left = mid + 2; + else + right = mid; + } + else { + if (nums[mid] == nums[mid - 1]) + left = mid + 1; + else + right = mid - 1; + } + } + return nums[left]; +} From 6e94adf066b87efb14036a9ba08189440cd02736 Mon Sep 17 00:00:00 2001 From: Mindaugas <76015221+mindaugl@users.noreply.github.com> Date: Sat, 25 Feb 2023 20:35:50 +0000 Subject: [PATCH 109/156] feat: add Longest Palindrome Substring solution (#1210) * feat: add Longest Palindrome Substring solution * fix: update formatting and allocate new results string * fix: update formatting, fix bug related to the string copy * fix: add parantheses for one line if statement * fix: add comments for library inclusions --- leetcode/DIRECTORY.md | 1 + leetcode/src/5.c | 52 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 53 insertions(+) create mode 100644 leetcode/src/5.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index a7ccca3ad8..c08cde1151 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -9,6 +9,7 @@ | 2 | [Add Two Numbers](https://leetcode.com/problems/add-two-numbers) | [C](./src/2.c) | Medium | | 3 | [Longest Substring Without Repeating Characters](https://leetcode.com/problems/longest-substring-without-repeating-characters) | [C](./src/3.c) | Medium | | 4 | [Median of Two Sorted Arrays](https://leetcode.com/problems/median-of-two-sorted-arrays) | [C](./src/4.c) | Hard | +| 5 | [Longest Palindromic Substring](https://leetcode.com/problems/longest-palindromic-substring) | [C](./src/5.c) | Medium | | 6 | [Zigzag Conversion](https://leetcode.com/problems/zigzag-conversion) | [C](./src/6.c) | Medium | | 7 | [Reverse Integer](https://leetcode.com/problems/reverse-integer) | [C](./src/7.c) | Medium | | 8 | [String to Integer (atoi)](https://leetcode.com/problems/string-to-integer-atoi) | [C](./src/8.c) | Medium | diff --git a/leetcode/src/5.c b/leetcode/src/5.c new file mode 100644 index 0000000000..e54bf598da --- /dev/null +++ b/leetcode/src/5.c @@ -0,0 +1,52 @@ +/** + * Find longest palindrome by traversing the string and checking how + * long palindrome can be constructed from each element by going left and right. + * Checking palindromes of types '..aa..' and '..bab..' + */ + +#include /// for allocating new string via malloc() +#include /// for copying the contents of the string via strncpy() + +char * longestPalindrome(char * s) { + int si_max = 0, ei_max = 0, sz_max = 0, sz, i, delta_i; + char ch, *s_longest; + if (s[1] == '\0') return s; + + for (ch = s[1], i = 1; ch != '\0'; ch = s[++i]) { + if (s[i - 1] == ch) { + sz = 2; + delta_i = 1; + while (i - 1 - delta_i >= 0 && s[i + delta_i] != '\0' && s[i - 1 - delta_i] == s[i + delta_i]) { + sz += 2; + delta_i += 1; + } + if (sz > sz_max) { + sz_max = sz; + si_max = i - 1 - delta_i + 1; + ei_max = i + delta_i - 1; + } + } + } + + for (ch = s[0], i = 1; ch != '\0'; ch = s[++i]) { + sz = 1; + delta_i = 1; + while (i - delta_i >= 0 && s[i + delta_i] != '\0' && s[i - delta_i] == s[i + delta_i]) { + sz += 2; + delta_i += 1; + } + if (sz > sz_max) { + sz_max = sz; + si_max = i - delta_i + 1; + ei_max = i + delta_i - 1; + } + } + + if ((s_longest = (char *) malloc(sizeof(s))) == NULL) { + return NULL; + } + strncpy(s_longest, s + si_max, sz_max); + s_longest[sz_max] = '\0'; + + return s_longest; +} From 59dc816c9db4d2613b2f0f869752599e3bc9b525 Mon Sep 17 00:00:00 2001 From: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> Date: Tue, 28 Feb 2023 07:05:50 +0800 Subject: [PATCH 110/156] feat: add Shunting Yard Algorithm (#1219) * Create shunting_yard.c * updating DIRECTORY.md * Update shunting_yard.c * Update shunting_yard.c * Update shunting_yard.c * updating DIRECTORY.md * Update shunting_yard.c * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] Co-authored-by: David Leal --- DIRECTORY.md | 4 + misc/shunting_yard.c | 238 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 242 insertions(+) create mode 100644 misc/shunting_yard.c diff --git a/DIRECTORY.md b/DIRECTORY.md index 399667690b..4196787c63 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -200,6 +200,7 @@ * [142](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/142.c) * [1524](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1524.c) * [153](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/153.c) + * [16](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/16.c) * [160](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/160.c) * [1653](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1653.c) * [1657](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1657.c) @@ -266,10 +267,12 @@ * [461](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/461.c) * [476](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/476.c) * [485](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/485.c) + * [5](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/5.c) * [50](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/50.c) * [509](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/509.c) * [520](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/520.c) * [53](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/53.c) + * [540](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/540.c) * [561](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/561.c) * [567](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/567.c) * [6](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/6.c) @@ -354,6 +357,7 @@ * [Rot13](https://github.com/TheAlgorithms/C/blob/HEAD/misc/rot13.c) * [Rselect](https://github.com/TheAlgorithms/C/blob/HEAD/misc/rselect.c) * [Run Length Encoding](https://github.com/TheAlgorithms/C/blob/HEAD/misc/run_length_encoding.c) + * [Shunting Yard](https://github.com/TheAlgorithms/C/blob/HEAD/misc/shunting_yard.c) * [Sudoku Solver](https://github.com/TheAlgorithms/C/blob/HEAD/misc/sudoku_solver.c) * [Tower Of Hanoi](https://github.com/TheAlgorithms/C/blob/HEAD/misc/tower_of_hanoi.c) * [Union Find](https://github.com/TheAlgorithms/C/blob/HEAD/misc/union_find.c) diff --git a/misc/shunting_yard.c b/misc/shunting_yard.c new file mode 100644 index 0000000000..7cf7bc44b2 --- /dev/null +++ b/misc/shunting_yard.c @@ -0,0 +1,238 @@ +/** + * @file + * @brief [Shunting Yard Algorithm](https://en.wikipedia.org/wiki/Shunting_yard_algorithm) + * @details From Wikipedia: In computer science, + * the shunting yard algorithm is a method for parsing arithmetical or logical expressions, or a combination of both, specified in infix notation. + * It can produce either a postfix notation string, also known as Reverse Polish notation (RPN), or an abstract syntax tree (AST). + * The algorithm was invented by Edsger Dijkstra and named the "shunting yard" algorithm because its operation resembles that of a railroad shunting yard. + * @author [CascadingCascade](https://github.com/CascadingCascade) + */ + +#include /// for assertion +#include /// for IO operations +#include /// for memory management +#include /// for string operations +#include /// for isdigit() + +/** + * @brief Helper function that returns each operator's precedence + * @param operator the operator to be queried + * @returns the operator's precedence + */ +int getPrecedence(char operator) { + switch (operator) { + case '+': + case '-': { + return 1; + } + case '*': + case '/': { + return 2; + } + case '^': { + return 3; + } + default:{ + fprintf(stderr,"Error: Invalid operator\n"); + return -1; + } + } +} + +/** + * @brief Helper function that returns each operator's associativity + * @param operator the operator to be queried + * @returns '1' if the operator is left associative + * @returns '0' if the operator is right associative + */ +int getAssociativity(char operator) { + switch (operator) { + case '^': { + return 0; + } + case '+': + case '-': + case '*': + case '/': { + return 1; + } + default: { + fprintf(stderr,"Error: Invalid operator\n"); + return -1; + } + } +} + +/** + * @brief An implementation of the shunting yard that converts infix notation to reversed polish notation + * @param input pointer to input string + * @param output pointer to output location + * @returns `1` if a parentheses mismatch is detected + * @returns `0` if no mismatches are detected + */ +int shuntingYard(const char *input, char *output) { + const unsigned int inputLength = strlen(input); + char* operatorStack = (char*) malloc(sizeof(char) * inputLength); + + // This pointer points at where we should insert the next element, + // Hence stackPointer - 1 is used when accessing elements + unsigned int stackPointer = 0; + + // We will parse the input with strtok(), + // Since strtok() is destructive, we make a copy of the input to preserve the original string + char* str = malloc(sizeof(char) * inputLength + 1); + strcpy(str,input); + char* token = strtok(str," "); + + // We will push to output with strcat() and strncat(), + // This initializes output to be a string with a length of zero + output[0] = '\0'; + + while (token != NULL) { + // If it's a number, push it to the output directly + if (isdigit(token[0])) { + strcat(output,token); + strcat(output," "); + + token = strtok(NULL," "); + continue; + } + + switch (token[0]) { + // If it's a left parenthesis, push it to the operator stack for later matching + case '(': { + operatorStack[stackPointer++] = token[0]; + break; + } + + // If it's a right parenthesis, search for a left parenthesis to match it + case ')': { + // Guard statement against accessing an empty stack + if(stackPointer < 1) { + fprintf(stderr,"Error: Mismatched parentheses\n"); + free(operatorStack); + free(str); + return 1; + } + + while (operatorStack[stackPointer - 1] != '(') { + // strncat() with a count of 1 is used to append characters to output + const unsigned int i = (stackPointer--) - 1; + strncat(output, &operatorStack[i], 1); + strcat(output," "); + + // If the operator stack is exhausted before a match can be found, + // There must be a mismatch + if(stackPointer == 0) { + fprintf(stderr,"Error: Mismatched parentheses\n"); + free(operatorStack); + free(str); + return 1; + } + } + + // Discards the parentheses now the matching is complete, + // Simply remove the left parenthesis from the stack is enough, + // Since the right parenthesis didn't enter the stack in the first place + stackPointer--; + break; + } + + // If it's an operator(o1), we compare it to whatever is at the top of the operator stack(o2) + default: { + // Places the operator into the stack directly if it's empty + if(stackPointer < 1) { + operatorStack[stackPointer++] = token[0]; + break; + } + + // We need to check if there's actually a valid operator at the top of the stack + if((stackPointer - 1 > 0) && operatorStack[stackPointer - 1] != '(') { + const int precedence1 = getPrecedence(token[0]); + const int precedence2 = getPrecedence(operatorStack[stackPointer - 1]); + const int associativity = getAssociativity(token[0]); + + // We pop operators from the stack, if... + while ( // ... their precedences are equal, and o1 is left associative, ... + ((associativity && precedence1 == precedence2) || + // ... or o2 simply have a higher precedence, ... + precedence2 > precedence1) && + // ... and there are still operators available to be popped. + ((stackPointer - 1 > 0) && operatorStack[stackPointer - 1] != '(')) { + + strncat(output,&operatorStack[(stackPointer--) - 1],1); + strcat(output," "); + } + } + + // We'll save o1 for later + operatorStack[stackPointer++] = token[0]; + break; + } + } + + token = strtok(NULL," "); + } + + free(str); + + // Now all input has been exhausted, + // Pop everything from the operator stack, then push them to the output + while (stackPointer > 0) { + // If there are still leftover left parentheses in the stack, + // There must be a mismatch + if(operatorStack[stackPointer - 1] == '(') { + fprintf(stderr,"Error: Mismatched parentheses\n"); + free(operatorStack); + return 1; + } + + const unsigned int i = (stackPointer--) - 1; + strncat(output, &operatorStack[i], 1); + if (i != 0) { + strcat(output," "); + } + } + + free(operatorStack); + return 0; +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() { + char* in = malloc(sizeof(char) * 50); + char* out = malloc(sizeof(char) * 50); + int i; + + strcpy(in,"3 + 4 * ( 2 - 1 )"); + printf("Infix: %s\n",in); + i = shuntingYard(in, out); + printf("RPN: %s\n",out); + printf("Return code: %d\n\n",i); + assert(strcmp(out,"3 4 2 1 - * +") == 0); + assert(i == 0); + + strcpy(in,"3 + 4 * 2 / ( 1 - 5 ) ^ 2 ^ 3"); + printf("Infix: %s\n",in); + i = shuntingYard(in, out); + printf("RPN: %s\n",out); + printf("Return code: %d\n\n",i); + assert(strcmp(out,"3 4 2 * 1 5 - 2 3 ^ ^ / +") == 0); + assert(i == 0); + + printf("Testing successfully completed!\n"); + free(in); + free(out); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() { + test(); // Run self-test implementations + return 0; +} From 0bc8f7a5766e509d191ae8a2ac616fdfa214d49e Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Tue, 28 Feb 2023 10:55:09 +0400 Subject: [PATCH 111/156] feat: add LeetCode jump game II (#1213) * add leetcode Jump Game II * updating DIRECTORY.md * Update 45.c free correct resources * Update leetcode/src/45.c Co-authored-by: David Leal * Update leetcode/src/45.c Co-authored-by: David Leal * Update leetcode/src/45.c Co-authored-by: David Leal * Update leetcode/src/45.c Co-authored-by: David Leal * Update leetcode/src/45.c Co-authored-by: David Leal * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 3 ++- leetcode/src/45.c | 50 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 52 insertions(+), 1 deletion(-) create mode 100644 leetcode/src/45.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index c08cde1151..61afbda40b 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -32,6 +32,7 @@ | 37 | [Sudoku Solver](https://leetcode.com/problems/sudoku-solver) | [C](./src/37.c) | Hard | | 38 | [Count and Say](https://leetcode.com/problems/count-and-say) | [C](./src/38.c) | Medium | | 42 | [Trapping Rain Water](https://leetcode.com/problems/trapping-rain-water) | [C](./src/42.c) | Hard | +| 45 | [Jump Game II](https://leetcode.com/problems/jump-game-ii) | [C](./src/45.c) | Medium | | 50 | [Pow(x, n)](https://leetcode.com/problems/powx-n) | [C](./src/50.c) | Medium | | 53 | [Maximum Subarray](https://leetcode.com/problems/maximum-subarray) | [C](./src/53.c) | Medium | | 62 | [Unique Paths](https://leetcode.com/problems/unique-paths) | [C](./src/62.c) | Medium | @@ -92,7 +93,7 @@ | 485 | [Max Consecutive Ones](https://leetcode.com/problems/max-consecutive-ones) | [C](./src/485.c) | Easy | | 509 | [Fibonacci Number](https://leetcode.com/problems/fibonacci-number) | [C](./src/509.c) | Easy | | 520 | [Detect Capital](https://leetcode.com/problems/detect-capital) | [C](./src/520.c) | Easy | -| 540 | [Single Element in a Sorted Array](https://leetcode.com/problems/single-element-in-a-sorted-array/) | [C](./src/540.c) | Medium | +| 540 | [Single Element in a Sorted Array](https://leetcode.com/problems/single-element-in-a-sorted-array) | [C](./src/540.c) | Medium | | 561 | [Array Partition](https://leetcode.com/problems/array-partition) | [C](./src/561.c) | Easy | | 567 | [Permutation in String](https://leetcode.com/problems/permutation-in-string) | [C](./src/567.c) | Medium | | 617 | [Merge Two Binary Trees](https://leetcode.com/problems/merge-two-binary-trees) | [C](./src/617.c) | Easy | diff --git a/leetcode/src/45.c b/leetcode/src/45.c new file mode 100644 index 0000000000..4deaab4594 --- /dev/null +++ b/leetcode/src/45.c @@ -0,0 +1,50 @@ +// Breadth-first search, imitation. +// Runtime: O(n) +// Space: O(n) +int jump(int* nums, int numsSize) { + if (numsSize == 1) { + return 0; + } + + int step = 1; + int* visitedCells = calloc(numsSize, sizeof(int)); + + int* queue = malloc(numsSize * sizeof(int)); + queue[0] = 0; + int queueLength = 1; + + while (queueLength > 0){ + int* nextQueue = malloc(numsSize * sizeof(int)); + int nextQueueLength = 0; + + for (int i = 0; i < queueLength; i++) { + int cell = queue[i]; + int jump = nums[cell]; + + if (cell + jump >= numsSize - 1) { + free(visitedCells); + free(queue); + free(nextQueue); + return step; + } + + // populate next queue wave for searching + for (int nextCell = cell; nextCell <= cell + jump; nextCell++) { + if (visitedCells[nextCell] == 0){ + nextQueue[nextQueueLength++] = nextCell; + visitedCells[nextCell] = 1; + } + } + } + + step++; + free(queue); + + queue = nextQueue; + queueLength = nextQueueLength; + } + + free(visitedCells); + free(queue); + return -1; +} From 3c8f86e740a0ef136f7acae713afabc11e47c352 Mon Sep 17 00:00:00 2001 From: Mindaugas <76015221+mindaugl@users.noreply.github.com> Date: Tue, 28 Feb 2023 07:17:31 +0000 Subject: [PATCH 112/156] feat: add Letter combinations of phone book problem (#1221) * feat: add Letter combinations of phone book problem (#17) * fix: add newline at the end of the file * fix: add brief description of the algorithm --------- Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/17.c | 78 +++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 79 insertions(+) create mode 100644 leetcode/src/17.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 61afbda40b..4c124798bc 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -20,6 +20,7 @@ | 13 | [Roman to Integer](https://leetcode.com/problems/roman-to-integer) | [C](./src/13.c) | Easy | | 14 | [Longest Common Prefix](https://leetcode.com/problems/longest-common-prefix) | [C](./src/14.c) | Easy | | 16 | [3Sum Closest](https://leetcode.com/problems/3sum-closest) | [C](./src/16.c) | Medium | +| 17 | [Letter Combinations of a Phone Number](https://leetcode.com/problems/letter-combinations-of-a-phone-number) | [C](./src/17.c) | Medium | | 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses) | [C](./src/20.c) | Easy | | 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists) | [C](./src/21.c) | Easy | | 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs) | [C](./src/24.c) | Medium | diff --git a/leetcode/src/17.c b/leetcode/src/17.c new file mode 100644 index 0000000000..ff6e77d048 --- /dev/null +++ b/leetcode/src/17.c @@ -0,0 +1,78 @@ +/** + * Letter Combinations of a Phone Number problem + * The algorithm determines the final size of the return array (combs) and allocates + * corresponding letter for each element, assuming that the return array is alphabetically sorted. + * It does so by running two loops for each letter: + * - the first loop determines the starting positions of the sequence of subsequent letter positions + * - the second loop determines the length of each subsequent sequence for each letter + * The size and space complexity are both O("size of final array"), as even though there are 4 loops, + * each element in the final array is accessed only once. + */ + +#include // for the malloc() function +#include // for the strlen() function + +char *get_letters(char digit) { + switch (digit) { + case '2': + return "abc"; + case '3': + return "def"; + case '4': + return "ghi"; + case '5': + return "jkl"; + case '6': + return "mno"; + case '7': + return "pqrs"; + case '8': + return "tuv"; + case '9': + return "wxyz"; + default: + return ""; + } +} + +char **letterCombinations(char *digits, int *return_size) { + char *cp; + int i, j, k, l, ind, k_tot, l_tot, digits_size = 0; + + if (*digits == '\0') { + *return_size = 0; + return NULL; + } + + *return_size = 1; + cp = digits; + while (*cp != '\0') { + *return_size *= strlen(get_letters(*cp)); + digits_size++; + cp++; + } + + char **combs = malloc(sizeof(char*) * (*return_size)); + for (i = 0; i < *return_size; i++) { + combs[i] = malloc(sizeof(char) * (digits_size + 1)); + combs[i][digits_size] = '\0'; + } + + k_tot = 1; + l_tot = (*return_size); + for (i = 0; i < digits_size; i++) { // loop accross digits + cp = get_letters(digits[i]); + l_tot /= strlen(cp); + for (j = 0; j < strlen(cp); j++) { // loop accross letters of the digit + for (k = 0; k < k_tot; k++) { // loop across the subset starting positions for each letter + for (l = 0; l < l_tot; l++) { // loop accross each subset positions for each letter + ind = k * l_tot * strlen(cp) + l + l_tot * j; + combs[ind][i] = cp[j]; + } + } + } + k_tot *= strlen(cp); + } + + return combs; +} From 1cfb88c5ebed78a346f4eda256df6c56184a1a1e Mon Sep 17 00:00:00 2001 From: Alexander Pantyukhin Date: Wed, 1 Mar 2023 06:28:06 +0400 Subject: [PATCH 113/156] docs: update the LeetCode contributing guide (#1225) * Update README.md Remove not actual information regrading the solutions list. Now it's updated automaticaly. * updating DIRECTORY.md * Update README.md add note about automatically updating the `DIRECTORY.md` file * Update leetcode/README.md Co-authored-by: David Leal * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] Co-authored-by: David Leal --- DIRECTORY.md | 2 ++ leetcode/README.md | 12 ++---------- 2 files changed, 4 insertions(+), 10 deletions(-) diff --git a/DIRECTORY.md b/DIRECTORY.md index 4196787c63..f8ac382e01 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -206,6 +206,7 @@ * [1657](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1657.c) * [169](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/169.c) * [1695](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1695.c) + * [17](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/17.c) * [1704](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1704.c) * [173](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/173.c) * [1752](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1752.c) @@ -264,6 +265,7 @@ * [404](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/404.c) * [42](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/42.c) * [442](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/442.c) + * [45](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/45.c) * [461](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/461.c) * [476](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/476.c) * [485](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/485.c) diff --git a/leetcode/README.md b/leetcode/README.md index 47c2b5836e..8f938b440a 100644 --- a/leetcode/README.md +++ b/leetcode/README.md @@ -39,16 +39,8 @@ If you have a solution to any of these problems (which are not being [**repeated 4. Doxygen documentation isn't used in LeetCode solutions. Simple/small documentation or comments should be fine. 5. Don't include libraries/headers such as `stdio.h`. Your file should be the solution to the problem only. -### 📜 Adding your new solution to the list 📜 - -Great! You've added your solution. Now, you'll have to add it to `leetcode/DIRECTORY.md`.\ -Please use numerical order. For example: if the solution's number is `98`, add your solution after `97`, if available. - -This is the required format for new solutinos: - -```markdown -| | []() | [C](./src/.c) | | -``` +> **Note** +> There was a requirement to update the `leetcode/DIRECTORY.md` file with details of the solved problem. It's not required anymore. The information about the problem is fetched automatically throughout the LeetCode API. ## 📦 Committing your changes 📦 From f141ae41666810e71b85aad34428abd66f31df4e Mon Sep 17 00:00:00 2001 From: Sahil Kandhare Date: Fri, 3 Mar 2023 05:00:56 +0530 Subject: [PATCH 114/156] feat: add Circular Doubly Linked List implementation (#1038) * Create circular_doubly_linked_list.c * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update circular_doubly_linked_list.c Added brief description of library files * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update circular_doubly_linked_list.c Done the all suggested changes. * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update circular_doubly_linked_list.c * updating DIRECTORY.md * updating DIRECTORY.md * updating DIRECTORY.md * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * There was typo while calling delete_first_node ! * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: David Leal * updating DIRECTORY.md * Suggested changes are done. Done the suggested changes in functions 1. delete_first_node() 2. delete_last_node() * updating DIRECTORY.md * updating DIRECTORY.md * Worked on Suggested Changes * Suggested changes are done. * Update circular_doubly_linked_list.c Worked on all the suggested changes. Co-Authored-By: David Leal Co-Authored-By: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> Co-Authored-By: Taj * updating DIRECTORY.md * updating DIRECTORY.md * Worked on suggested changes for test cases. Check the code's functionality [here](https://leetcode.com/playground/WcRBMWa8) Co-Authored-By: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> * updating DIRECTORY.md * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> * Update circular_doubly_linked_list.c Update: Worked on suggested changes. * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> * Update data_structures/linked_list/circular_doubly_linked_list.c Co-authored-by: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> * Worked on suggested changes. * Minor upgrade. * updating DIRECTORY.md --------- Co-authored-by: David Leal Co-authored-by: github-actions[bot] Co-authored-by: CascadingCascade <122662061+CascadingCascade@users.noreply.github.com> Co-authored-by: Taj --- DIRECTORY.md | 1 + .../linked_list/circular_doubly_linked_list.c | 304 ++++++++++++++++++ 2 files changed, 305 insertions(+) create mode 100644 data_structures/linked_list/circular_doubly_linked_list.c diff --git a/DIRECTORY.md b/DIRECTORY.md index f8ac382e01..a4aa32c3d8 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -86,6 +86,7 @@ * [Min Heap](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/heap/min_heap.c) * Linked List * [Ascending Priority Queue](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/ascending_priority_queue.c) + * [Circular Doubly Linked List](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/circular_doubly_linked_list.c) * [Circular Linked List](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/circular_linked_list.c) * [Doubly Linked List](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/doubly_linked_list.c) * [Merge Linked Lists](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/linked_list/merge_linked_lists.c) diff --git a/data_structures/linked_list/circular_doubly_linked_list.c b/data_structures/linked_list/circular_doubly_linked_list.c new file mode 100644 index 0000000000..d2302e06b9 --- /dev/null +++ b/data_structures/linked_list/circular_doubly_linked_list.c @@ -0,0 +1,304 @@ +/** + * @file + * + * @details + * Circular [Doubly Linked + * List](https://en.wikipedia.org/wiki/Doubly_linked_list) combines the + * properties of a doubly linked list and a circular linked list in which two + * consecutive elements are linked or connected by the previous. Next, the + * pointer and the last node point to the first node via the next pointer, and + * the first node points to the last node via the previous pointer. + * + * In this implementation, functions to insert at the head, insert at the last + * index, delete the first node, delete the last node, display list, and get + * list size functions are coded. + * + * @author [Sahil Kandhare](https://github.com/SahilK-027) + * + */ + +#include /// to verify assumptions made by the program and print a diagnostic message if this assumption is false. +#include /// to provide a set of integer types with universally consistent definitions that are operating system-independent +#include /// for IO operations +#include /// for including functions involving memory allocation such as `malloc` + +/** + * @brief Circular Doubly linked list struct + */ +typedef struct node +{ + struct node *prev, *next; ///< List pointers + uint64_t value; ///< Data stored on each node +} ListNode; + +/** + * @brief Create a list node + * @param data the data that the node initialises with + * @return ListNode* pointer to the newly created list node + */ +ListNode *create_node(uint64_t data) +{ + ListNode *new_list = (ListNode *)malloc(sizeof(ListNode)); + new_list->value = data; + new_list->next = new_list; + new_list->prev = new_list; + return new_list; +} + +/** + * @brief Insert a node at start of list + * @param head start pointer of list + * @param data the data that the node initialises with + * @return ListNode* pointer to the newly created list node + * inserted at the head + */ +ListNode *insert_at_head(ListNode *head, uint64_t data) +{ + if (head == NULL) + { + head = create_node(data); + return head; + } + else + { + ListNode *temp; + ListNode *new_node = create_node(data); + temp = head->prev; + new_node->next = head; + head->prev = new_node; + new_node->prev = temp; + temp->next = new_node; + head = new_node; + return head; + } +} + +/** + * @brief Insert a node at end of list + * + * @param head start pointer of list + * @param data the data that the node initialises with + * @return ListNode* pointer to the newly added list node that was + * inserted at the head of list. + */ +ListNode *insert_at_tail(ListNode *head, uint64_t data) +{ + if (head == NULL) + { + head = create_node(data); + return head; + } + else + { + ListNode *temp1, *temp2; + ListNode *new_node = create_node(data); + temp1 = head; + temp2 = head->prev; + new_node->prev = temp2; + new_node->next = temp1; + temp1->prev = new_node; + temp2->next = new_node; + return head; + } +} + +/** + * @brief Function for deletion of the first node in list + * + * @param head start pointer of list + * @return ListNode* pointer to the list node after deleting first node + */ +ListNode *delete_from_head(ListNode *head) +{ + if (head == NULL) + { + printf("The list is empty\n"); + return head; + } + ListNode *temp1, *temp2; + temp1 = head; + temp2 = temp1->prev; + if (temp1 == temp2) + { + free(temp2); + head = NULL; + return head; + } + temp2->next = temp1->next; + (temp1->next)->prev = temp2; + head = temp1->next; + free(temp1); + return head; +} + +/** + * @brief Function for deletion of the last node in list + * + * @param head start pointer of list + * @return ListNode* pointer to the list node after deleting first node + */ +ListNode *delete_from_tail(ListNode *head) +{ + if (head == NULL) + { + printf("The list is empty\n"); + return head; + } + + ListNode *temp1, *temp2; + temp1 = head; + temp2 = temp1->prev; + if (temp1 == temp2) + { + free(temp2); + head = NULL; + return head; + } + (temp2->prev)->next = temp1; + temp1->prev = temp2->prev; + free(temp2); + return head; +} + +/** + * @brief The function that will return current size of list + * + * @param head start pointer of list + * @return int size of list + */ +int getsize(ListNode *head) +{ + if (!head) + { + return 0; + } + int size = 1; + ListNode *temp = head->next; + while (temp != head) + { + temp = temp->next; + size++; + } + return size; +} + +/** + * @brief Display list function + * @param head start pointer of list + * @returns void + */ + +void display_list(ListNode *head) +{ + printf("\nContents of your linked list: "); + ListNode *temp; + temp = head; + if (head != NULL) + { + while (temp->next != head) + { + printf("%" PRIu64 " <-> ", temp->value); + temp = temp->next; + } + if (temp->next == head) + { + printf("%" PRIu64, temp->value); + } + } + else + { + printf("The list is empty"); + } + printf("\n"); +} + +/** + * @brief access the list by index + * @param list pointer to the target list + * @param index access location + * @returns the value at the specified index, + * wrapping around if the index is larger than the size of the target + * list + */ +uint64_t get(ListNode *list, const int index) +{ + if (list == NULL || index < 0) + { + exit(EXIT_FAILURE); + } + ListNode *temp = list; + for (int i = 0; i < index; ++i) + { + temp = temp->next; + } + return temp->value; +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() +{ + ListNode *testList = NULL; + unsigned int array[] = {2, 3, 4, 5, 6}; + + assert(getsize(testList) == 0); + + printf("Testing inserting elements:\n"); + for (int i = 0; i < 5; ++i) + { + display_list(testList); + testList = insert_at_head(testList, array[i]); + assert(testList->value == array[i]); + assert(getsize(testList) == i + 1); + } + + printf("\nTesting removing elements:\n"); + for (int i = 4; i > -1; --i) + { + display_list(testList); + assert(testList->value == array[i]); + testList = delete_from_head(testList); + assert(getsize(testList) == i); + } + + printf("\nTesting inserting at tail:\n"); + for (int i = 0; i < 5; ++i) + { + display_list(testList); + testList = insert_at_tail(testList, array[i]); + assert(get(testList, i) == array[i]); + assert(getsize(testList) == i + 1); + } + + printf("\nTesting removing from tail:\n"); + for (int i = 4; i > -1; --i) + { + display_list(testList); + testList = delete_from_tail(testList); + assert(getsize(testList) == i); + // If list is not empty, assert that accessing the just removed element + // will wrap around to the list head + if (testList != NULL) + { + assert(get(testList, i) == testList->value); + } + else + { + // If the list is empty, assert that the elements were removed after + // the correct number of iterations + assert(i == 0); + } + } +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() +{ + test(); // run self-test implementations + return 0; +} From f0b38a320175d3c1f7e9ca52048e7d9df7589694 Mon Sep 17 00:00:00 2001 From: Mindaugas <76015221+mindaugl@users.noreply.github.com> Date: Fri, 3 Mar 2023 15:12:04 +0000 Subject: [PATCH 115/156] feat: remove nth node from end of list LeetCode (#1222) * feat: remove nth node from end of list (leetcode #19) * fix: update the leetcode #19 solution to introduce node pointing to head --------- Co-authored-by: David Leal --- leetcode/DIRECTORY.md | 1 + leetcode/src/19.c | 27 +++++++++++++++++++++++++++ 2 files changed, 28 insertions(+) create mode 100644 leetcode/src/19.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 4c124798bc..1ae9af3a18 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -21,6 +21,7 @@ | 14 | [Longest Common Prefix](https://leetcode.com/problems/longest-common-prefix) | [C](./src/14.c) | Easy | | 16 | [3Sum Closest](https://leetcode.com/problems/3sum-closest) | [C](./src/16.c) | Medium | | 17 | [Letter Combinations of a Phone Number](https://leetcode.com/problems/letter-combinations-of-a-phone-number) | [C](./src/17.c) | Medium | +| 19 | [Remove Nth Node From End of List](https://leetcode.com/problems/remove-nth-node-from-end-of-list) | [C](./src/19.c) | Medium | | 20 | [Valid Parentheses](https://leetcode.com/problems/valid-parentheses) | [C](./src/20.c) | Easy | | 21 | [Merge Two Sorted Lists](https://leetcode.com/problems/merge-two-sorted-lists) | [C](./src/21.c) | Easy | | 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs) | [C](./src/24.c) | Medium | diff --git a/leetcode/src/19.c b/leetcode/src/19.c new file mode 100644 index 0000000000..c189f8f288 --- /dev/null +++ b/leetcode/src/19.c @@ -0,0 +1,27 @@ +/** + * Definition for singly-linked list. + * struct ListNode { + * int val; + * struct ListNode *next; + * }; + */ + +struct ListNode *removeNthFromEnd(struct ListNode *head, int n) { + struct ListNode entry, *p_free, *p = head; + int i, sz = 0; + entry.next = head; + while (p != NULL) { + p = p->next; + sz++; + } + for (i = 0, p = &entry; i < sz - n; i++, p = p -> next) + ; + p_free = p->next; + if (n != 1) { + p->next = p->next->next; + } else { + p->next = NULL; + } + free(p_free); + return entry.next; +} From 62359492bfdfd365135237a62b022b9467612129 Mon Sep 17 00:00:00 2001 From: Bao Hexing Date: Tue, 14 Mar 2023 01:44:01 +0800 Subject: [PATCH 116/156] fix: addition of two polynomials memory leak and linked list crash (#1211) Co-authored-by: David Leal --- misc/poly_add.c | 46 ++++++++++++++-------------------------------- 1 file changed, 14 insertions(+), 32 deletions(-) diff --git a/misc/poly_add.c b/misc/poly_add.c index 53e76c3967..8280315e09 100644 --- a/misc/poly_add.c +++ b/misc/poly_add.c @@ -30,17 +30,11 @@ struct term */ void free_poly(struct term *poly) { - if (!poly) + while (poly) { - return; // NULL pointer does not need delete - } - else - { - while (!poly->next) - { - free(poly->next); // Deletes next term - } - free(poly); // delete the current term + struct term *next = poly->next; + free(poly); + poly = next; } } @@ -54,31 +48,19 @@ void free_poly(struct term *poly) void create_polynomial(struct term **poly, int coef, int pow) { // Creating the polynomial using temporary linked lists - struct term *temp1, *temp2; - temp1 = *poly; // Contains the null pointer + struct term **temp1 = poly; - // Initiating first term - if (temp1 == NULL) + while (*temp1) { - temp2 = (struct term *)malloc( - sizeof(struct term)); // Dynamic node creation - temp2->coef = coef; - temp2->pow = pow; - // Updating the null pointer with the address of the first node of the - // polynomial just created - *poly = temp2; - temp2->next = NULL; // Increasing the pointer temp2 - } - // Creating the rest of the nodes - else - { - temp2->next = (struct term *)malloc( - sizeof(struct term)); // Dynamic node creation - temp2 = temp2->next; // Increasing the pointer temp2 - temp2->coef = coef; - temp2->pow = pow; - temp2->next = NULL; + temp1 = &(*temp1)->next; } + + // Now temp1 reaches to the end of the list + *temp1 = (struct term *)malloc( + sizeof(struct term)); // Create the term and linked as the tail + (*temp1)->coef = coef; + (*temp1)->pow = pow; + (*temp1)->next = NULL; } /** From acbaf4a2914fcda7d786a43f1a0a4472af0088d4 Mon Sep 17 00:00:00 2001 From: dsmurrow <73198549+dsmurrow@users.noreply.github.com> Date: Mon, 13 Mar 2023 22:38:42 -0400 Subject: [PATCH 117/156] feat: implemented BLAKE2b cryptographic hashing algorithm (#1230) * feat: added BLAKE2b with one working assert docs: added BLAKE2b to README.md * [enhancement] added more doc comments and fully implemented BLAKE2b key hashing * fix: forgot to add arg * chore: applied clang-format * updating DIRECTORY.md * docs: added main function docs Co-authored-by: David Leal * docs: removed @file qualifier Co-authored-by: David Leal * docs: added doc comment for assert_bytes() Co-authored-by: David Leal * docs: added documentation for #include's As requested by Panquesito27 in https://github.com/TheAlgorithms/C/pull/1230#discussion_r1130143641 * docs: added algorithm description As requested in https://github.com/TheAlgorithms/C/pull/1230#discussion_r1130143364 * docs: added reasoning for warning suppression pragmas * docs: spellcheck and additions Added doc for bb definition. Added description for mixing function G and compression function F. * Added print statement to let user know tests have passed Co-authored-by: David Leal * Updated doc comments for variables * docs: removed old doc comments * fix: had minus sign instead of assignment operator * chore: replaced uint64_t[16] with block_t type to improve readability * docs: defined macro constants to reduce magic numbers * fix: fixed memory leak in blake2b() * docs: moved comment Moved comment about the suppressed warning directly above the code that emits the warning * docs: added psuedocode/feat: added u128 Added psuedocode for the algorithm in doc comment for BLAKE2B(). Added return docs for void functions. Defined an unsigned 128-bit integer to match the max input size specified for the algorithm. * fix: fixed build errors * docs: added some clarifying comments * docs: reduced magic numbers --------- Co-authored-by: github-actions[bot] Co-authored-by: David Leal --- DIRECTORY.md | 2 + hash/README.md | 1 + hash/hash_blake2b.c | 480 ++++++++++++++++++++++++++++++++++++++++++++ 3 files changed, 483 insertions(+) create mode 100644 hash/hash_blake2b.c diff --git a/DIRECTORY.md b/DIRECTORY.md index a4aa32c3d8..9a51282a02 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -161,6 +161,7 @@ ## Hash * [Hash Adler32](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_adler32.c) + * [Hash Blake2B](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_blake2b.c) * [Hash Crc32](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_crc32.c) * [Hash Djb2](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_djb2.c) * [Hash Sdbm](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_sdbm.c) @@ -215,6 +216,7 @@ * [1833](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1833.c) * [1838](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1838.c) * [189](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/189.c) + * [19](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/19.c) * [190](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/190.c) * [191](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/191.c) * [2](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2.c) diff --git a/hash/README.md b/hash/README.md index 20e201edf8..90942636cf 100644 --- a/hash/README.md +++ b/hash/README.md @@ -5,3 +5,4 @@ * xor8 (8 bit) * adler_32 (32 bit) * crc32 (32 bit) +* BLAKE2b diff --git a/hash/hash_blake2b.c b/hash/hash_blake2b.c new file mode 100644 index 0000000000..69b254edf9 --- /dev/null +++ b/hash/hash_blake2b.c @@ -0,0 +1,480 @@ +/** + * @addtogroup hash Hash algorithms + * @{ + * @file + * @author [Daniel Murrow](https://github.com/dsmurrow) + * @brief [Blake2b cryptographic hash + * function](https://www.rfc-editor.org/rfc/rfc7693) + * + * The Blake2b cryptographic hash function provides + * hashes for data that are secure enough to be used in + * cryptographic applications. It is designed to perform + * optimally on 64-bit platforms. The algorithm can output + * digests between 1 and 64 bytes long, for messages up to + * 128 bits in length. Keyed hashing is also supported for + * keys up to 64 bytes in length. + */ +#include /// for asserts +#include /// for fixed-width integer types e.g. uint64_t and uint8_t +#include /// for IO +#include /// for malloc, calloc, and free. As well as size_t + +/* Warning suppressed is in blake2b() function, more + * details are over there */ +#ifdef __GNUC__ +#pragma GCC diagnostic ignored "-Wshift-count-overflow" +#elif _MSC_VER +#pragma warning(disable : 4293) +#endif + +/** + * @define bb + * @brief the size of a data block in bytes + */ +#define bb 128 + +/** + * @define KK_MAX + * @brief max key length for BLAKE2b + */ +#define KK_MAX 64 + +/** + * @define NN_MAX + * @brief max length of BLAKE2b digest in bytes + */ +#define NN_MAX 64 + +/** + * @define CEIL + * @brief ceiling division macro without floats + * + * @param a dividend + * @param divisor + */ +#define CEIL(a, b) (((a) / (b)) + ((a) % (b) != 0)) + +/** + * @define MIN + * @brief returns minimum value + */ +#define MIN(a, b) ((a) < (b) ? (a) : (b)) + +/** + * @define MAX + * @brief returns maximum value + */ +#define MAX(a, b) ((a) > (b) ? (a) : (b)) + +/** + * @define ROTR64 + * @brief macro to rotate 64-bit ints to the right + * Ripped from RFC 7693 + */ +#define ROTR64(n, offset) (((n) >> (offset)) ^ ((n) << (64 - (offset)))) + +/** + * @define U128_ZERO + * @brief zero-value initializer for u128 type + */ +#define U128_ZERO \ + { \ + 0, 0 \ + } + +/** 128-bit number represented as two uint64's */ +typedef uint64_t u128[2]; + +/** Padded input block containing bb bytes */ +typedef uint64_t block_t[bb / sizeof(uint64_t)]; + +static const uint8_t R1 = 32; ///< Rotation constant 1 for mixing function G +static const uint8_t R2 = 24; ///< Rotation constant 2 for mixing function G +static const uint8_t R3 = 16; ///< Rotation constant 3 for mixing function G +static const uint8_t R4 = 63; ///< Rotation constant 4 for mixing function G + +static const uint64_t blake2b_iv[8] = { + 0x6A09E667F3BCC908, 0xBB67AE8584CAA73B, 0x3C6EF372FE94F82B, + 0xA54FF53A5F1D36F1, 0x510E527FADE682D1, 0x9B05688C2B3E6C1F, + 0x1F83D9ABFB41BD6B, 0x5BE0CD19137E2179}; ///< BLAKE2b Initialization vector + ///< blake2b_iv[i] = floor(2**64 * + ///< frac(sqrt(prime(i+1)))), + ///< where prime(i) is the i:th + ///< prime number + +static const uint8_t blake2b_sigma[12][16] = { + {0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15}, + {14, 10, 4, 8, 9, 15, 13, 6, 1, 12, 0, 2, 11, 7, 5, 3}, + {11, 8, 12, 0, 5, 2, 15, 13, 10, 14, 3, 6, 7, 1, 9, 4}, + {7, 9, 3, 1, 13, 12, 11, 14, 2, 6, 5, 10, 4, 0, 15, 8}, + {9, 0, 5, 7, 2, 4, 10, 15, 14, 1, 11, 12, 6, 8, 3, 13}, + {2, 12, 6, 10, 0, 11, 8, 3, 4, 13, 7, 5, 15, 14, 1, 9}, + {12, 5, 1, 15, 14, 13, 4, 10, 0, 7, 6, 3, 9, 2, 8, 11}, + {13, 11, 7, 14, 12, 1, 3, 9, 5, 0, 15, 4, 8, 6, 2, 10}, + {6, 15, 14, 9, 11, 3, 0, 8, 12, 2, 13, 7, 1, 4, 10, 5}, + {10, 2, 8, 4, 7, 6, 1, 5, 15, 11, 9, 14, 3, 12, 13, 0}, + {0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15}, + {14, 10, 4, 8, 9, 15, 13, 6, 1, 12, 0, 2, 11, 7, 5, + 3}}; ///< word schedule permutations for each round of the algorithm + +/** + * @brief put value of n into dest + * + * @param dest 128-bit number to get copied from n + * @param n value put into dest + * + * @returns void + */ +static inline void u128_fill(u128 dest, size_t n) +{ + dest[0] = n & UINT64_MAX; + + if (sizeof(n) > 8) + { + /* The C standard does not specify a maximum length for size_t, + * although most machines implement it to be the same length as + * uint64_t. On machines where size_t is 8 bytes long this will issue a + * compiler warning, which is why it is suppressed. But on a machine + * where size_t is greater than 8 bytes, this will work as normal. */ + dest[1] = n >> 64; + } + else + { + dest[1] = 0; + } +} + +/** + * @brief increment an 128-bit number by a given amount + * + * @param dest the value being incremented + * @param n what dest is being increased by + * + * @returns void + */ +static inline void u128_increment(u128 dest, uint64_t n) +{ + /* Check for overflow */ + if (UINT64_MAX - dest[0] <= n) + { + dest[1]++; + } + + dest[0] += n; +} + +/** + * @brief blake2b mixing function G + * + * Shuffles values in block v depending on + * provided indeces a, b, c, and d. x and y + * are also mixed into the block. + * + * @param v array of words to be mixed + * @param a first index + * @param b second index + * @param c third index + * @param d fourth index + * @param x first word being mixed into v + * @param y second word being mixed into y + * + * @returns void + */ +static void G(block_t v, uint8_t a, uint8_t b, uint8_t c, uint8_t d, uint64_t x, + uint64_t y) +{ + v[a] += v[b] + x; + v[d] = ROTR64(v[d] ^ v[a], R1); + v[c] += v[d]; + v[b] = ROTR64(v[b] ^ v[c], R2); + v[a] += v[b] + y; + v[d] = ROTR64(v[d] ^ v[a], R3); + v[c] += v[d]; + v[b] = ROTR64(v[b] ^ v[c], R4); +} + +/** + * @brief compression function F + * + * Securely mixes the values in block m into + * the state vector h. Value at v[14] is also + * inverted if this is the final block to be + * compressed. + * + * @param h the state vector + * @param m message vector to be compressed into h + * @param t 128-bit offset counter + * @param f flag to indicate whether this is the final block + * + * @returns void + */ +static void F(uint64_t h[8], block_t m, u128 t, int f) +{ + int i; + block_t v; + + /* v[0..7] := h[0..7] */ + for (i = 0; i < 8; i++) + { + v[i] = h[i]; + } + /* v[8..15] := IV[0..7] */ + for (; i < 16; i++) + { + v[i] = blake2b_iv[i - 8]; + } + + v[12] ^= t[0]; /* v[12] ^ (t mod 2**w) */ + v[13] ^= t[1]; /* v[13] ^ (t >> w) */ + + if (f) + { + v[14] = ~v[14]; + } + + for (i = 0; i < 12; i++) + { + const uint8_t *s = blake2b_sigma[i]; + + G(v, 0, 4, 8, 12, m[s[0]], m[s[1]]); + G(v, 1, 5, 9, 13, m[s[2]], m[s[3]]); + G(v, 2, 6, 10, 14, m[s[4]], m[s[5]]); + G(v, 3, 7, 11, 15, m[s[6]], m[s[7]]); + + G(v, 0, 5, 10, 15, m[s[8]], m[s[9]]); + G(v, 1, 6, 11, 12, m[s[10]], m[s[11]]); + G(v, 2, 7, 8, 13, m[s[12]], m[s[13]]); + G(v, 3, 4, 9, 14, m[s[14]], m[s[15]]); + } + + for (i = 0; i < 8; i++) + { + h[i] ^= v[i] ^ v[i + 8]; + } +} + +/** + * @brief driver function to perform the hashing as described in specification + * + * pseudocode: (credit to authors of RFC 7693 listed above) + * FUNCTION BLAKE2( d[0..dd-1], ll, kk, nn ) + * | + * | h[0..7] := IV[0..7] // Initialization Vector. + * | + * | // Parameter block p[0] + * | h[0] := h[0] ^ 0x01010000 ^ (kk << 8) ^ nn + * | + * | // Process padded key and data blocks + * | IF dd > 1 THEN + * | | FOR i = 0 TO dd - 2 DO + * | | | h := F( h, d[i], (i + 1) * bb, FALSE ) + * | | END FOR. + * | END IF. + * | + * | // Final block. + * | IF kk = 0 THEN + * | | h := F( h, d[dd - 1], ll, TRUE ) + * | ELSE + * | | h := F( h, d[dd - 1], ll + bb, TRUE ) + * | END IF. + * | + * | RETURN first "nn" bytes from little-endian word array h[]. + * | + * END FUNCTION. + * + * @param dest destination of hashing digest + * @param d message blocks + * @param dd length of d + * @param ll 128-bit length of message + * @param kk length of secret key + * @param nn length of hash digest + * + * @returns 0 upon successful hash + */ +static int BLAKE2B(uint8_t *dest, block_t *d, size_t dd, u128 ll, uint8_t kk, + uint8_t nn) +{ + uint8_t bytes[8]; + uint64_t i, j; + uint64_t h[8]; + u128 t = U128_ZERO; + + /* h[0..7] = IV[0..7] */ + for (i = 0; i < 8; i++) + { + h[i] = blake2b_iv[i]; + } + + h[0] ^= 0x01010000 ^ (kk << 8) ^ nn; + + if (dd > 1) + { + for (i = 0; i < dd - 1; i++) + { + u128_increment(t, bb); + F(h, d[i], t, 0); + } + } + + if (kk != 0) + { + u128_increment(ll, bb); + } + F(h, d[dd - 1], ll, 1); + + /* copy bytes from h to destination buffer */ + for (i = 0; i < nn; i++) + { + if (i % sizeof(uint64_t) == 0) + { + /* copy values from uint64 to 8 u8's */ + for (j = 0; j < sizeof(uint64_t); j++) + { + uint16_t offset = 8 * j; + uint64_t mask = 0xFF; + mask <<= offset; + + bytes[j] = (h[i / 8] & (mask)) >> offset; + } + } + + dest[i] = bytes[i % 8]; + } + + return 0; +} + +/* @brief blake2b hash function + * + * This is the front-end function that sets up the argument for BLAKE2B(). + * + * @param message the message to be hashed + * @param len length of message (0 <= len < 2**128) (depends on sizeof(size_t) + * for this implementation) + * @param key optional secret key + * @param kk length of optional secret key (0 <= kk <= 64) + * @param nn length of output digest (1 <= nn < 64) + * + * @returns NULL if heap memory couldn't be allocated. Otherwise heap allocated + * memory nn bytes large + */ +uint8_t *blake2b(const uint8_t *message, size_t len, const uint8_t *key, + uint8_t kk, uint8_t nn) +{ + uint8_t *dest = NULL; + uint64_t long_hold; + size_t dd, has_key, i; + size_t block_index, word_in_block; + u128 ll; + block_t *blocks; + + if (message == NULL) + { + len = 0; + } + if (key == NULL) + { + kk = 0; + } + + kk = MIN(kk, KK_MAX); + nn = MIN(nn, NN_MAX); + + dd = MAX(CEIL(kk, bb) + CEIL(len, bb), 1); + + blocks = calloc(dd, sizeof(block_t)); + if (blocks == NULL) + { + return NULL; + } + + dest = malloc(nn * sizeof(uint8_t)); + if (dest == NULL) + { + free(blocks); + return NULL; + } + + /* If there is a secret key it occupies the first block */ + for (i = 0; i < kk; i++) + { + long_hold = message[i]; + long_hold <<= 8 * (i % 8); + + word_in_block = (i % bb) / 8; + /* block_index will always be 0 because kk <= 64 and bb = 128*/ + blocks[0][word_in_block] |= long_hold; + } + + has_key = kk > 0 ? 1 : 0; + + for (i = 0; i < len; i++) + { + /* long_hold exists because the bit-shifting will overflow if we don't + * store the value */ + long_hold = message[i]; + long_hold <<= 8 * (i % 8); + + block_index = has_key + (i / bb); + word_in_block = (i % bb) / 8; + + blocks[block_index][word_in_block] |= long_hold; + } + + u128_fill(ll, len); + + BLAKE2B(dest, blocks, dd, ll, kk, nn); + + free(blocks); + + return dest; +} + +/** @} */ + +/** + * @brief Self-test implementations + * @returns void + */ +static void assert_bytes(const uint8_t *expected, const uint8_t *actual, + uint8_t len) +{ + uint8_t i; + + assert(expected != NULL); + assert(actual != NULL); + assert(len > 0); + + for (i = 0; i < len; i++) + { + assert(expected[i] == actual[i]); + } + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() +{ + uint8_t *digest = NULL; + + /* "abc" example straight out of RFC-7693 */ + uint8_t abc[3] = {'a', 'b', 'c'}; + uint8_t abc_answer[64] = { + 0xBA, 0x80, 0xA5, 0x3F, 0x98, 0x1C, 0x4D, 0x0D, 0x6A, 0x27, 0x97, + 0xB6, 0x9F, 0x12, 0xF6, 0xE9, 0x4C, 0x21, 0x2F, 0x14, 0x68, 0x5A, + 0xC4, 0xB7, 0x4B, 0x12, 0xBB, 0x6F, 0xDB, 0xFF, 0xA2, 0xD1, 0x7D, + 0x87, 0xC5, 0x39, 0x2A, 0xAB, 0x79, 0x2D, 0xC2, 0x52, 0xD5, 0xDE, + 0x45, 0x33, 0xCC, 0x95, 0x18, 0xD3, 0x8A, 0xA8, 0xDB, 0xF1, 0x92, + 0x5A, 0xB9, 0x23, 0x86, 0xED, 0xD4, 0x00, 0x99, 0x23}; + + digest = blake2b(abc, 3, NULL, 0, 64); + assert_bytes(abc_answer, digest, 64); + + free(digest); + + return 0; +} From 9997c8bdf0aac59281dd3105f898ae325334c94f Mon Sep 17 00:00:00 2001 From: Rishav Kumar <85122792+i-m-afk@users.noreply.github.com> Date: Fri, 17 Mar 2023 23:31:44 +0530 Subject: [PATCH 118/156] fix: memory allocation method (#1220) * Fix : memory allocation method "new" is not used in C , because of that the compiler was giving compilation error. Instead malloc was used for memory allocation. * updating DIRECTORY.md * Update data_structures/graphs/kruskal.c Co-authored-by: Stepfen Shawn * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] Co-authored-by: Stepfen Shawn --- data_structures/graphs/kruskal.c | 4 ++-- leetcode/DIRECTORY.md | 2 +- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/data_structures/graphs/kruskal.c b/data_structures/graphs/kruskal.c index 49d1c54c9f..0f72c6b52f 100644 --- a/data_structures/graphs/kruskal.c +++ b/data_structures/graphs/kruskal.c @@ -27,11 +27,11 @@ struct Graph // Creates a graph with V vertices and E edges struct Graph *createGraph(int V, int E) { - struct Graph *graph = new Graph(); + struct Graph* graph = (struct Graph*)(malloc(sizeof(struct Graph))); graph->V = V; graph->E = E; - graph->edge = new Edge[E]; + graph->edge = (struct Edge*)malloc(sizeof(struct Edge) * E); return graph; } diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 1ae9af3a18..4807b447d4 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -27,7 +27,7 @@ | 24 | [Swap Nodes in Pairs](https://leetcode.com/problems/swap-nodes-in-pairs) | [C](./src/24.c) | Medium | | 26 | [Remove Duplicates from Sorted Array](https://leetcode.com/problems/remove-duplicates-from-sorted-array) | [C](./src/26.c) | Easy | | 27 | [Remove Element](https://leetcode.com/problems/remove-element) | [C](./src/27.c) | Easy | -| 28 | [Find the Index of the First Occurrence in a String](https://leetcode.com/problems/find-the-index-of-the-first-occurrence-in-a-string) | [C](./src/28.c) | Medium | +| 28 | [Find the Index of the First Occurrence in a String](https://leetcode.com/problems/find-the-index-of-the-first-occurrence-in-a-string) | [C](./src/28.c) | Easy | | 29 | [Divide Two Integers](https://leetcode.com/problems/divide-two-integers) | [C](./src/29.c) | Medium | | 32 | [Longest Valid Parentheses](https://leetcode.com/problems/longest-valid-parentheses) | [C](./src/32.c) | Hard | | 35 | [Search Insert Position](https://leetcode.com/problems/search-insert-position) | [C](./src/35.c) | Easy | From 581dd22ae0fb1dbdbc66de67efdb78ab7662de7b Mon Sep 17 00:00:00 2001 From: dsmurrow <73198549+dsmurrow@users.noreply.github.com> Date: Fri, 24 Mar 2023 15:27:10 -0400 Subject: [PATCH 119/156] chore: add `math` to CMake lists (#1236) --- CMakeLists.txt | 1 + math/CMakeLists.txt | 18 ++++++++++++++++++ 2 files changed, 19 insertions(+) create mode 100644 math/CMakeLists.txt diff --git a/CMakeLists.txt b/CMakeLists.txt index 064fc5dc12..80a80b0f39 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -63,6 +63,7 @@ add_subdirectory(project_euler) add_subdirectory(machine_learning) add_subdirectory(process_scheduling_algorithms) add_subdirectory(numerical_methods) +add_subdirectory(math) ## Configure Doxygen documentation system cmake_policy(SET CMP0054 NEW) diff --git a/math/CMakeLists.txt b/math/CMakeLists.txt new file mode 100644 index 0000000000..517ec8ccbd --- /dev/null +++ b/math/CMakeLists.txt @@ -0,0 +1,18 @@ +# If necessary, use the RELATIVE flag, otherwise each source file may be listed +# with full pathname. The RELATIVE flag makes it easier to extract an executable's name +# automatically. + +file( GLOB APP_SOURCES RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} *.c ) +foreach( testsourcefile ${APP_SOURCES} ) + string( REPLACE ".c" "" testname ${testsourcefile} ) # File type. Example: `.c` + add_executable( ${testname} ${testsourcefile} ) + + if(OpenMP_C_FOUND) + target_link_libraries(${testname} OpenMP::OpenMP_C) + endif() + if(MATH_LIBRARY) + target_link_libraries(${testname} ${MATH_LIBRARY}) + endif() + install(TARGETS ${testname} DESTINATION "bin/math") # Folder name. Do NOT include `<>` + +endforeach( testsourcefile ${APP_SOURCES} ) From f3a3e6d4765f53e03724f567c8380a830a7429d9 Mon Sep 17 00:00:00 2001 From: dsmurrow <73198549+dsmurrow@users.noreply.github.com> Date: Wed, 29 Mar 2023 16:42:08 -0400 Subject: [PATCH 120/156] chore: created new subdirectory for cryptographic ciphers (#1237) * chore: moved rot13.c to cipher directory * chore: added CMakeLists.txt for /cipher * chore: added /cipher to root CMakeLists.txt --- CMakeLists.txt | 1 + cipher/CMakeLists.txt | 18 ++++++++++++++++++ {misc => cipher}/rot13.c | 0 3 files changed, 19 insertions(+) create mode 100644 cipher/CMakeLists.txt rename {misc => cipher}/rot13.c (100%) diff --git a/CMakeLists.txt b/CMakeLists.txt index 80a80b0f39..eb925dc92a 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -64,6 +64,7 @@ add_subdirectory(machine_learning) add_subdirectory(process_scheduling_algorithms) add_subdirectory(numerical_methods) add_subdirectory(math) +add_subdirectory(cipher) ## Configure Doxygen documentation system cmake_policy(SET CMP0054 NEW) diff --git a/cipher/CMakeLists.txt b/cipher/CMakeLists.txt new file mode 100644 index 0000000000..c1d93bbc91 --- /dev/null +++ b/cipher/CMakeLists.txt @@ -0,0 +1,18 @@ +# If necessary, use the RELATIVE flag, otherwise each source file may be listed +# with full pathname. The RELATIVE flag makes it easier to extract an executable's name +# automatically. + +file( GLOB APP_SOURCES RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} *.c ) +foreach( testsourcefile ${APP_SOURCES} ) + string( REPLACE ".c" "" testname ${testsourcefile} ) # File type. Example: `.c` + add_executable( ${testname} ${testsourcefile} ) + + if(OpenMP_C_FOUND) + target_link_libraries(${testname} OpenMP::OpenMP_C) + endif() + if(MATH_LIBRARY) + target_link_libraries(${testname} ${MATH_LIBRARY}) + endif() + install(TARGETS ${testname} DESTINATION "bin/cipher") # Folder name. Do NOT include `<>` + +endforeach( testsourcefile ${APP_SOURCES} ) diff --git a/misc/rot13.c b/cipher/rot13.c similarity index 100% rename from misc/rot13.c rename to cipher/rot13.c From f9c89a720dba01781391c659f1c9f9c9c1bd9221 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 31 Mar 2023 12:20:16 -0600 Subject: [PATCH 121/156] feat: create a PR when building the LeetCode directory (#1231) * updating DIRECTORY.md * feat: create a PR when building the LeetCode directory * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] --- .../workflows/leetcode_directory_writer.yml | 23 +++++++++++++------ DIRECTORY.md | 4 +++- 2 files changed, 19 insertions(+), 8 deletions(-) diff --git a/.github/workflows/leetcode_directory_writer.yml b/.github/workflows/leetcode_directory_writer.yml index 16cb656b98..d2657333e6 100644 --- a/.github/workflows/leetcode_directory_writer.yml +++ b/.github/workflows/leetcode_directory_writer.yml @@ -18,13 +18,22 @@ jobs: - name: Add python dependencies run: | pip install requests - - name: Write leectode DIRECTORY.md + - name: Write LeetCode DIRECTORY.md run: | python3 scripts/leetcode_directory_md.py 2>&1 | tee leetcode/DIRECTORY.md - git config --global user.name github-actions[bot] - git config --global user.email 'github-actions@users.noreply.github.com' - - name: Update LeetCode's directory + git pull || true + - name: Commit and push changes + uses: stefanzweifel/git-auto-commit-action@v4 + id: commit-push + with: + commit_message: "docs: updating `leetcode/DIRECTORY.md`" + branch: "leetcode-directory-${{ github.sha }}" + create_branch: true + - name: Creating and merging the PR + shell: bash + if: steps.commit-push.outputs.changes_detected == 'true' run: | - git add leetcode/DIRECTORY.md - git commit -am "updating DIRECTORY.md" || true - git push origin HEAD:$GITHUB_REF || true + gh pr create --base ${GITHUB_REF##*/} --head leetcode-directory-${{ github.sha }} --title 'docs: updating `leetcode/DIRECTORY.md`' --body 'Updated LeetCode directory (see the diff. for changes).' + gh pr merge --admin --merge --subject 'docs: updating `leetcode/DIRECTORY.md' --delete-branch + env: + GH_TOKEN: ${{ github.token }} diff --git a/DIRECTORY.md b/DIRECTORY.md index 9a51282a02..2aba056d03 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -2,6 +2,9 @@ ## Audio * [Alaw](https://github.com/TheAlgorithms/C/blob/HEAD/audio/alaw.c) +## Cipher + * [Rot13](https://github.com/TheAlgorithms/C/blob/HEAD/cipher/rot13.c) + ## Client Server * [Client](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/client.c) * [Remote Command Exec Udp Client](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/remote_command_exec_udp_client.c) @@ -359,7 +362,6 @@ * [Poly Add](https://github.com/TheAlgorithms/C/blob/HEAD/misc/poly_add.c) * [Postfix Evaluation](https://github.com/TheAlgorithms/C/blob/HEAD/misc/postfix_evaluation.c) * [Quartile](https://github.com/TheAlgorithms/C/blob/HEAD/misc/quartile.c) - * [Rot13](https://github.com/TheAlgorithms/C/blob/HEAD/misc/rot13.c) * [Rselect](https://github.com/TheAlgorithms/C/blob/HEAD/misc/rselect.c) * [Run Length Encoding](https://github.com/TheAlgorithms/C/blob/HEAD/misc/run_length_encoding.c) * [Shunting Yard](https://github.com/TheAlgorithms/C/blob/HEAD/misc/shunting_yard.c) From ca6ac1fdfc3141d72bfc7b17397915e5762119c5 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 31 Mar 2023 12:20:44 -0600 Subject: [PATCH 122/156] fix: ignore the LeetCode folder on `DIRECTORY.md` (#1240) * updating DIRECTORY.md * fix: ignore LeetCode folder while building... ...the `DIRECTORY.md` file. * updating DIRECTORY.md * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] --- .github/workflows/awesome_workflow.yml | 2 +- DIRECTORY.md | 152 ------------------------- 2 files changed, 1 insertion(+), 153 deletions(-) diff --git a/.github/workflows/awesome_workflow.yml b/.github/workflows/awesome_workflow.yml index cf6212b30c..50a15fc5cd 100644 --- a/.github/workflows/awesome_workflow.yml +++ b/.github/workflows/awesome_workflow.yml @@ -29,7 +29,7 @@ jobs: - name: Update DIRECTORY.md run: | wget https://raw.githubusercontent.com/TheAlgorithms/scripts/main/build_directory_md.py - python3 build_directory_md.py C . .c,.h > DIRECTORY.md + python3 build_directory_md.py C . .c,.h leetcode/ > DIRECTORY.md git commit -m "updating DIRECTORY.md" DIRECTORY.md || true - name: Get file changes run: | diff --git a/DIRECTORY.md b/DIRECTORY.md index 2aba056d03..1e49c05293 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -170,158 +170,6 @@ * [Hash Sdbm](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_sdbm.c) * [Hash Xor8](https://github.com/TheAlgorithms/C/blob/HEAD/hash/hash_xor8.c) -## Leetcode - * Src - * [1](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1.c) - * [10](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/10.c) - * [1008](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1008.c) - * [1009](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1009.c) - * [101](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/101.c) - * [1019](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1019.c) - * [1026](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1026.c) - * [104](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/104.c) - * [108](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/108.c) - * [1089](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1089.c) - * [109](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/109.c) - * [11](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/11.c) - * [110](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/110.c) - * [112](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/112.c) - * [1137](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1137.c) - * [1147](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1147.c) - * [118](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/118.c) - * [1184](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1184.c) - * [1189](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1189.c) - * [119](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/119.c) - * [12](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/12.c) - * [1207](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1207.c) - * [121](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/121.c) - * [124](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/124.c) - * [125](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/125.c) - * [1283](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1283.c) - * [13](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/13.c) - * [136](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/136.c) - * [14](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/14.c) - * [141](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/141.c) - * [142](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/142.c) - * [1524](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1524.c) - * [153](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/153.c) - * [16](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/16.c) - * [160](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/160.c) - * [1653](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1653.c) - * [1657](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1657.c) - * [169](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/169.c) - * [1695](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1695.c) - * [17](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/17.c) - * [1704](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1704.c) - * [173](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/173.c) - * [1752](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1752.c) - * [1769](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1769.c) - * [1833](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1833.c) - * [1838](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/1838.c) - * [189](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/189.c) - * [19](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/19.c) - * [190](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/190.c) - * [191](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/191.c) - * [2](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2.c) - * [20](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/20.c) - * [201](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/201.c) - * [2024](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2024.c) - * [203](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/203.c) - * [206](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/206.c) - * [2095](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2095.c) - * [21](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/21.c) - * [2125](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2125.c) - * [2130](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2130.c) - * [215](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/215.c) - * [217](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/217.c) - * [2222](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2222.c) - * [223](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/223.c) - * [2256](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2256.c) - * [226](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/226.c) - * [2270](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2270.c) - * [2279](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2279.c) - * [230](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/230.c) - * [2304](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2304.c) - * [231](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/231.c) - * [234](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/234.c) - * [236](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/236.c) - * [24](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/24.c) - * [242](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/242.c) - * [2482](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2482.c) - * [2501](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/2501.c) - * [26](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/26.c) - * [268](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/268.c) - * [27](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/27.c) - * [274](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/274.c) - * [278](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/278.c) - * [28](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/28.c) - * [283](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/283.c) - * [287](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/287.c) - * [29](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/29.c) - * [3](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/3.c) - * [32](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/32.c) - * [344](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/344.c) - * [35](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/35.c) - * [367](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/367.c) - * [37](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/37.c) - * [38](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/38.c) - * [387](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/387.c) - * [389](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/389.c) - * [4](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/4.c) - * [404](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/404.c) - * [42](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/42.c) - * [442](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/442.c) - * [45](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/45.c) - * [461](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/461.c) - * [476](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/476.c) - * [485](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/485.c) - * [5](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/5.c) - * [50](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/50.c) - * [509](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/509.c) - * [520](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/520.c) - * [53](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/53.c) - * [540](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/540.c) - * [561](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/561.c) - * [567](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/567.c) - * [6](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/6.c) - * [617](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/617.c) - * [62](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/62.c) - * [63](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/63.c) - * [647](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/647.c) - * [66](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/66.c) - * [669](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/669.c) - * [674](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/674.c) - * [684](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/684.c) - * [7](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/7.c) - * [700](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/700.c) - * [701](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/701.c) - * [704](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/704.c) - * [709](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/709.c) - * [75](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/75.c) - * [771](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/771.c) - * [79](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/79.c) - * [8](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/8.c) - * [807](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/807.c) - * [82](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/82.c) - * [83](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/83.c) - * [841](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/841.c) - * [852](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/852.c) - * [876](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/876.c) - * [9](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/9.c) - * [901](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/901.c) - * [905](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/905.c) - * [917](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/917.c) - * [931](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/931.c) - * [938](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/938.c) - * [94](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/94.c) - * [953](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/953.c) - * [965](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/965.c) - * [977](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/977.c) - * [979](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/979.c) - * [98](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/98.c) - * [985](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/985.c) - * [997](https://github.com/TheAlgorithms/C/blob/HEAD/leetcode/src/997.c) - ## Machine Learning * [Adaline Learning](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/adaline_learning.c) * [K Means Clustering](https://github.com/TheAlgorithms/C/blob/HEAD/machine_learning/k_means_clustering.c) From 2115ec87d66ff1199f10a996132ec609535d4043 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 31 Mar 2023 18:30:43 +0000 Subject: [PATCH 123/156] Update copyright notice to 2023 --- LICENSE | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/LICENSE b/LICENSE index ecc818272d..1e132df443 100644 --- a/LICENSE +++ b/LICENSE @@ -1,4 +1,4 @@ -Copyright (C) 2016-2022 TheAlgorithms and contributors +Copyright (C) 2016-2023 TheAlgorithms and contributors GNU GENERAL PUBLIC LICENSE Version 3, 29 June 2007 From a537cf3645f6da90ef30a8a545cf60a111fa1488 Mon Sep 17 00:00:00 2001 From: Aybars Nazlica Date: Thu, 6 Apr 2023 07:02:54 +0900 Subject: [PATCH 124/156] feat: add bisection method (#1233) * feat: add bisection method * fix function documentation * fix float to zero comparison * fix error definition * fix the sign function Co-authored-by: Sharon "Cass" Cassidy <122662061+CascadingCascade@users.noreply.github.com> * change float type to double type * fix sign comparison equals to zero * remove pow function * Update numerical_methods/bisection_method.c Co-authored-by: David Leal * add parameter docs * update docs * Update numerical_methods/bisection_method.c Co-authored-by: David Leal * Update numerical_methods/bisection_method.c Co-authored-by: David Leal * update docs --------- Co-authored-by: Sharon "Cass" Cassidy <122662061+CascadingCascade@users.noreply.github.com> Co-authored-by: David Leal --- numerical_methods/bisection_method.c | 111 +++++++++++++++++++++++++++ 1 file changed, 111 insertions(+) create mode 100644 numerical_methods/bisection_method.c diff --git a/numerical_methods/bisection_method.c b/numerical_methods/bisection_method.c new file mode 100644 index 0000000000..ce790f441f --- /dev/null +++ b/numerical_methods/bisection_method.c @@ -0,0 +1,111 @@ +/** + * @file + * @brief In mathematics, the [Bisection + * Method](https://en.wikipedia.org/wiki/Bisection_method) is a root-finding + * method that applies to any continuous function for which one knows two values + * with opposite signs. + * @details + * The method consists of repeatedly bisecting the interval + * defined by the two values and then selecting the subinterval in which the + * function changes sign, and therefore must contain a root. It is a very + * simple and robust method, but it is also relatively slow. Because of this, + * it is often used to obtain a rough approximation to a solution which is + * then used as a starting point for more rapidly converging methods. + * @author [Aybars Nazlica](https://github.com/aybarsnazlica) + */ + +#include /// for assert +#include /// for fabs +#include /// for IO operations + +#define EPSILON 0.0001 // a small positive infinitesimal quantity +#define NMAX 50 // maximum number of iterations + +/** + * @brief Function to check if two input values have the same sign (the property + * of being positive or negative) + * @param a Input value + * @param b Input value + * @returns 1.0 if the input values have the same sign, + * @returns -1.0 if the input values have different signs + */ +double sign(double a, double b) +{ + return (a > 0 && b > 0) + (a < 0 && b < 0) - (a > 0 && b < 0) - + (a < 0 && b > 0); +} + +/** + * @brief Continuous function for which we want to find the root + * @param x Real input variable + * @returns The evaluation result of the function using the input value + */ +double func(double x) +{ + return x * x * x + 2.0 * x - 10.0; // f(x) = x**3 + 2x - 10 +} + +/** + * @brief Root-finding method for a continuous function given two values with + * opposite signs + * @param x_left Lower endpoint value of the interval + * @param x_right Upper endpoint value of the interval + * @param tolerance Error threshold + * @returns `root of the function` if bisection method succeed within the + * maximum number of iterations + * @returns `-1` if bisection method fails + */ +double bisection(double x_left, double x_right, double tolerance) +{ + int n = 1; // step counter + double middle; // midpoint + + while (n <= NMAX) + { + middle = (x_left + x_right) / 2; // bisect the interval + double error = middle - x_left; + + if (fabs(func(middle)) < EPSILON || error < tolerance) + { + return middle; + } + + if (sign(func(middle), func(x_left)) > 0.0) + { + x_left = middle; // new lower endpoint + } + else + { + x_right = middle; // new upper endpoint + } + + n++; // increase step counter + } + return -1; // method failed (maximum number of steps exceeded) +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() +{ + /* Compares root value that is found by the bisection method within a given + * floating point error*/ + assert(fabs(bisection(1.0, 2.0, 0.0001) - 1.847473) < + EPSILON); // the algorithm works as expected + assert(fabs(bisection(100.0, 250.0, 0.0001) - 249.999928) < + EPSILON); // the algorithm works as expected + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() +{ + test(); // run self-test implementations + return 0; +} From 0c5eccc69e8f3586b956d25c80a1d49ff1fde19b Mon Sep 17 00:00:00 2001 From: dsmurrow <73198549+dsmurrow@users.noreply.github.com> Date: Fri, 7 Apr 2023 15:35:40 -0400 Subject: [PATCH 125/156] docs: fixed some documentation errors in BLAKE2b (#1234) * docs: Slight modifications Changed #include comments from doc to regular because it messed up the generated documentation. Changed blake2b() comment from regular to doc * docs: Removed @define's Doxygen doesn't seem to like them. Also fixed param on CEIL * chore: made it so math directory gets built * docs: added back third slash for includes * feat: added extended Euclidean algorithm * fix: key wasn't being considered in the algorithm * chore: added more tests * chore: Deleted file accidentally added from different branch * chore: moved tests to their own function * chore: apply suggestions from code review --------- Co-authored-by: David Leal --- hash/hash_blake2b.c | 103 +++++++++++++++++++++++++++++++++++++------- 1 file changed, 87 insertions(+), 16 deletions(-) diff --git a/hash/hash_blake2b.c b/hash/hash_blake2b.c index 69b254edf9..3c7b75781b 100644 --- a/hash/hash_blake2b.c +++ b/hash/hash_blake2b.c @@ -28,53 +28,45 @@ #endif /** - * @define bb * @brief the size of a data block in bytes */ #define bb 128 /** - * @define KK_MAX * @brief max key length for BLAKE2b */ #define KK_MAX 64 /** - * @define NN_MAX * @brief max length of BLAKE2b digest in bytes */ #define NN_MAX 64 /** - * @define CEIL * @brief ceiling division macro without floats * * @param a dividend - * @param divisor + * @param b divisor */ #define CEIL(a, b) (((a) / (b)) + ((a) % (b) != 0)) /** - * @define MIN * @brief returns minimum value */ #define MIN(a, b) ((a) < (b) ? (a) : (b)) /** - * @define MAX * @brief returns maximum value */ #define MAX(a, b) ((a) > (b) ? (a) : (b)) /** - * @define ROTR64 * @brief macro to rotate 64-bit ints to the right * Ripped from RFC 7693 */ #define ROTR64(n, offset) (((n) >> (offset)) ^ ((n) << (64 - (offset)))) /** - * @define U128_ZERO * @brief zero-value initializer for u128 type */ #define U128_ZERO \ @@ -344,7 +336,8 @@ static int BLAKE2B(uint8_t *dest, block_t *d, size_t dd, u128 ll, uint8_t kk, return 0; } -/* @brief blake2b hash function +/** + * @brief blake2b hash function * * This is the front-end function that sets up the argument for BLAKE2B(). * @@ -398,7 +391,7 @@ uint8_t *blake2b(const uint8_t *message, size_t len, const uint8_t *key, /* If there is a secret key it occupies the first block */ for (i = 0; i < kk; i++) { - long_hold = message[i]; + long_hold = key[i]; long_hold <<= 8 * (i % 8); word_in_block = (i % bb) / 8; @@ -449,15 +442,14 @@ static void assert_bytes(const uint8_t *expected, const uint8_t *actual, { assert(expected[i] == actual[i]); } - - printf("All tests have successfully passed!\n"); } /** - * @brief Main function - * @returns 0 on exit + * @brief testing function + * + * @returns void */ -int main() +static void test() { uint8_t *digest = NULL; @@ -476,5 +468,84 @@ int main() free(digest); + uint8_t key[64] = { + 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0a, + 0x0b, 0x0c, 0x0d, 0x0e, 0x0f, 0x10, 0x11, 0x12, 0x13, 0x14, 0x15, + 0x16, 0x17, 0x18, 0x19, 0x1a, 0x1b, 0x1c, 0x1d, 0x1e, 0x1f, 0x20, + 0x21, 0x22, 0x23, 0x24, 0x25, 0x26, 0x27, 0x28, 0x29, 0x2a, 0x2b, + 0x2c, 0x2d, 0x2e, 0x2f, 0x30, 0x31, 0x32, 0x33, 0x34, 0x35, 0x36, + 0x37, 0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f}; + uint8_t key_answer[64] = { + 0x10, 0xeb, 0xb6, 0x77, 0x00, 0xb1, 0x86, 0x8e, 0xfb, 0x44, 0x17, + 0x98, 0x7a, 0xcf, 0x46, 0x90, 0xae, 0x9d, 0x97, 0x2f, 0xb7, 0xa5, + 0x90, 0xc2, 0xf0, 0x28, 0x71, 0x79, 0x9a, 0xaa, 0x47, 0x86, 0xb5, + 0xe9, 0x96, 0xe8, 0xf0, 0xf4, 0xeb, 0x98, 0x1f, 0xc2, 0x14, 0xb0, + 0x05, 0xf4, 0x2d, 0x2f, 0xf4, 0x23, 0x34, 0x99, 0x39, 0x16, 0x53, + 0xdf, 0x7a, 0xef, 0xcb, 0xc1, 0x3f, 0xc5, 0x15, 0x68}; + + digest = blake2b(NULL, 0, key, 64, 64); + assert_bytes(key_answer, digest, 64); + + free(digest); + + uint8_t zero[1] = {0}; + uint8_t zero_key[64] = { + 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0a, + 0x0b, 0x0c, 0x0d, 0x0e, 0x0f, 0x10, 0x11, 0x12, 0x13, 0x14, 0x15, + 0x16, 0x17, 0x18, 0x19, 0x1a, 0x1b, 0x1c, 0x1d, 0x1e, 0x1f, 0x20, + 0x21, 0x22, 0x23, 0x24, 0x25, 0x26, 0x27, 0x28, 0x29, 0x2a, 0x2b, + 0x2c, 0x2d, 0x2e, 0x2f, 0x30, 0x31, 0x32, 0x33, 0x34, 0x35, 0x36, + 0x37, 0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f}; + uint8_t zero_answer[64] = { + 0x96, 0x1f, 0x6d, 0xd1, 0xe4, 0xdd, 0x30, 0xf6, 0x39, 0x01, 0x69, + 0x0c, 0x51, 0x2e, 0x78, 0xe4, 0xb4, 0x5e, 0x47, 0x42, 0xed, 0x19, + 0x7c, 0x3c, 0x5e, 0x45, 0xc5, 0x49, 0xfd, 0x25, 0xf2, 0xe4, 0x18, + 0x7b, 0x0b, 0xc9, 0xfe, 0x30, 0x49, 0x2b, 0x16, 0xb0, 0xd0, 0xbc, + 0x4e, 0xf9, 0xb0, 0xf3, 0x4c, 0x70, 0x03, 0xfa, 0xc0, 0x9a, 0x5e, + 0xf1, 0x53, 0x2e, 0x69, 0x43, 0x02, 0x34, 0xce, 0xbd}; + + digest = blake2b(zero, 1, zero_key, 64, 64); + assert_bytes(zero_answer, digest, 64); + + free(digest); + + uint8_t filled[64] = { + 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0a, + 0x0b, 0x0c, 0x0d, 0x0e, 0x0f, 0x10, 0x11, 0x12, 0x13, 0x14, 0x15, + 0x16, 0x17, 0x18, 0x19, 0x1a, 0x1b, 0x1c, 0x1d, 0x1e, 0x1f, 0x20, + 0x21, 0x22, 0x23, 0x24, 0x25, 0x26, 0x27, 0x28, 0x29, 0x2a, 0x2b, + 0x2c, 0x2d, 0x2e, 0x2f, 0x30, 0x31, 0x32, 0x33, 0x34, 0x35, 0x36, + 0x37, 0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f}; + uint8_t filled_key[64] = { + 0x00, 0x01, 0x02, 0x03, 0x04, 0x05, 0x06, 0x07, 0x08, 0x09, 0x0a, + 0x0b, 0x0c, 0x0d, 0x0e, 0x0f, 0x10, 0x11, 0x12, 0x13, 0x14, 0x15, + 0x16, 0x17, 0x18, 0x19, 0x1a, 0x1b, 0x1c, 0x1d, 0x1e, 0x1f, 0x20, + 0x21, 0x22, 0x23, 0x24, 0x25, 0x26, 0x27, 0x28, 0x29, 0x2a, 0x2b, + 0x2c, 0x2d, 0x2e, 0x2f, 0x30, 0x31, 0x32, 0x33, 0x34, 0x35, 0x36, + 0x37, 0x38, 0x39, 0x3a, 0x3b, 0x3c, 0x3d, 0x3e, 0x3f}; + uint8_t filled_answer[64] = { + 0x65, 0x67, 0x6d, 0x80, 0x06, 0x17, 0x97, 0x2f, 0xbd, 0x87, 0xe4, + 0xb9, 0x51, 0x4e, 0x1c, 0x67, 0x40, 0x2b, 0x7a, 0x33, 0x10, 0x96, + 0xd3, 0xbf, 0xac, 0x22, 0xf1, 0xab, 0xb9, 0x53, 0x74, 0xab, 0xc9, + 0x42, 0xf1, 0x6e, 0x9a, 0xb0, 0xea, 0xd3, 0x3b, 0x87, 0xc9, 0x19, + 0x68, 0xa6, 0xe5, 0x09, 0xe1, 0x19, 0xff, 0x07, 0x78, 0x7b, 0x3e, + 0xf4, 0x83, 0xe1, 0xdc, 0xdc, 0xcf, 0x6e, 0x30, 0x22}; + + digest = blake2b(filled, 64, filled_key, 64, 64); + assert_bytes(filled_answer, digest, 64); + + free(digest); + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief main function + * + * @returns 0 on successful program exit + */ +int main() +{ + test(); return 0; } From 2698ad2d135142bcfee9d43a41dba14c28309c5c Mon Sep 17 00:00:00 2001 From: Pongsakorn TIPPAYASOMDECH Date: Sun, 9 Apr 2023 08:58:03 +0700 Subject: [PATCH 126/156] fix: Segmentation fault in `merge_sort.c` (#1243) * fix segmentation fault * add a comments * add print error message when can't malloc and exit program * Update sorting/merge_sort.c Co-authored-by: Sharon "Cass" Cassidy * Update sorting/merge_sort.c Co-authored-by: Sharon "Cass" Cassidy --------- Co-authored-by: Sharon "Cass" Cassidy --- sorting/merge_sort.c | 21 ++++++++++++++++++++- 1 file changed, 20 insertions(+), 1 deletion(-) diff --git a/sorting/merge_sort.c b/sorting/merge_sort.c index c61767a154..ac1046f489 100644 --- a/sorting/merge_sort.c +++ b/sorting/merge_sort.c @@ -33,6 +33,11 @@ void swap(int *a, int *b) void merge(int *a, int l, int r, int n) { int *b = (int *)malloc(n * sizeof(int)); /* dynamic memory must be freed */ + if (b == NULL) + { + printf("Can't Malloc! Please try again."); + exit(EXIT_FAILURE); + } int c = l; int p1, p2; p1 = l; @@ -101,18 +106,32 @@ void merge_sort(int *a, int n, int l, int r) int main(void) { int *a, n, i; + printf("Enter Array size: "); scanf("%d", &n); + if (n <= 0) /* exit program if arraysize is not greater than 0 */ + { + printf("Array size must be Greater than 0!\n"); + return 1; + } a = (int *)malloc(n * sizeof(int)); + if (a == NULL) /* exit program if can't malloc memory */ + { + printf("Can't Malloc! Please try again."); + return 1; + } for (i = 0; i < n; i++) { + printf("Enter number[%d]: ", i); scanf("%d", &a[i]); } merge_sort(a, n, 0, n - 1); + printf("Sorted Array: "); for (i = 0; i < n; i++) { - printf(" %d", a[i]); + printf("%d ", a[i]); } + printf("\n"); free(a); From e1fcdd2a0487a13d42ae44206b8d71af61b3a610 Mon Sep 17 00:00:00 2001 From: "Sharon \"Cass\" Cassidy" Date: Wed, 12 Apr 2023 08:57:27 +0800 Subject: [PATCH 127/156] =?UTF-8?q?feat:=20Add=20McNaughton=E2=80=93Yamada?= =?UTF-8?q?=E2=80=93Thompson=20algorithm=20(#1241)?= MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit * updating DIRECTORY.md * Create mcnaughton_yamada_thompson.c * updating DIRECTORY.md * Update mcnaughton_yamada_thompson.c * fix some memory leaks * fix another memory leak * Update mcnaughton_yamada_thompson.c * added more test cases * a few formatting changes * another few SPaG changes * Update misc/mcnaughton_yamada_thompson.c Co-authored-by: David Leal * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] Co-authored-by: David Leal --- DIRECTORY.md | 2 + misc/mcnaughton_yamada_thompson.c | 721 ++++++++++++++++++++++++++++++ 2 files changed, 723 insertions(+) create mode 100644 misc/mcnaughton_yamada_thompson.c diff --git a/DIRECTORY.md b/DIRECTORY.md index 1e49c05293..cad509a70b 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -205,6 +205,7 @@ * [Hamming Distance](https://github.com/TheAlgorithms/C/blob/HEAD/misc/hamming_distance.c) * [Lexicographic Permutations](https://github.com/TheAlgorithms/C/blob/HEAD/misc/lexicographic_permutations.c) * [Longest Subsequence](https://github.com/TheAlgorithms/C/blob/HEAD/misc/longest_subsequence.c) + * [Mcnaughton Yamada Thompson](https://github.com/TheAlgorithms/C/blob/HEAD/misc/mcnaughton_yamada_thompson.c) * [Mirror](https://github.com/TheAlgorithms/C/blob/HEAD/misc/mirror.c) * [Pid](https://github.com/TheAlgorithms/C/blob/HEAD/misc/pid.c) * [Poly Add](https://github.com/TheAlgorithms/C/blob/HEAD/misc/poly_add.c) @@ -218,6 +219,7 @@ * [Union Find](https://github.com/TheAlgorithms/C/blob/HEAD/misc/union_find.c) ## Numerical Methods + * [Bisection Method](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/bisection_method.c) * [Durand Kerner Roots](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/durand_kerner_roots.c) * [Gauss Elimination](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/gauss_elimination.c) * [Gauss Seidel Method](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/gauss_seidel_method.c) diff --git a/misc/mcnaughton_yamada_thompson.c b/misc/mcnaughton_yamada_thompson.c new file mode 100644 index 0000000000..9f13ae03e4 --- /dev/null +++ b/misc/mcnaughton_yamada_thompson.c @@ -0,0 +1,721 @@ +/** + * @file + * @brief [McNaughton–Yamada–Thompson algorithm](https://en.wikipedia.org/wiki/Thompson%27s_construction) + * @details + * From Wikipedia: + * In computer science, Thompson's construction algorithm, + * also called the McNaughton–Yamada–Thompson algorithm, + * is a method of transforming a regular expression into + * an equivalent nondeterministic finite automaton (NFA). + * This implementation implements the all three operations + * (implicit concatenation, '|' for union, '*' for Kleene star) + * required by the formal definition of regular expressions. + * @author [Sharon Cassidy](https://github.com/CascadingCascade) + */ + +#include /// for assert() +#include /// for IO operations +#include /// for string operations +#include /// for memory management + +/* Begin declarations, I opted to place various helper / utility functions + * close to their usages and didn't split their declaration / definition */ + +/** + * @brief Definition for a binary abstract syntax tree (AST) node + */ +struct ASTNode { + char content; ///< the content of this node + struct ASTNode* left; ///< left child + struct ASTNode* right; ///< right child +}; + +struct ASTNode* createNode(char content); +void destroyNode(struct ASTNode* node); +char* preProcessing(const char* input); +struct ASTNode* buildAST(const char* input); + +/** + * @brief Definition for a NFA state transition rule + */ +struct transRule { + struct NFAState* target; ///< pointer to the state to transit to + char cond; ///< the input required to activate this transition +}; + +struct transRule* createRule(struct NFAState* state, char c); +void destroyRule(struct transRule* rule); + +/** + * @brief Definition for a NFA state. Each NFAState object is initialized + * to have a capacity of three rules, since there will only be at most two + * outgoing rules and one empty character circular rule in this algorithm + */ +struct NFAState { + int ruleCount; ///< number of transition rules this state have + struct transRule** rules; ///< the transition rules +}; + +struct NFAState* createState(void); +void destroyState(struct NFAState* state); + +/** + * @brief Definition for the NFA itself. + * statePool[0] is defined to be its starting state, + * and statePool[1] is defined to be its accepting state. + * for simplicity's sake all NFAs are initialized to have + * a small fixed capacity, although due to the recursive nature + * of this algorithm this capacity is believed to be sufficient + */ +struct NFA { + int stateCount; ///< the total number of states this NFA have + struct NFAState** statePool; ///< the pool of all available states + int ruleCount; ///< the total number of transition rules in this NFA + struct transRule** rulePool; ///< the pool of all transition rules + int CSCount; ///< the number of currently active states + struct NFAState** currentStates; ///< the pool of all active states + int subCount; ///< the number of sub NFAs + struct NFA** subs; ///< the pool of all sub NFAs + int wrapperFlag; ///< whether this NFA is a concatenation wrapper +}; + +struct NFA* createNFA(void); +void destroyNFA(struct NFA* nfa); +void addState(struct NFA* nfa, struct NFAState* state); +void addRule(struct NFA* nfa, struct transRule* rule, int loc); +void postProcessing(struct NFA* nfa); +void transit(struct NFA* nfa, char input); +int isAccepting(const struct NFA* nfa); + +/* End definitions, begin abstract syntax tree construction */ + +/** + * @brief helper function to determine whether a character should be + * considered a character literal + * @param ch the character to be tested + * @returns `1` if it is a character literal + * @returns `0` otherwise + */ +int isLiteral(const char ch) { + return !(ch == '(' || ch == ')' || ch == '*' || ch == '\n' || ch == '|'); +} + +/** + * @brief performs preprocessing on a regex string, + * making all implicit concatenations explicit + * @param input target regex string + * @returns pointer to the processing result + */ +char* preProcessing(const char* input) { + const size_t len = strlen(input); + if(len == 0) { + char* str = malloc(1); + str[0] = '\0'; + return str; + } + + char* str = malloc(len * 2); + size_t op = 0; + + for (size_t i = 0; i < len - 1; ++i) { + char c = input[i]; + str[op++] = c; + // one character lookahead + char c1 = input[i + 1]; + + if( (isLiteral(c) && isLiteral(c1)) || + (isLiteral(c) && c1 == '(') || + (c == ')' && c1 == '(') || + (c == ')' && isLiteral(c1)) || + (c == '*' && isLiteral(c1)) || + (c == '*' && c1 == '(') + ) { + // '\n' is used to represent concatenation + // in this implementation + str[op++] = '\n'; + } + } + + str[op++] = input[len - 1]; + str[op] = '\0'; + return str; +} + +/** + * @brief utility function to locate the first occurrence + * of a character in a string while respecting parentheses + * @param str target string + * @param key the character to be located + * @returns the index of its first occurrence, `0` if it could not be found + */ +size_t indexOf(const char* str, char key) { + int depth = 0; + + for (size_t i = 0; i < strlen(str); ++i) { + const char c = str[i]; + + if(depth == 0 && c == key) { + return i; + } + if(c == '(') depth++; + if(c == ')') depth--; + } + // Due to the way this function is intended to be used, + // it's safe to assume the character will not appear as + // the string's first character + // thus `0` is used as the `not found` value + return 0; +} + +/** + * @brief utility function to create a subString + * @param str target string + * @param begin starting index, inclusive + * @param end ending index, inclusive + * @returns pointer to the newly created subString + */ +char* subString(const char* str, size_t begin, size_t end) { + char* res = malloc(end - begin + 2); + strncpy(res, str + begin, end - begin + 1); + res[end - begin + 1] = '\0'; + return res; +} + +/** + * @brief recursively constructs a AST from a preprocessed regex string + * @param input regex + * @returns pointer to the resulting tree + */ +struct ASTNode* buildAST(const char* input) { + + struct ASTNode* node = createNode('\0'); + node->left = NULL; + node->right = NULL; + const size_t len = strlen(input); + size_t index; + + // Empty input + if(len == 0) return node; + + // Character literals + if(len == 1) { + node->content = input[0]; + return node; + } + + // Discard parentheses + if(input[0] == '(' && input[len - 1] == ')') { + char* temp = subString(input, 1, len - 2); + destroyNode(node); + node = buildAST(temp); + + free(temp); + return node; + } + + // Union + index = indexOf(input, '|'); + if(index) { + node->content = '|'; + + char* temp1 = subString(input, 0, index - 1); + char* temp2 = subString(input, index + 1, len - 1); + node->left = buildAST(temp1); + node->right = buildAST(temp2); + + free(temp2); + free(temp1); + return node; + } + + // Concatenation + index = indexOf(input, '\n'); + if(index) { + node->content = '\n'; + + char* temp1 = subString(input, 0, index - 1); + char* temp2 = subString(input, index + 1, len - 1); + node->left = buildAST(temp1); + node->right = buildAST(temp2); + + free(temp2); + free(temp1); + return node; + } + + // Kleene star + // Testing with indexOf() is unnecessary here, + // Since all other possibilities have been exhausted + node->content = '*'; + char* temp = subString(input, 0, len - 2); + node->left = buildAST(temp); + node->right = NULL; + + free(temp); + return node; +} + +/* End AST construction, begins the actual algorithm itself */ + +/** + * @brief helper function to recursively redirect transition rule targets + * @param nfa target NFA + * @param src the state to redirect away from + * @param dest the state to redirect to + * @returns void + */ +void redirect(struct NFA* nfa, struct NFAState* src, struct NFAState* dest) { + for (int i = 0; i < nfa->subCount; ++i) { + redirect(nfa->subs[i], src, dest); + } + for (int i = 0; i < nfa->ruleCount; ++i) { + struct transRule* rule = nfa->rulePool[i]; + if (rule->target == src) { + rule->target = dest; + } + } +} + +struct NFA* compileFromAST(struct ASTNode* root) { + + struct NFA* nfa = createNFA(); + + // Empty input + if (root->content == '\0') { + addRule(nfa, createRule(nfa->statePool[1], '\0'), 0); + return nfa; + } + + // Character literals + if (isLiteral(root->content)) { + addRule(nfa, createRule(nfa->statePool[1], root->content), 0); + return nfa; + } + + switch (root->content) { + + case '\n': { + struct NFA* ln = compileFromAST(root->left); + struct NFA* rn = compileFromAST(root->right); + + // Redirects all rules targeting ln's accepting state to + // target rn's starting state + redirect(ln, ln->statePool[1], rn->statePool[0]); + + // Manually creates and initializes a special + // "wrapper" NFA + destroyNFA(nfa); + struct NFA* wrapper = malloc(sizeof(struct NFA)); + wrapper->stateCount = 2; + wrapper->statePool = malloc(sizeof(struct NFAState*) * 2); + wrapper->subCount = 0; + wrapper->subs = malloc(sizeof(struct NFA*) * 2); + wrapper->ruleCount = 0; + wrapper->rulePool = malloc(sizeof(struct transRule*) * 3); + wrapper->CSCount = 0; + wrapper->currentStates = malloc(sizeof(struct NFAState*) * 2); + wrapper->wrapperFlag = 1; + wrapper->subs[wrapper->subCount++] = ln; + wrapper->subs[wrapper->subCount++] = rn; + + // Maps the wrapper NFA's starting and ending states + // to its sub NFAs + wrapper->statePool[0] = ln->statePool[0]; + wrapper->statePool[1] = rn->statePool[1]; + + return wrapper; + } + case '|': { + + struct NFA* ln = compileFromAST(root->left); + struct NFA* rn = compileFromAST(root->right); + nfa->subs[nfa->subCount++] = ln; + nfa->subs[nfa->subCount++] = rn; + + // Adds empty character transition rules + addRule(nfa, createRule(ln->statePool[0], '\0'), 0); + addRule(ln, createRule(nfa->statePool[1], '\0'), 1); + addRule(nfa, createRule(rn->statePool[0], '\0'), 0); + addRule(rn, createRule(nfa->statePool[1], '\0'), 1); + + return nfa; + } + case '*': { + struct NFA* ln = compileFromAST(root->left); + nfa->subs[nfa->subCount++] = ln; + + addRule(ln, createRule(ln->statePool[0], '\0'), 1); + addRule(nfa, createRule(ln->statePool[0], '\0'), 0); + addRule(ln, createRule(nfa->statePool[1], '\0'), 1); + addRule(nfa, createRule(nfa->statePool[1], '\0'), 0); + + return nfa; + } + } + + // Fallback, shouldn't happen in normal operation + destroyNFA(nfa); + return NULL; +} + +/* Ends the algorithm, begins NFA utility functions*/ + +/** + * @brief adds a state to a NFA + * @param nfa target NFA + * @param state the NFA state to be added + * @returns void + */ +void addState(struct NFA* nfa, struct NFAState* state) { + nfa->statePool[nfa->stateCount++] = state; +} + +/** + * @brief adds a transition rule to a NFA + * @param nfa target NFA + * @param rule the rule to be added + * @param loc which state this rule should be added to + * @returns void + */ +void addRule(struct NFA* nfa, struct transRule* rule, int loc) { + nfa->rulePool[nfa->ruleCount++] = rule; + struct NFAState* state = nfa->statePool[loc]; + state->rules[state->ruleCount++] = rule; +} + +/** + * @brief performs postprocessing on a compiled NFA, + * add circular empty character transition rules where + * it's needed for the NFA to function correctly + * @param nfa target NFA + * @returns void + */ +void postProcessing(struct NFA* nfa) { + // Since the sub NFA's states and rules are managed + // through their own pools, recursion is necessary + for (int i = 0; i < nfa->subCount; ++i) { + postProcessing(nfa->subs[i]); + } + + // If a state does not have any empty character accepting rule, + // we add a rule that circles back to itself + // So this state will be preserved when + // empty characters are inputted + for (int i = 0; i < nfa->stateCount; ++i) { + + struct NFAState* pState = nfa->statePool[i]; + int f = 0; + for (int j = 0; j < pState->ruleCount; ++j) { + if(pState->rules[j]->cond == '\0') { + f = 1; + break; + } + } + + if (!f) { + addRule(nfa, createRule(pState, '\0'), i); + } + } +} + +/** + * @brief helper function to determine an element's presence in an array + * @param states target array + * @param len length of the target array + * @param state the element to search for + * @returns `1` if the element is present, `0` otherwise + */ +int contains(struct NFAState** states, int len, struct NFAState* state) { + int f = 0; + for (int i = 0; i < len; ++i) { + if(states[i] == state) { + f = 1; + break; + } + } + return f; +} + +/** + * @brief helper function to manage empty character transitions + * @param target target NFA + * @param states pointer to results storage location + * @param sc pointer to results count storage location + * @returns void + */ +void findEmpty(struct NFAState* target, struct NFAState** states, int *sc) { + for (int i = 0; i < target->ruleCount; ++i) { + const struct transRule *pRule = target->rules[i]; + + if (pRule->cond == '\0' && !contains(states, *sc, pRule->target)) { + states[(*sc)++] = pRule->target; + // the use of `states` and `sc` is necessary + // to sync data across recursion levels + findEmpty(pRule->target, states, sc); + } + } +} + +/** + * @brief moves a NFA forward + * @param nfa target NFA + * @param input the character to be fed into the NFA + * @returns void + */ +void transit(struct NFA* nfa, char input) { + struct NFAState** newStates = malloc(sizeof(struct NFAState*) * 10); + int NSCount = 0; + + if (input == '\0') { + // In case of empty character input, it's possible for + // a state to transit to another state that's more than + // one rule away, we need to take that into account + for (int i = nfa->CSCount - 1; i > -1; --i) { + struct NFAState *pState = nfa->currentStates[i]; + nfa->CSCount--; + + struct NFAState** states = malloc(sizeof(struct NFAState*) * 10); + int sc = 0; + findEmpty(pState, states, &sc); + + for (int j = 0; j < sc; ++j) { + if(!contains(newStates,NSCount, states[j])) { + newStates[NSCount++] = states[j]; + } + } + free(states); + } + } else { + // Iterates through all current states + for (int i = nfa->CSCount - 1; i > -1; --i) { + struct NFAState *pState = nfa->currentStates[i]; + // Gradually empties the current states pool, so + // it can be refilled + nfa->CSCount--; + + // Iterates through rules of this state + for (int j = 0; j < pState->ruleCount; ++j) { + const struct transRule *pRule = pState->rules[j]; + + if(pRule->cond == input) { + if(!contains(newStates, NSCount, pRule->target)) { + newStates[NSCount++] = pRule->target; + } + } + } + } + } + + nfa->CSCount = NSCount; + for (int i = 0; i < NSCount; ++i) { + nfa->currentStates[i] = newStates[i]; + } + free(newStates); +} + +/** + * @brief determines whether the NFA is currently in its accepting state + * @param nfa target NFA + * @returns `1` if the NFA is in its accepting state + * @returns `0` otherwise + */ +int isAccepting(const struct NFA* nfa) { + for (int i = 0; i < nfa->CSCount; ++i) { + if(nfa->currentStates[i] == nfa->statePool[1]) { + return 1; + } + } + return 0; +} + +/* Ends NFA utilities, begins testing function*/ + +/** + * @brief Testing helper function + * @param regex the regular expression to be used + * @param string the string to match against + * @param expected expected results + * @returns void + */ +void testHelper(const char* regex, const char* string, const int expected) { + char* temp = preProcessing(regex); + struct ASTNode* node = buildAST(temp); + + struct NFA* nfa = compileFromAST(node); + postProcessing(nfa); + + // reallocates the outermost NFA's current states pool + // because it will actually be used to store all the states + nfa->currentStates = realloc(nfa->currentStates, sizeof(struct NFAState*) * 100); + // Starts the NFA by adding its starting state to the pool + nfa->currentStates[nfa->CSCount++] = nfa->statePool[0]; + + // feeds empty characters into the NFA before and after + // every normal character + for (size_t i = 0; i < strlen(string); ++i) { + transit(nfa, '\0'); + transit(nfa, string[i]); + } + transit(nfa, '\0'); + + assert(isAccepting(nfa) == expected); + + destroyNFA(nfa); + destroyNode(node); + free(temp); +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test(void) { + testHelper("(c|a*b)", "c", 1); + testHelper("(c|a*b)", "aab", 1); + testHelper("(c|a*b)", "ca", 0); + testHelper("(c|a*b)*", "caaab", 1); + testHelper("(c|a*b)*", "caba", 0); + testHelper("", "", 1); + testHelper("", "1", 0); + testHelper("(0|(1(01*(00)*0)*1)*)*","11",1); + testHelper("(0|(1(01*(00)*0)*1)*)*","110",1); + testHelper("(0|(1(01*(00)*0)*1)*)*","1100",1); + testHelper("(0|(1(01*(00)*0)*1)*)*","10000",0); + testHelper("(0|(1(01*(00)*0)*1)*)*","00000",1); + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main(void) { + test(); // run self-test implementations + return 0; +} + +/* I opted to place these more-or-less boilerplate code and their docs + * at the end of file for better readability */ + +/** + * @brief creates and initializes a AST node + * @param content data to initializes the node with + * @returns pointer to the newly created node + */ +struct ASTNode* createNode(const char content) { + struct ASTNode* node = malloc(sizeof(struct ASTNode)); + node->content = content; + node->left = NULL; + node->right = NULL; + return node; +} + +/** + * @brief recursively destroys a AST + * @param node the root node of the tree to be deleted + * @returns void + */ +void destroyNode(struct ASTNode* node) { + if(node->left != NULL) { + destroyNode(node->left); + } + + if(node->right != NULL) { + destroyNode(node->right); + } + + free(node); +} + +/** + * @brief creates and initializes a transition rule + * @param state transition target + * @param c transition condition + * @returns pointer to the newly created rule + */ +struct transRule* createRule(struct NFAState* state, char c) { + struct transRule* rule = malloc(sizeof(struct transRule)); + rule->target = state; + rule->cond = c; + return rule; +} + +/** + * @brief destroys a transition rule object + * @param rule pointer to the object to be deleted + * @returns void + */ +void destroyRule(struct transRule* rule) { + free(rule); +} + +/** + * @brief creates and initializes a NFA state + * @returns pointer to the newly created NFA state + */ +struct NFAState* createState(void) { + struct NFAState* state = malloc(sizeof(struct NFAState)); + state->ruleCount = 0; + state->rules = malloc(sizeof(struct transRule*) * 3); + return state; +} + +/** + * @brief destroys a NFA state + * @param state pointer to the object to be deleted + * @returns void + */ +void destroyState(struct NFAState* state) { + free(state->rules); + free(state); +} + +/** + * @brief creates and initializes a NFA + * @returns pointer to the newly created NFA + */ +struct NFA* createNFA(void) { + struct NFA* nfa = malloc(sizeof(struct NFA)); + + nfa->stateCount = 0; + nfa->statePool = malloc(sizeof(struct NFAState*) * 5); + nfa->ruleCount = 0; + nfa->rulePool = malloc(sizeof(struct transRule*) * 10); + nfa->CSCount = 0; + nfa->currentStates = malloc(sizeof(struct NFAState*) * 5); + nfa->subCount = 0; + nfa->subs = malloc(sizeof(struct NFA*) * 5); + nfa->wrapperFlag = 0; + + addState(nfa, createState()); + addState(nfa, createState()); + return nfa; +} + +/** + * @brief recursively destroys a NFA + * @param nfa pointer to the object to be deleted + * @returns void + */ +void destroyNFA(struct NFA* nfa) { + for (int i = 0; i < nfa->subCount; ++i) { + destroyNFA(nfa->subs[i]); + } + + // In case of a wrapper NFA, do not free its states + // because it doesn't really have any states of its own + if (!nfa->wrapperFlag) { + for (int i = 0; i < nfa->stateCount; ++i) { + destroyState(nfa->statePool[i]); + } + } + for (int i = 0; i < nfa->ruleCount; ++i) { + destroyRule(nfa->rulePool[i]); + } + free(nfa->statePool); + free(nfa->currentStates); + free(nfa->rulePool); + free(nfa->subs); + free(nfa); +} From 0a5f5c61f73004cd90208ec5b998d22aec3ff246 Mon Sep 17 00:00:00 2001 From: dsmurrow <73198549+dsmurrow@users.noreply.github.com> Date: Thu, 13 Apr 2023 17:33:10 -0400 Subject: [PATCH 128/156] feat: added extended Euclidean algorithm (#1238) * chore: made it so math directory gets built * feat: added extended Euclidean algorithm * docs: added details qualifier Co-authored-by: David Leal * docs: added param qualifiers to functions that needed them * docs: added details qualifier Co-authored-by: David Leal * docs: small cleanup --------- Co-authored-by: David Leal --- math/euclidean_algorithm_extended.c | 154 ++++++++++++++++++++++++++++ 1 file changed, 154 insertions(+) create mode 100644 math/euclidean_algorithm_extended.c diff --git a/math/euclidean_algorithm_extended.c b/math/euclidean_algorithm_extended.c new file mode 100644 index 0000000000..914eb98ba0 --- /dev/null +++ b/math/euclidean_algorithm_extended.c @@ -0,0 +1,154 @@ +/** + * @{ + * @file + * @brief Program to perform the [extended Euclidean + * algorithm](https://en.wikipedia.org/wiki/Extended_Euclidean_algorithm) + * + * @details The extended Euclidean algorithm, on top of finding the GCD (greatest common + * divisor) of two integers a and b, also finds the values x and y such that + * ax+by = gcd(a, b) + */ + +#include /// for tests +#include /// for IO +#include /// for div function and corresponding div_t struct + +/** + * @brief a structure holding the values resulting from the extended Euclidean + * algorithm + */ +typedef struct euclidean_result +{ + int gcd; ///< the greatest common divisor calculated with the Euclidean + ///< algorithm + int x, y; ///< the values x and y such that ax + by = gcd(a, b) +} euclidean_result_t; + +/** + * @brief gives queue-like behavior to an array of two ints, pushing an element + * onto the end and pushing one off the front + * + * @param arr an array of ints acting as a queue + * @param newval the value being pushed into arr + * + * @returns void + */ +static inline void xy_push(int arr[2], int newval) +{ + arr[1] = arr[0]; + arr[0] = newval; +} + +/** + * @brief calculates the value of x or y and push those into the small 'queues' + * + * @details Both x and y are found by taking their value from 2 iterations ago minus the + * product of their value from 1 iteration ago and the most recent quotient. + * + * @param quotient the quotient from the latest iteration of the Euclidean + * algorithm + * @param prev the 'queue' holding the values of the two previous iterations + * + * @returns void + */ +static inline void calculate_next_xy(int quotient, int prev[2]) +{ + int next = prev[1] - (prev[0] * quotient); + xy_push(prev, next); +} + +/** + * @brief performs the extended Euclidean algorithm on integer inputs a and b + * + * @param a first integer input + * @param b second integer input + * + * @returns euclidean_result_t containing the gcd, and values x and y such that + * ax + by = gcd + */ +euclidean_result_t extended_euclidean_algorithm(int a, int b) +{ + int previous_remainder = 1; + int previous_x_values[2] = {0, 1}; + int previous_y_values[2] = {1, 0}; + div_t div_result; + euclidean_result_t result; + + /* swap values of a and b */ + if (abs(a) < abs(b)) + { + a ^= b; + b ^= a; + a ^= b; + } + + div_result.rem = b; + + while (div_result.rem > 0) + { + div_result = div(a, b); + + previous_remainder = b; + + a = b; + b = div_result.rem; + + calculate_next_xy(div_result.quot, previous_x_values); + calculate_next_xy(div_result.quot, previous_y_values); + } + + result.gcd = previous_remainder; + result.x = previous_x_values[1]; + result.y = previous_y_values[1]; + + return result; +} + +/** @} */ + +/** + * @brief perform one single check on the result of the algorithm with provided + * parameters and expected output + * + * @param a first paramater for Euclidean algorithm + * @param b second parameter for Euclidean algorithm + * @param gcd expected value of result.gcd + * @param x expected value of result.x + * @param y expected value of result.y + * + * @returns void + */ +static inline void single_test(int a, int b, int gcd, int x, int y) +{ + euclidean_result_t result; + + result = extended_euclidean_algorithm(a, b); + assert(result.gcd == gcd); + assert(result.x == x); + assert(result.y == y); +} + +/** + * @brief Perform tests on known results + * @returns void + */ +static void test() +{ + single_test(40, 27, 1, -2, 3); + single_test(71, 41, 1, -15, 26); + single_test(48, 18, 6, -1, 3); + single_test(99, 303, 3, -16, 49); + single_test(14005, 3507, 1, -305, 1218); + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief Main Function + * @returns 0 upon successful program exit + */ +int main() +{ + test(); // run self-test implementations + return 0; +} From b5b2218e60218ffc4d46ec0a1e94da583ce704fe Mon Sep 17 00:00:00 2001 From: dsmurrow <73198549+dsmurrow@users.noreply.github.com> Date: Thu, 13 Apr 2023 17:33:42 -0400 Subject: [PATCH 129/156] feat: added Affine Cipher (#1245) * feat: added affine cipher * chore: applied clang-format * docs: fixed typo Co-authored-by: Sharon "Cass" Cassidy * docs: added brief qualifier Co-authored-by: Sharon "Cass" Cassidy * chore: added const qualifier to test_string input * test: added checks for correct ciphertext * chore: removed asserts in modular_multiplicative_inverse and defined the ASCII conversion character * removed previous_remainder variable in modular_multiplicative_inverse() * chore: added brackets Co-authored-by: David Leal * chore: made test function static Co-authored-by: David Leal * docs: added back quotes to variable `a` Co-authored-by: David Leal * docs: added back quotes to more variables Co-authored-by: David Leal * chore: Added capitalization to string indicating passing tests Co-authored-by: David Leal * chore: apply suggestions from code review --------- Co-authored-by: Sharon "Cass" Cassidy Co-authored-by: David Leal --- cipher/affine.c | 207 ++++++++++++++++++++++++++++++++++++++++++++++++ 1 file changed, 207 insertions(+) create mode 100644 cipher/affine.c diff --git a/cipher/affine.c b/cipher/affine.c new file mode 100644 index 0000000000..49a91cd799 --- /dev/null +++ b/cipher/affine.c @@ -0,0 +1,207 @@ +/** + * @file + * @brief An [affine cipher](https://en.wikipedia.org/wiki/Affine_cipher) is a + * letter substitution cipher that uses a linear transformation to substitute + * letters in a message. + * @details Given an alphabet of length M with characters with numeric values + * 0-(M-1), an arbitrary character x can be transformed with the expression (ax + * + b) % M into our ciphertext character. The only caveat is that a must be + * relatively prime with M in order for this transformation to be invertible, + * i.e., gcd(a, M) = 1. + * @author [Daniel Murrow](https://github.com/dsmurrow) + */ + +#include /// for assertions +#include /// for IO +#include /// for div function and div_t struct as well as malloc and free +#include /// for strlen, strcpy, and strcmp + +/** + * @brief number of characters in our alphabet (printable ASCII characters) + */ +#define ALPHABET_SIZE 95 + +/** + * @brief used to convert a printable byte (32 to 126) to an element of the + * group Z_95 (0 to 94) + */ +#define Z95_CONVERSION_CONSTANT 32 + +/** + * @brief a structure representing an affine cipher key + */ +typedef struct +{ + int a; ///< what the character is being multiplied by + int b; ///< what is being added after the multiplication with `a` +} affine_key_t; + +/** + * @brief finds the value x such that (a * x) % m = 1 + * + * @param a number we are finding the inverse for + * @param m the modulus the inversion is based on + * + * @returns the modular multiplicative inverse of `a` mod `m` + */ +int modular_multiplicative_inverse(unsigned int a, unsigned int m) +{ + int x[2] = {1, 0}; + div_t div_result; + + if (m == 0) { + return 0; + } + a %= m; + if (a == 0) { + return 0; + } + + div_result.rem = a; + + while (div_result.rem > 0) + { + div_result = div(m, a); + + m = a; + a = div_result.rem; + + // Calculate value of x for this iteration + int next = x[1] - (x[0] * div_result.quot); + + x[1] = x[0]; + x[0] = next; + } + + return x[1]; +} + +/** + * @brief Given a valid affine cipher key, this function will produce the + * inverse key. + * + * @param key They key to be inverted + * + * @returns inverse of key + */ +affine_key_t inverse_key(affine_key_t key) +{ + affine_key_t inverse; + + inverse.a = modular_multiplicative_inverse(key.a, ALPHABET_SIZE); + + // Turn negative results positive + inverse.a += ALPHABET_SIZE; + inverse.a %= ALPHABET_SIZE; + + inverse.b = -(key.b % ALPHABET_SIZE) + ALPHABET_SIZE; + + return inverse; +} + +/** + * @brief Encrypts character string `s` with key + * + * @param s string to be encrypted + * @param key affine key used for encryption + * + * @returns void + */ +void affine_encrypt(char *s, affine_key_t key) +{ + for (int i = 0; s[i] != '\0'; i++) + { + int c = (int)s[i] - Z95_CONVERSION_CONSTANT; + + c *= key.a; + c += key.b; + c %= ALPHABET_SIZE; + + s[i] = (char)(c + Z95_CONVERSION_CONSTANT); + } +} + +/** + * @brief Decrypts an affine ciphertext + * + * @param s string to be decrypted + * @param key Key used when s was encrypted + * + * @returns void + */ +void affine_decrypt(char *s, affine_key_t key) +{ + affine_key_t inverse = inverse_key(key); + + for (int i = 0; s[i] != '\0'; i++) + { + int c = (int)s[i] - Z95_CONVERSION_CONSTANT; + + c += inverse.b; + c *= inverse.a; + c %= ALPHABET_SIZE; + + s[i] = (char)(c + Z95_CONVERSION_CONSTANT); + } +} + +/** + * @brief Tests a given string + * + * @param s string to be tested + * @param a value of key.a + * @param b value of key.b + * + * @returns void + */ +void test_string(const char *s, const char *ciphertext, int a, int b) +{ + char *copy = malloc((strlen(s) + 1) * sizeof(char)); + strcpy(copy, s); + + affine_key_t key = {a, b}; + + affine_encrypt(copy, key); + assert(strcmp(copy, ciphertext) == 0); // assert that the encryption worked + + affine_decrypt(copy, key); + assert(strcmp(copy, s) == + 0); // assert that we got the same string we started with + + free(copy); +} + +/** + * @brief Test multiple strings + * + * @returns void + */ +static void tests() +{ + test_string("Hello!", "&3ddy2", 7, 11); + test_string("TheAlgorithms/C", "DNC}=jHS2zN!7;E", 67, 67); + test_string("0123456789", "840,($ {ws", 91, 88); + test_string("7W@;cdeRT9uL", "JDfa*we?z&bL", 77, 76); + test_string("~Qr%^-+++$leM", "r'qC0$sss;Ahf", 8, 90); + test_string("The quick brown fox jumps over the lazy dog", + "K7: .*6<4 =-0(1 90' 5*2/, 0):- +7: 3>%& ;08", 94, 0); + test_string( + "One-1, Two-2, Three-3, Four-4, Five-5, Six-6, Seven-7, Eight-8, " + "Nine-9, Ten-10", + "H&60>\\2*uY0q\\2*p4660E\\2XYn40x\\2XDB60L\\2VDI0 " + "\\2V6B6&0S\\2%D=p;0'\\2tD&60Z\\2*6&0>j", + 51, 18); + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief main function + * + * @returns 0 upon successful program exit + */ +int main() +{ + tests(); + return 0; +} From 144442afba8b45709d0c3fe7b8992a1e3d6bac82 Mon Sep 17 00:00:00 2001 From: Niranjan <112152164+niranjank2022@users.noreply.github.com> Date: Fri, 21 Apr 2023 01:29:14 +0530 Subject: [PATCH 130/156] [feat/docs]: improve the Fibonacci algorithm (#1232) * Improve the documentation of factorial.c * Improve the documentation of fibonacci.c * Update starting terms of fibonacci as 0 and 1 * Update math/fibonacci.c Co-authored-by: Sharon "Cass" Cassidy <122662061+CascadingCascade@users.noreply.github.com> * docs: Documenting the code * test: Add test * fix: fix the test expression Co-authored-by: Sharon "Cass" Cassidy <122662061+CascadingCascade@users.noreply.github.com> * feat: Restrict non-integer inputs * fix: Change atoi() to sscanf() * fix: Change atoi() to sscanf() * fix: scanf() to getInput() * fix: while, continue and break Co-authored-by: Sharon "Cass" Cassidy <122662061+CascadingCascade@users.noreply.github.com> * fix: Increase buffer size * fix: Doesn't accept lengthy characters * fix: Accepts empty characters * fix: fibonacci.c Co-authored-by: Sharon "Cass" Cassidy <122662061+CascadingCascade@users.noreply.github.com> * feat: Add wikipedia link * feat: Add author Co-authored-by: David Leal * feat: Record time duration of function execution * chore: apply suggestions from code review Co-authored-by: Sharon "Cass" Cassidy * chore: apply suggestions from code review Co-authored-by: Sharon "Cass" Cassidy --------- Co-authored-by: Sharon "Cass" Cassidy <122662061+CascadingCascade@users.noreply.github.com> Co-authored-by: David Leal Co-authored-by: Sharon "Cass" Cassidy --- math/fibonacci.c | 125 ++++++++++++++++++++++++++++++++++++++++++----- 1 file changed, 113 insertions(+), 12 deletions(-) diff --git a/math/fibonacci.c b/math/fibonacci.c index 3af489624d..60752e7ae5 100644 --- a/math/fibonacci.c +++ b/math/fibonacci.c @@ -1,23 +1,124 @@ -#include +/** + * @file + * @brief Program to print the nth term of the Fibonacci series. + * @details + * Fibonacci series generally starts from 0 and 1. Every next term in + * the series is equal to the sum of the two preceding terms. + * For further info: https://en.wikipedia.org/wiki/Fibonacci_sequence + * + * @author [Luiz Carlos Aguiar C](https://github.com/IKuuhakuI) + * @author [Niranjan](https://github.com/niranjank2022) + */ -// Fibonnacci function -int fib(int number) +#include /// for assert() +#include /// for errno - to determine whether there is an error while using strtol() +#include /// for input, output +#include /// for exit() - to exit the program +#include /// to calculate time taken by fib() +/** + * @brief Determines the nth Fibonacci term + * @param number - n in "nth term" and it can't be negative as well as zero + * @return nth term in unsigned type + * @warning + * Only till 47th and 48th fibonacci element can be stored in `int` and + * `unsigned int` respectively (takes more than 20 seconds to print) + */ +unsigned int fib(int number) { - if (number == 1 || number == 2) + // Check for negative integers + if (number <= 0) + { + fprintf(stderr, "Illegal Argument Is Passed!\n"); + exit(EXIT_FAILURE); + } + + // Base conditions + if (number == 1) + return 0; + + if (number == 2) return 1; - else - return fib(number - 1) + fib(number - 2); + + // Recursive call to the function + return fib(number - 1) + fib(number - 2); } +/** + * @brief Get the input from the user + * @return valid argument to the fibonacci function + */ +int getInput(void) +{ + int num, excess_len; + char buffer[3], *endPtr; + + while (1) + { // Repeat until a valid number is entered + printf("Please enter a valid number:"); + fgets(buffer, 3, stdin); // Inputs the value from user + + excess_len = 0; + if (!(buffer[0] == '\n' || + buffer[1] == '\n' || + buffer[2] == '\n')) { + while (getchar() != '\n') excess_len++; + } + + num = strtol(buffer, &endPtr, + 10); // Attempts to convert the string to integer + + // Checking the input + if ( // The number is too large + (excess_len > 0 || num > 48) || + // Characters other than digits are included in the input + (*endPtr != '\0' && *endPtr != '\n') || + // No characters are entered + endPtr == buffer) + { + continue; + } + + break; + } + + printf("\nEntered digit: %d (it might take sometime)\n", num); + return num; +} + +/** + * @brief self-test implementation + * @return void + */ +static void test() +{ + assert(fib(5) == 3); + assert(fib(2) == 1); + assert(fib(9) == 21); +} + +/** + * @brief Main function + * @return 0 on exit + */ int main() { - int number; + // Performing the test + test(); + printf("Tests passed...\n"); - // Asks for the number that is in n position in Fibonnacci sequence - printf("Number: "); - scanf("%d", &number); + // Getting n + printf( + "Enter n to find nth fibonacci element...\n" + "Note: You would be asked to enter input until valid number ( less " + "than or equal to 48 ) is entered.\n"); - printf("%d \n", fib(number)); + int number = getInput(); + clock_t start, end; + start = clock(); + printf("Fibonacci element %d is %u ", number, fib(number)); + end = clock(); + + printf("in %.3f seconds.\n", ((double)(end - start)) / CLOCKS_PER_SEC ); return 0; -} \ No newline at end of file +} From 3ba43b75ed5ea265ae6a9d905de4ee61ecd21435 Mon Sep 17 00:00:00 2001 From: David Leal Date: Wed, 26 Apr 2023 11:27:51 -0600 Subject: [PATCH 131/156] docs: improve contributing guidelines --- CONTRIBUTING.md | 3 +++ 1 file changed, 3 insertions(+) diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index d6064dbea1..87686af3ca 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -109,6 +109,9 @@ static void test() { assert(func(...) == ...); // this ensures that the algorithm works as expected // can have multiple checks + + // this lets the user know that the tests passed + printf("All tests have successfully passed!\n"); } /** From d07ab7d0f1b3845e3de73b1642ed2cb25638b933 Mon Sep 17 00:00:00 2001 From: David Leal Date: Thu, 27 Apr 2023 10:38:05 -0600 Subject: [PATCH 132/156] docs: add self-test examples (#1250) * docs: add self-test examples * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] --- CONTRIBUTING.md | 96 +++++++++++++++++++++++++++++++++++++++++++++++++ DIRECTORY.md | 2 ++ 2 files changed, 98 insertions(+) diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index 87686af3ca..01638a59c4 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -57,6 +57,102 @@ For LeetCode solutions, please check its [**guide**](https://github.com/TheAlgor - Make sure to add examples and test cases in your `main()` function. - If you find an algorithm or document without tests, please feel free to create a pull request or issue describing suggested changes. - Please try to add one or more `test()` functions that will invoke the algorithm implementation on random test data with the expected output. Use the `assert()` function to confirm that the tests will pass. Requires including the `assert.h` library. +- Test cases should fully verify that your program works as expected. Rather than asking the user for input, it's best to make sure the given output is the correct output. + +##### Self-test examples + +1. [ROT13 Cipher](https://github.com/TheAlgorithms/C/blob/master/cipher/rot13.c) (complex). + +```c + // NOTE: the `rot13` function is defined in another part of the code. + + char test_01[] = "The more I C, the less I see."; + rot13(test_01); + assert(strcmp(test_01, "Gur zber V P, gur yrff V frr.") == 0); + + char test_02[] = "Which witch switched the Swiss wristwatches?"; + rot13(test_02); + assert(strcmp(test_02, "Juvpu jvgpu fjvgpurq gur Fjvff jevfgjngpurf?") == 0); + + char test_03[] = "Juvpu jvgpu fjvgpurq gur Fjvff jevfgjngpurf?"; + rot13(test_03); + assert(strcmp(test_03, "Which witch switched the Swiss wristwatches?") == 0); +``` + +2. [Sudoku Solver](https://github.com/TheAlgorithms/C/blob/master/misc/sudoku_solver.c) (medium). + +```c + uint8_t test_array[] = {3, 0, 6, 5, 0, 8, 4, 0, 0, 5, 2, 0, 0, 0, 0, 0, 0, + 0, 0, 8, 7, 0, 0, 0, 0, 3, 1, 0, 0, 3, 0, 1, 0, 0, + 8, 0, 9, 0, 0, 8, 6, 3, 0, 0, 5, 0, 5, 0, 0, 9, 0, + 6, 0, 0, 1, 3, 0, 0, 0, 0, 2, 5, 0, 0, 0, 0, 0, 0, + 0, 0, 7, 4, 0, 0, 5, 2, 0, 6, 3, 0, 0}; + struct sudoku a = {.N = 9, .N2 = 3, .a = test_array}; + assert(solve(&a)); // ensure that solution is obtained + // NOTE: `solve` is defined in another part of the code. + + uint8_t expected[] = {3, 1, 6, 5, 7, 8, 4, 9, 2, 5, 2, 9, 1, 3, 4, 7, 6, + 8, 4, 8, 7, 6, 2, 9, 5, 3, 1, 2, 6, 3, 4, 1, 5, 9, + 8, 7, 9, 7, 4, 8, 6, 3, 1, 2, 5, 8, 5, 1, 7, 9, 2, + 6, 4, 3, 1, 3, 8, 9, 4, 7, 2, 5, 6, 6, 9, 2, 3, 5, + 1, 8, 7, 4, 7, 4, 5, 2, 8, 6, 3, 1, 9}; + for (int i = 0; i < a.N; i++) + for (int j = 0; j < a.N; j++) + assert(a.a[i * a.N + j] == expected[i * a.N + j]); +``` + +3. Small C program that showcases and explains the use of tests. + +```c +#include /// for IO operations +#include /// for assert +#include /// for bool + +/** + * @brief Verifies if the given array + * contains the given number on it. + * @param arr the array to be used for checking + * @param number the number to check if it's inside the array + * @return false if the number was NOT found in the array + * @return true if the number WAS found in the array + */ +bool is_number_on_array(const int *arr, const int number) { + for (int i = 0; i < sizeof(arr); i++) { + if (arr[i] == number) { + return true; + } + else { + // Number not in the current index, keep searching. + } + } + + return false; +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void tests() { + int arr[] = { 9, 14, 21, 98, 67 }; + + assert(is_number_on_array(arr, 9) == true); + assert(is_number_on_array(arr, 4) == false); + assert(is_number_on_array(arr, 98) == true); + assert(is_number_on_array(arr, 512) == false); + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() { + tests(); // run self-test implementations + return 0; +} +``` #### Typical structure of a program diff --git a/DIRECTORY.md b/DIRECTORY.md index cad509a70b..d970ad9c2c 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -3,6 +3,7 @@ * [Alaw](https://github.com/TheAlgorithms/C/blob/HEAD/audio/alaw.c) ## Cipher + * [Affine](https://github.com/TheAlgorithms/C/blob/HEAD/cipher/affine.c) * [Rot13](https://github.com/TheAlgorithms/C/blob/HEAD/cipher/rot13.c) ## Client Server @@ -182,6 +183,7 @@ * [Cartesian To Polar](https://github.com/TheAlgorithms/C/blob/HEAD/math/cartesian_to_polar.c) * [Catalan](https://github.com/TheAlgorithms/C/blob/HEAD/math/catalan.c) * [Collatz](https://github.com/TheAlgorithms/C/blob/HEAD/math/collatz.c) + * [Euclidean Algorithm Extended](https://github.com/TheAlgorithms/C/blob/HEAD/math/euclidean_algorithm_extended.c) * [Factorial](https://github.com/TheAlgorithms/C/blob/HEAD/math/factorial.c) * [Factorial Large Number](https://github.com/TheAlgorithms/C/blob/HEAD/math/factorial_large_number.c) * [Factorial Trailing Zeroes](https://github.com/TheAlgorithms/C/blob/HEAD/math/factorial_trailing_zeroes.c) From 2b885108b87561de7ebe9f8975cbdcdc2b276384 Mon Sep 17 00:00:00 2001 From: Aditya Pal Date: Fri, 28 Apr 2023 01:07:59 +0530 Subject: [PATCH 133/156] feat: add LeetCode problem 434 (#1252) * feat: add LeetCode problem 434 Adds solution of problem 434 for leetcode. Beats 100% Time, 97.18% space * docs: updating `leetcode/DIRECTORY.md` * Update 434.c --------- Co-authored-by: PalAditya Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com> Co-authored-by: Alexander Pantyukhin --- leetcode/DIRECTORY.md | 1 + leetcode/src/434.c | 20 ++++++++++++++++++++ 2 files changed, 21 insertions(+) create mode 100644 leetcode/src/434.c diff --git a/leetcode/DIRECTORY.md b/leetcode/DIRECTORY.md index 4807b447d4..d4436ea420 100644 --- a/leetcode/DIRECTORY.md +++ b/leetcode/DIRECTORY.md @@ -89,6 +89,7 @@ | 387 | [First Unique Character in a String](https://leetcode.com/problems/first-unique-character-in-a-string) | [C](./src/387.c) | Easy | | 389 | [Find the Difference](https://leetcode.com/problems/find-the-difference) | [C](./src/389.c) | Easy | | 404 | [Sum of Left Leaves](https://leetcode.com/problems/sum-of-left-leaves) | [C](./src/404.c) | Easy | +| 434 | [Number of Segments in a String](https://leetcode.com/problems/number-of-segments-in-a-string) | [C](./src/434.c) | Easy | | 442 | [Find All Duplicates in an Array](https://leetcode.com/problems/find-all-duplicates-in-an-array) | [C](./src/442.c) | Medium | | 461 | [Hamming Distance](https://leetcode.com/problems/hamming-distance) | [C](./src/461.c) | Easy | | 476 | [Number Complement](https://leetcode.com/problems/number-complement) | [C](./src/476.c) | Easy | diff --git a/leetcode/src/434.c b/leetcode/src/434.c new file mode 100644 index 0000000000..a2d05d5cad --- /dev/null +++ b/leetcode/src/434.c @@ -0,0 +1,20 @@ +// Given a string s, returns the number of segments in the string. +int countSegments(char * s){ + int sLen = strlen(s); + int prevSpace = 1; + int result = 0; + char currChar; + + for (int i = 0; i < sLen; i++){ + currChar = s[i]; + + //A string of whitespaces will only be counted once as the condition below is only true when we transition from whitespace to non-whitespace. + //Since we start with assumed whitespace (prevSpace = 1), initial whitespaces are handled as well, if any + if (s[i] != ' ' && prevSpace) { + result++; + } + prevSpace = (currChar == ' '); + } + + return result; +} From 71a7cf3bc4696a49f5bc4e81ce8d569d2c238cb2 Mon Sep 17 00:00:00 2001 From: MRio <55620821+AtlantaEmrys2002@users.noreply.github.com> Date: Sun, 30 Apr 2023 16:47:09 +0100 Subject: [PATCH 134/156] feat: added hangman game #967 (#1248) * Add files via upload feat: added hangman game #967 * Update hangman.c * Update hangman.c * Update hangman.c * Update hangman.c * Update hangman.c * Update hangman.c Updated so that game instance was held as struct - can include current guess in game_instance too if preferred. * Update hangman.c * Update hangman.c * Add files via upload Adding test file * Update hangman.c * Update hangman.c Co-authored-by: David Leal Co-authored-by: Sharon "Cass" Cassidy --- games/hangman.c | 291 ++++++++++++++++++++++++++++++++++++++++++++++++ games/words.txt | 8 ++ 2 files changed, 299 insertions(+) create mode 100644 games/hangman.c create mode 100644 games/words.txt diff --git a/games/hangman.c b/games/hangman.c new file mode 100644 index 0000000000..5d2697df75 --- /dev/null +++ b/games/hangman.c @@ -0,0 +1,291 @@ +/** + * @file + * @brief C implementation of [Hangman Game](https://en.wikipedia.org/wiki/Hangman_(game)) + * @details + * Simple, readable version of hangman. + * Changed graphic to duck instead of traditional stick figure (same number of guesses). + * @author [AtlantaEmrys2002](https://github.com/AtlantaEmrys2002) +*/ + +#include /// for main() - tolower() +#include /// for main(), new_word(), new_guess(), won() - I/O operations +#include /// for all functions - exit(), rand() and file functions +#include /// for main() - for string operations strlen, strchr, strcpy +#include /// for new_game() - used with srand() for declaring new game instance + +/* + * @brief game_instance structure that holds current state of game + */ +struct game_instance{ + + char current_word[30]; ///< word to be guessed by player + char hidden[30]; ///< hidden version of word that is displayed to player + int size; ///< size of word + int incorrect; ///< number of incorrect guesses + char guesses[25]; ///< previous guesses + int guesses_size; ///< size of guesses array + +}; + +// function prototypes +struct game_instance new_game(void); // creates a new game +int new_guess(char, const char guesses[], int size); // checks if player has already played letter +int in_word(char, const char word[], unsigned int size); // checks if letter is in word +void picture(int score); // outputs image of duck (instead of hang man) +void won(const char word[], int score); // checks if player has won or lost + +/** + * @brief Main Function + * @returns 0 on exit + */ +int main() { + + struct game_instance game = new_game(); // new game created + char guess; // current letter guessed by player + + // main loop - asks player for guesses + while ((strchr(game.hidden, '_') != NULL) && game.incorrect <= 12) { + do { + printf("\n****************************\n"); + printf("Your word: "); + + for (int i = 0; i < game.size; i++) { + printf("%c ", game.hidden[i]); + } + + if (game.guesses_size > 0) { + printf("\nSo far, you have guessed: "); + for (int i = 0; i < game.guesses_size; i++) { + printf("%c ", game.guesses[i]); + } + } + + printf("\nYou have %d guesses left.", (12 - game.incorrect)); + printf("\nPlease enter a letter: "); + scanf(" %c", &guess); + guess = tolower(guess); + + } while (new_guess(guess, game.guesses, game.guesses_size) != -1); + + game.guesses[game.guesses_size] = guess; // adds new letter to guesses array + game.guesses_size++; // updates size of guesses array + + if (in_word(guess, game.current_word, game.size) == 1) { + printf("That letter is in the word!"); + for (int i = 0; i < game.size; i++) { + if ((game.current_word[i]) == guess) { + game.hidden[i] = guess; + } + } + } else { + printf("That letter is not in the word.\n"); + (game.incorrect)++; + } + picture(game.incorrect); + } + + won(game.current_word, game.incorrect); + return 0; +} + +/** + * @brief checks if letter has been guessed before + * @param new_guess letter that has been guessed by player + * @param guesses array of player's previous guesses + * @param size size of guesses[] array + * @returns 1 if letter has been guessed before + * @returns -1 if letter has not been guessed before + */ +int new_guess(char new_guess, const char guesses[], int size) { + + for (int j = 0; j < size; j++) { + if (guesses[j] == new_guess) { + printf("\nYou have already guessed that letter."); + return 1; + } + } + + return -1; +} + +/** + * @brief checks if letter is in current word + * @param letter letter guessed by player + * @param word current word + * @param size length of word + * @returns 1 if letter is in word + * @returns -1 if letter is not in word + */ +int in_word(char letter, const char word[], unsigned int size) { + + for (int i = 0; i < size; i++) { + if ((word[i]) == letter) { + return 1; + } + } + + return -1; +} + +/** + * @brief creates a new game - generates a random word and stores in global variable current_word + * @returns current_game - a new game instance containing randomly selected word, its length and hidden version of word + */ +struct game_instance new_game() { + + char word[30]; // used throughout function + + FILE *fptr; + fptr = fopen("games/words.txt", "r"); + + if (fptr == NULL){ + fprintf(stderr, "File not found.\n"); + exit(EXIT_FAILURE); + } + + // counts number of words in file - assumes each word on new line + int line_number = 0; + while (fgets(word, 30, fptr) != NULL) { + line_number++; + } + + rewind(fptr); + + // generates random number + int random_num; + srand(time(NULL)); + random_num = rand() % line_number; + + // selects randomly generated word + int s = 0; + while (s <= random_num){ + fgets(word, 30, fptr); + s++; + } + + // formats string correctly + if (strchr(word, '\n') != NULL){ + word[strlen(word) - 1] = '\0'; + } + + fclose(fptr); + + // creates new game instance + struct game_instance current_game; + strcpy(current_game.current_word, word); + current_game.size = strlen(word); + for (int i = 0; i < (strlen(word)); i++) { + current_game.hidden[i] = '_'; + } + current_game.incorrect = 0; + current_game.guesses_size = 0; + + return current_game; +} + +/** + * @brief checks if player has won or lost + * @param word the word player has attempted to guess + * @param score how many incorrect guesses player has made + * @returns void + */ +void won(const char word[], int score) { + if (score > 12) { + printf("\nYou lost! The word was: %s.\n", word); + } + else { + printf("\nYou won! You had %d guesses left.\n", (12 - score)); + } +} + +/* + * @brief gradually draws duck as player gets letters incorrect + * @param score how many incorrect guesses player has made + * @returns void + */ +void picture(int score) { + + switch(score) { + + case 12: + printf("\n _\n" + " __( ' )> \n" + " \\_ < _ ) "); + break; + + case 11: + printf("\n _\n" + " __( ' )\n" + " \\_ < _ ) "); + break; + + case 10: + printf("\n _\n" + " __( )\n" + " \\_ < _ ) "); + break; + + case 9: + printf("\n \n" + " __( )\n" + " \\_ < _ ) "); + break; + + case 8: + printf("\n \n" + " __( \n" + " \\_ < _ ) "); + break; + + case 7: + printf("\n \n" + " __ \n" + " \\_ < _ ) "); + break; + + case 6: + printf("\n \n" + " _ \n" + " \\_ < _ ) "); + break; + + case 5: + printf("\n \n" + " _ \n" + " _ < _ ) "); + break; + + case 4: + printf("\n \n" + " \n" + " _ < _ ) "); + break; + + case 3: + printf("\n \n" + " \n" + " < _ ) "); + break; + + case 2: + printf("\n \n" + " \n" + " _ ) "); + break; + + case 1: + printf("\n \n" + " \n" + " ) "); + break; + + case 0: + break; + + default: + printf("\n _\n" + " __( ' )> QUACK!\n" + " \\_ < _ ) "); + break; + } +} diff --git a/games/words.txt b/games/words.txt new file mode 100644 index 0000000000..0db94bf699 --- /dev/null +++ b/games/words.txt @@ -0,0 +1,8 @@ +dog +cat +tree +flower +table +programming +language +testing \ No newline at end of file From aae2aac1ff58d42d97975bd70e8e00deda36bf1c Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 12 May 2023 12:26:32 -0600 Subject: [PATCH 135/156] chore: minor LeetCode directory workflow improvements (#1247) * updating DIRECTORY.md * chore: minor LeetCode directory work... ...flow improvements. * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] --- .github/workflows/leetcode_directory_writer.yml | 2 -- DIRECTORY.md | 1 + 2 files changed, 1 insertion(+), 2 deletions(-) diff --git a/.github/workflows/leetcode_directory_writer.yml b/.github/workflows/leetcode_directory_writer.yml index d2657333e6..e85c879b9b 100644 --- a/.github/workflows/leetcode_directory_writer.yml +++ b/.github/workflows/leetcode_directory_writer.yml @@ -21,7 +21,6 @@ jobs: - name: Write LeetCode DIRECTORY.md run: | python3 scripts/leetcode_directory_md.py 2>&1 | tee leetcode/DIRECTORY.md - git pull || true - name: Commit and push changes uses: stefanzweifel/git-auto-commit-action@v4 id: commit-push @@ -34,6 +33,5 @@ jobs: if: steps.commit-push.outputs.changes_detected == 'true' run: | gh pr create --base ${GITHUB_REF##*/} --head leetcode-directory-${{ github.sha }} --title 'docs: updating `leetcode/DIRECTORY.md`' --body 'Updated LeetCode directory (see the diff. for changes).' - gh pr merge --admin --merge --subject 'docs: updating `leetcode/DIRECTORY.md' --delete-branch env: GH_TOKEN: ${{ github.token }} diff --git a/DIRECTORY.md b/DIRECTORY.md index d970ad9c2c..8eb1c38ae0 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -148,6 +148,7 @@ * [Word Count](https://github.com/TheAlgorithms/C/blob/HEAD/exercism/word_count/word_count.h) ## Games + * [Hangman](https://github.com/TheAlgorithms/C/blob/HEAD/games/hangman.c) * [Naval Battle](https://github.com/TheAlgorithms/C/blob/HEAD/games/naval_battle.c) * [Tic Tac Toe](https://github.com/TheAlgorithms/C/blob/HEAD/games/tic_tac_toe.c) From a555d2dd07140c2cdf3b1811aaef087a6c999b92 Mon Sep 17 00:00:00 2001 From: David Leal Date: Tue, 16 May 2023 12:39:34 -0600 Subject: [PATCH 136/156] chore: update the CodeQL workflow (#1246) Co-authored-by: Taj --- .github/workflows/codeql.yml | 93 +++++++++++++++++++----------------- 1 file changed, 49 insertions(+), 44 deletions(-) diff --git a/.github/workflows/codeql.yml b/.github/workflows/codeql.yml index e856dd5f9c..16da8867bf 100644 --- a/.github/workflows/codeql.yml +++ b/.github/workflows/codeql.yml @@ -1,56 +1,61 @@ -name: "CodeQL" +name: "Code Scanning - Action" on: push: - branches: [ "master" ] + branches: [master] pull_request: - branches: [ "master" ] + branches: [master] + schedule: + # ┌───────────── minute (0 - 59) + # │ ┌───────────── hour (0 - 23) + # │ │ ┌───────────── day of the month (1 - 31) + # │ │ │ ┌───────────── month (1 - 12 or JAN-DEC) + # │ │ │ │ ┌───────────── day of the week (0 - 6 or SUN-SAT) + # │ │ │ │ │ + # │ │ │ │ │ + # │ │ │ │ │ + # * * * * * + - cron: '30 1 * * 0' jobs: - analyze: - name: Analyze + CodeQL-Build: + # CodeQL runs on ubuntu-latest, windows-latest, and macos-latest runs-on: ubuntu-latest + permissions: + # required for all workflows + security-events: write + + # only required for workflows in private repositories actions: read contents: read - security-events: write - strategy: - fail-fast: false - matrix: - language: [ 'cpp' ] steps: - - name: Checkout repository - uses: actions/checkout@v3 - - name: Initialize CodeQL - uses: github/codeql-action/init@v2 - with: - languages: ${{ matrix.language }} - # If you wish to specify custom queries, you can do so here or in a config file. - # By default, queries listed here will override any specified in a config file. - # Prefix the list here with "+" to use these queries and those in the config file. - - # Details on CodeQL's query packs refer to : https://docs.github.com/en/code-security/code-scanning/automatically-scanning-your-code-for-vulnerabilities-and-errors/configuring-code-scanning#using-queries-in-ql-packs - # queries: security-extended,security-and-quality - - # Autobuild attempts to build any compiled languages (C/C++, C#, Go, or Java). - # If this step fails, then you should remove it and run the build manually (see below) - - name: Autobuild - uses: github/codeql-action/autobuild@v2 - - # ℹ️ Command-line programs to run using the OS shell. - # 📚 See https://docs.github.com/en/actions/using-workflows/workflow-syntax-for-github-actions#jobsjob_idstepsrun - - # If the Autobuild fails above, remove it and uncomment the following three lines. - # modify them (or add more) to build your code if your project, please refer to the EXAMPLE below for guidance. - - # - run: | - # echo "Run, Build Application using script" - # ./location_of_script_within_repo/buildscript.sh - # - # In our case, this would be a CMake build step. - - - name: Perform CodeQL Analysis - uses: github/codeql-action/analyze@v2 - with: - category: "/language:${{matrix.language}}" + - name: Checkout repository + uses: actions/checkout@v3 + + # Initializes the CodeQL tools for scanning. + - name: Initialize CodeQL + uses: github/codeql-action/init@v2 + # Override language selection by uncommenting this and choosing your languages + with: + languages: cpp + + # Autobuild attempts to build any compiled languages (C/C++, C#, Go, or Java). + # If this step fails, then you should remove it and run the build manually (see below). + - name: Autobuild + uses: github/codeql-action/autobuild@v2 + + # ℹ️ Command-line programs to run using the OS shell. + # 📚 See https://docs.github.com/en/actions/using-workflows/workflow-syntax-for-github-actions#jobsjob_idstepsrun + + # ✏️ If the Autobuild fails above, remove it and uncomment the following + # three lines and modify them (or add more) to build your code if your + # project uses a compiled language + + #- run: | + # make bootstrap + # make release + + - name: Perform CodeQL Analysis + uses: github/codeql-action/analyze@v2 From 6915d59738887b7674aa2a739701fbc7b0ff1919 Mon Sep 17 00:00:00 2001 From: Indrranil Pawar <112892653+Indrranil@users.noreply.github.com> Date: Mon, 29 May 2023 20:39:21 +0530 Subject: [PATCH 137/156] feat: improve `conversions/binary_to_decimal.c` (#1262) * Update binary_to_decimal.c 1. Removed the unused variable remainder. 2. Changed the variable name number to binary_number for clarity. 3. Removed the initialisation of number and temp since they are assigned values later. 4. Removed the newline character from the printf statement to improve readability. 5.Added a return statement at the end of main function. * Update binary_to_decimal.c --- conversions/binary_to_decimal.c | 39 ++++++++++++++++++++++----------- 1 file changed, 26 insertions(+), 13 deletions(-) diff --git a/conversions/binary_to_decimal.c b/conversions/binary_to_decimal.c index 352d07c160..3fa5773d8d 100644 --- a/conversions/binary_to_decimal.c +++ b/conversions/binary_to_decimal.c @@ -1,24 +1,37 @@ /** - * Modified 07/12/2017, Kyler Smith - * - */ +* Modified 24/05/2023, Indrranil Pawar +* +* C program that converts a binary number to its decimal equivalent. +*/ #include int main() { - int remainder, number = 0, decimal_number = 0, temp = 1; - printf("\n Enter any binary number= "); - scanf("%d", &number); + int binary_number, decimal_number = 0, temp = 1; - // Iterate over the number until the end. - while (number > 0) + // Input the binary number + printf("Enter any binary number: "); + scanf("%d", &binary_number); + + // Convert binary to decimal + while (binary_number > 0) { - remainder = number % 10; - number = number / 10; - decimal_number += remainder * temp; - temp = temp * 2; // used as power of 2 + // Extract the rightmost digit of the binary number + int digit = binary_number % 10; + + // Multiply the rightmost digit with the corresponding power of 2 and add to the decimal number + decimal_number += digit * temp; + + // Remove the rightmost digit from the binary number + binary_number /= 10; + + // Increase the power of 2 for the next digit + temp *= 2; } - printf("%d\n", decimal_number); + // Output the decimal equivalent + printf("Decimal equivalent: %d\n", decimal_number); + + return 0; } From d222df7dc17167540f2e674b517ef955c5a4e329 Mon Sep 17 00:00:00 2001 From: David Leal Date: Tue, 30 May 2023 10:30:13 -0600 Subject: [PATCH 138/156] [feat/docs]: improve the binary to decimal algorithm (#1263) --- conversions/binary_to_decimal.c | 83 ++++++++++++++++++++++----------- 1 file changed, 57 insertions(+), 26 deletions(-) diff --git a/conversions/binary_to_decimal.c b/conversions/binary_to_decimal.c index 3fa5773d8d..41721e5d9c 100644 --- a/conversions/binary_to_decimal.c +++ b/conversions/binary_to_decimal.c @@ -1,37 +1,68 @@ /** -* Modified 24/05/2023, Indrranil Pawar -* -* C program that converts a binary number to its decimal equivalent. + * @brief Converts a number from [Binary to Decimal](https://en.wikipedia.org/wiki/Binary-coded_decimal). + * @details + * + * Binary to decimal conversion is a process to convert a number + * having a binary representation to its equivalent decimal representation. + * + * The base of both number systems is different. + * Binary number system is base 2 number system while decimal number system is base 10 number system. + * The numbers used in binary number system are 0 and 1 while decimal number system has numbers from 0 to 9. + * The conversion of binary number to decimal number is done by multiplying + * each digit of the binary number, starting from the rightmost digit, with the power of 2 and adding the result. + * + * @author [Anup Kumar Pawar](https://github.com/AnupKumarPanwar) + * @author [David Leal](https://github.com/Panquesito7) */ -#include +#include /// for IO operations +#include /// for assert +#include /// for pow +#include /// for uint64_t -int main() -{ - int binary_number, decimal_number = 0, temp = 1; - - // Input the binary number - printf("Enter any binary number: "); - scanf("%d", &binary_number); - - // Convert binary to decimal - while (binary_number > 0) - { - // Extract the rightmost digit of the binary number - int digit = binary_number % 10; +/** + * @brief Converts the given binary number + * to its equivalent decimal number/value. + * @param number The binary number to be converted + * @returns The decimal equivalent of the binary number +*/ +int convert_to_decimal(uint64_t number) { + int decimal_number = 0, i = 0; - // Multiply the rightmost digit with the corresponding power of 2 and add to the decimal number - decimal_number += digit * temp; + while (number > 0) { + decimal_number += (number % 10) * pow(2, i); + number = number / 10; + i++; + } - // Remove the rightmost digit from the binary number - binary_number /= 10; + return decimal_number; +} - // Increase the power of 2 for the next digit - temp *= 2; - } +/** + * @brief Self-test implementations + * @returns void +*/ +static void tests() { + assert(convert_to_decimal(111) == 7); + assert(convert_to_decimal(101) == 5); + assert(convert_to_decimal(1010) == 10); + assert(convert_to_decimal(1101) == 13); + assert(convert_to_decimal(100001) == 33); + assert(convert_to_decimal(10101001) == 169); + assert(convert_to_decimal(111010) == 58); + assert(convert_to_decimal(100000000) == 256); + assert(convert_to_decimal(10000000000) == 1024); + assert(convert_to_decimal(101110111) == 375); - // Output the decimal equivalent - printf("Decimal equivalent: %d\n", decimal_number); + printf("All tests have successfully passed!\n"); +} +/** + * @brief Main function + * @returns 0 on exit +*/ +int main() +{ + tests(); // run self-test implementations return 0; } From 05ff277ebfd5fb8d21481349456454cac0600a6b Mon Sep 17 00:00:00 2001 From: Samuel Pires <98485367+disnoca@users.noreply.github.com> Date: Fri, 2 Jun 2023 17:43:21 +0100 Subject: [PATCH 139/156] feat: add Secant Method (#1255) * feat: add secant method * Apply suggestions from code review Co-authored-by: Sharon "Cass" Cassidy * fixed indentation * added more tests * better clarification for the tolerance parameter * removed redundant comments * chore: apply suggestions from code review --------- Co-authored-by: Sharon "Cass" Cassidy Co-authored-by: scpires Co-authored-by: David Leal --- numerical_methods/secant_method.c | 80 +++++++++++++++++++++++++++++++ 1 file changed, 80 insertions(+) create mode 100644 numerical_methods/secant_method.c diff --git a/numerical_methods/secant_method.c b/numerical_methods/secant_method.c new file mode 100644 index 0000000000..946285388c --- /dev/null +++ b/numerical_methods/secant_method.c @@ -0,0 +1,80 @@ +/** + * @file + * @brief [Secant Method](https://en.wikipedia.org/wiki/Secant_method) implementation. Find a + * continuous function's root by using a succession of roots of secant lines to + * approximate it, starting from the given points' secant line. + * @author [Samuel Pires](https://github.com/disnoca) + */ + +#include /// for assert +#include /// for fabs +#include /// for io operations + +#define TOLERANCE 0.0001 // root approximation result tolerance +#define NMAX 100 // maximum number of iterations + +/** + * @brief Continuous function for which we want to find the root + * @param x Real input variable + * @returns The evaluation result of the function using the input value + */ +double func(double x) +{ + return x * x - 3.; // x^2 = 3 - solution is sqrt(3) +} + +/** + * @brief Root-finding method for a continuous function given two points + * @param x0 One of the starting secant points + * @param x1 One of the starting secant points + * @param tolerance Determines how accurate the returned value is. The returned + * value will be within `tolerance` of the actual root + * @returns `root of the function` if secant method succeed within the + * maximum number of iterations + * @returns `-1` if secant method fails + */ +double secant_method(double x0, double x1, double tolerance) +{ + int n = 1; // step counter + + while (n++ < NMAX) + { + // calculate secant line root + double x2 = x1 - func(x1) * (x1 - x0) / (func(x1) - func(x0)); + + // update values + x0 = x1; + x1 = x2; + + // return value if it meets tolerance + if (fabs(x1 - x0) < tolerance) + return x2; + } + + return -1; // method failed (maximum number of steps exceeded) +} + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() +{ + // compares root values found by the secant method within the tolerance + assert(secant_method(0.2, 0.5, TOLERANCE) - sqrt(3) < TOLERANCE); + assert(fabs(secant_method(-2, -5, TOLERANCE)) - sqrt(3) < TOLERANCE); + assert(secant_method(-3, 2, TOLERANCE) - sqrt(3) < TOLERANCE); + assert(fabs(secant_method(1, -1.5, TOLERANCE)) - sqrt(3) < TOLERANCE); + + printf("All tests have successfully passed!\n"); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() +{ + test(); // run self-test implementations + return 0; +} From 01bc982b9a0439c492c53c40b0daa45b031dbc92 Mon Sep 17 00:00:00 2001 From: David Leal Date: Wed, 7 Jun 2023 21:55:20 -0600 Subject: [PATCH 140/156] feat: label when the build fails (#1254) * feat: label when the build fails * updating DIRECTORY.md --------- Co-authored-by: Taj Co-authored-by: github-actions[bot] --- .github/workflows/awesome_workflow.yml | 18 ++++++++++++++++-- DIRECTORY.md | 1 + 2 files changed, 17 insertions(+), 2 deletions(-) diff --git a/.github/workflows/awesome_workflow.yml b/.github/workflows/awesome_workflow.yml index 50a15fc5cd..968aff2d97 100644 --- a/.github/workflows/awesome_workflow.yml +++ b/.github/workflows/awesome_workflow.yml @@ -92,6 +92,8 @@ jobs: build: name: Compile checks runs-on: ${{ matrix.os }} + permissions: + pull-requests: write needs: [MainSequence] strategy: matrix: @@ -100,5 +102,17 @@ jobs: - uses: actions/checkout@v3 with: submodules: true - - run: cmake -B ./build -S . - - run: cmake --build build + - run: | + cmake -B ./build -S . + cmake --build build + - name: Label on PR fail + uses: actions/github-script@v6 + if: ${{ failure() && matrix.os == 'ubuntu-latest' && github.event_name == 'pull_request' }} + with: + script: | + github.rest.issues.addLabels({ + issue_number: context.issue.number, + owner: context.repo.owner, + repo: context.repo.repo, + labels: ['Autochecks are failing'] + }) diff --git a/DIRECTORY.md b/DIRECTORY.md index 8eb1c38ae0..fc4a3c470e 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -238,6 +238,7 @@ * [Qr Decomposition](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/qr_decomposition.c) * [Qr Eigen Values](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/qr_eigen_values.c) * [Realtime Stats](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/realtime_stats.c) + * [Secant Method](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/secant_method.c) * [Simpsons 1 3Rd Rule](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/simpsons_1_3rd_rule.c) * [Variance](https://github.com/TheAlgorithms/C/blob/HEAD/numerical_methods/variance.c) From e278f5d74fe0ad4037f3e65272f5ab1c3026a7b2 Mon Sep 17 00:00:00 2001 From: Sahil Kandhare Date: Thu, 8 Jun 2023 20:26:26 +0530 Subject: [PATCH 141/156] feat: add Dynamic Stack implementation (#1261) * Create dynamic_stack.c In this implementation, functions such as PUSH, POP, PEEK, show_capacity, isempty, and stack_size are coded to implement dynamic stack. * Update dynamic_stack.c Worked on Suggested Changes. * Update dynamic_stack.c Worked on suggested changes. * Update dynamic_stack.c * Update: Used Int type that are OS-independent --------- Co-authored-by: David Leal --- data_structures/stack/dynamic_stack.c | 250 ++++++++++++++++++++++++++ 1 file changed, 250 insertions(+) create mode 100644 data_structures/stack/dynamic_stack.c diff --git a/data_structures/stack/dynamic_stack.c b/data_structures/stack/dynamic_stack.c new file mode 100644 index 0000000000..482896eabd --- /dev/null +++ b/data_structures/stack/dynamic_stack.c @@ -0,0 +1,250 @@ +/** + * @file + * + * @brief + * Dynamic [Stack](https://en.wikipedia.org/wiki/Stack_(abstract_data_type)), + * just like Dynamic Array, is a stack data structure whose the length or + * capacity (maximum number of elements that can be stored) increases or + * decreases in real time based on the operations (like insertion or deletion) + * performed on it. + * + * In this implementation, functions such as PUSH, POP, PEEK, show_capacity, + * isempty, and stack_size are coded to implement dynamic stack. + * + * @author [SahilK-027](https://github.com/SahilK-027) + * + */ +#include /// to verify assumptions made by the program and print a diagnostic message if this assumption is false. +#include /// to provide a set of integer types with universally consistent definitions that are operating system-independent +#include /// for IO operations +#include /// for including functions involving memory allocation such as `malloc` +/** + * @brief DArrayStack Structure of stack. + */ +typedef struct DArrayStack +{ + int capacity, top; ///< to store capacity and top of the stack + int *arrPtr; ///< array pointer +} DArrayStack; + +/** + * @brief Create a Stack object + * + * @param cap Capacity of stack + * @return DArrayStack* Newly created stack object pointer + */ +DArrayStack *create_stack(int cap) +{ + DArrayStack *ptr; + ptr = (DArrayStack *)malloc(sizeof(DArrayStack)); + ptr->capacity = cap; + ptr->top = -1; + ptr->arrPtr = (int *)malloc(sizeof(int) * cap); + printf("\nStack of capacity %d is successfully created.\n", ptr->capacity); + return (ptr); +} + +/** + * @brief As this is stack implementation using dynamic array this function will + * expand the size of the stack by twice as soon as the stack is full. + * + * @param ptr Stack pointer + * @param cap Capacity of stack + * @return DArrayStack*: Modified stack + */ +DArrayStack *double_array(DArrayStack *ptr, int cap) +{ + int newCap = 2 * cap; + int *temp; + temp = (int *)malloc(sizeof(int) * newCap); + for (int i = 0; i < (ptr->top) + 1; i++) + { + temp[i] = ptr->arrPtr[i]; + } + free(ptr->arrPtr); + ptr->arrPtr = temp; + ptr->capacity = newCap; + return ptr; +} + +/** + * @brief As this is stack implementation using dynamic array this function will + * shrink the size of stack by twice as soon as the stack's capacity and size + * has significant difference. + * + * @param ptr Stack pointer + * @param cap Capacity of stack + * @return DArrayStack*: Modified stack + */ +DArrayStack *shrink_array(DArrayStack *ptr, int cap) +{ + int newCap = cap / 2; + int *temp; + temp = (int *)malloc(sizeof(int) * newCap); + for (int i = 0; i < (ptr->top) + 1; i++) + { + temp[i] = ptr->arrPtr[i]; + } + free(ptr->arrPtr); + ptr->arrPtr = temp; + ptr->capacity = newCap; + return ptr; +} + +/** + * @brief The push function pushes the element onto the stack. + * + * @param ptr Stack pointer + * @param data Value to be pushed onto stack + * @return int Position of top pointer + */ +int push(DArrayStack *ptr, int data) +{ + if (ptr->top == (ptr->capacity) - 1) + { + ptr = double_array(ptr, ptr->capacity); + ptr->top++; + ptr->arrPtr[ptr->top] = data; + } + else + { + ptr->top++; + ptr->arrPtr[ptr->top] = data; + } + printf("Successfully pushed : %d\n", data); + return ptr->top; +} + +/** + * @brief The pop function to pop an element from the stack. + * + * @param ptr Stack pointer + * @return int Popped value + */ +int pop(DArrayStack *ptr) +{ + if (ptr->top == -1) + { + printf("Stack is empty UNDERFLOW \n"); + return -1; + } + int ele = ptr->arrPtr[ptr->top]; + ptr->arrPtr[ptr->top] = 0; + ptr->top = (ptr->top - 1); + if ((ptr->capacity) % 2 == 0) + { + if (ptr->top <= (ptr->capacity / 2) - 1) + { + ptr = shrink_array(ptr, ptr->capacity); + } + } + printf("Successfully popped: %d\n", ele); + return ele; +} + +/** + * @brief To retrieve or fetch the first element of the Stack or the element + * present at the top of the Stack. + * + * @param ptr Stack pointer + * @return int Top of the stack + */ +int peek(DArrayStack *ptr) +{ + if (ptr->top == -1) + { + printf("Stack is empty UNDERFLOW \n"); + return -1; + } + return ptr->arrPtr[ptr->top]; +} + +/** + * @brief To display the current capacity of the stack. + * + * @param ptr Stack pointer + * @return int Current capacity of the stack + */ +int show_capacity(DArrayStack *ptr) { return ptr->capacity; } + +/** + * @brief The function is used to check whether the stack is empty or not and + * return true or false accordingly. + * + * @param ptr Stack pointer + * @return int returns 1 -> true OR returns 0 -> false + */ +int isempty(DArrayStack *ptr) +{ + if (ptr->top == -1) + { + return 1; + } + return 0; +} + +/** + * @brief Used to get the size of the Stack or the number of elements present in + * the Stack. + * + * @param ptr Stack pointer + * @return int size of stack + */ +int stack_size(DArrayStack *ptr) { return ptr->top + 1; } + +/** + * @brief Self-test implementations + * @returns void + */ +static void test() +{ + DArrayStack *NewStack; + int capacity = 1; + NewStack = create_stack(capacity); + uint64_t arr[] = {1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12}; + + printf("\nTesting Empty stack: "); + assert(stack_size(NewStack) == 0); + assert(isempty(NewStack) == 1); + printf("Size of an empty stack is %d\n", stack_size(NewStack)); + + printf("\nTesting PUSH operation:\n"); + for (int i = 0; i < 12; ++i) + { + int topVal = push(NewStack, arr[i]); + printf("Size: %d, Capacity: %d\n\n", stack_size(NewStack), + show_capacity(NewStack)); + assert(topVal == i); + assert(peek(NewStack) == arr[i]); + assert(stack_size(NewStack) == i + 1); + assert(isempty(NewStack) == 0); + } + + printf("\nTesting POP operation:\n"); + for (int i = 11; i > -1; --i) + { + peek(NewStack); + assert(peek(NewStack) == arr[i]); + int ele = pop(NewStack); + assert(ele == arr[i]); + assert(stack_size(NewStack) == i); + } + + printf("\nTesting Empty stack size: "); + assert(stack_size(NewStack) == 0); + assert(isempty(NewStack) == 1); + printf("Size of an empty stack is %d\n", stack_size(NewStack)); + + printf("\nTesting POP operation on empty stack: "); + assert(pop(NewStack) == -1); +} + +/** + * @brief Main function + * @returns 0 on exit + */ +int main() +{ + test(); // run self-test implementations + return 0; +} From b1a8da69a87cd45e9db0cc340730e4a5e3b36201 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 9 Jun 2023 10:51:37 -0600 Subject: [PATCH 142/156] fix: missing `;` in `matrix_chain_order.c` --- dynamic_programming/matrix_chain_order.c | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/dynamic_programming/matrix_chain_order.c b/dynamic_programming/matrix_chain_order.c index 76c29bf1a4..d0ee8cacee 100644 --- a/dynamic_programming/matrix_chain_order.c +++ b/dynamic_programming/matrix_chain_order.c @@ -55,7 +55,7 @@ int matrixChainOrder(int l,const int *p, int *s) { void printSolution(int l,int *s,int i,int j) { if(i == j) { printf("A%d",i); - return + return; } putchar('('); printSolution(l,s,i,s[i * l + j]); From 2e8374e5c14d7106442833a20428dc2843982436 Mon Sep 17 00:00:00 2001 From: David Leal Date: Tue, 13 Jun 2023 10:13:34 -0600 Subject: [PATCH 143/156] chore: improve the LeetCode directory writer (#1276) * chore: free-dependency LeetCode directory writer * updating DIRECTORY.md --------- Co-authored-by: github-actions[bot] --- .../workflows/leetcode_directory_writer.yml | 23 +++++++++++-------- DIRECTORY.md | 1 + 2 files changed, 15 insertions(+), 9 deletions(-) diff --git a/.github/workflows/leetcode_directory_writer.yml b/.github/workflows/leetcode_directory_writer.yml index e85c879b9b..e6d666ce0d 100644 --- a/.github/workflows/leetcode_directory_writer.yml +++ b/.github/workflows/leetcode_directory_writer.yml @@ -7,6 +7,7 @@ on: - "leetcode/src/**.c" jobs: build: + if: github.repository == 'TheAlgorithms/C' # We only need this to run in our repository. runs-on: ubuntu-latest steps: - uses: actions/checkout@v3 @@ -21,17 +22,21 @@ jobs: - name: Write LeetCode DIRECTORY.md run: | python3 scripts/leetcode_directory_md.py 2>&1 | tee leetcode/DIRECTORY.md - - name: Commit and push changes - uses: stefanzweifel/git-auto-commit-action@v4 - id: commit-push - with: - commit_message: "docs: updating `leetcode/DIRECTORY.md`" - branch: "leetcode-directory-${{ github.sha }}" - create_branch: true - - name: Creating and merging the PR + - name: Setup Git configurations + shell: bash + run: | + git config --global user.name github-actions[bot] + git config --global user.email 'github-actions@users.noreply.github.com' + - name: Committing changes + shell: bash + run: | + git checkout -b leetcode-directory-${{ github.sha }} + git commit -m "docs: updating `leetcode/DIRECTORY.md` + git push origin leetcode-directory-${{ github.sha }}:leetcode-directory-${{ github.sha }} + - name: Creating the pull request shell: bash - if: steps.commit-push.outputs.changes_detected == 'true' run: | + if [[ `git status --porcelain` ]]; then gh pr create --base ${GITHUB_REF##*/} --head leetcode-directory-${{ github.sha }} --title 'docs: updating `leetcode/DIRECTORY.md`' --body 'Updated LeetCode directory (see the diff. for changes).' env: GH_TOKEN: ${{ github.token }} diff --git a/DIRECTORY.md b/DIRECTORY.md index fc4a3c470e..1493a4804d 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -107,6 +107,7 @@ * [Queue](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/queue/queue.c) * [Stack](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack.c) * Stack + * [Dynamic Stack](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/dynamic_stack.c) * [Main](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/main.c) * [Parenthesis](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/parenthesis.c) * [Stack](https://github.com/TheAlgorithms/C/blob/HEAD/data_structures/stack/stack.c) From b6b01a360549b5bd131d171639204aee7b524fd8 Mon Sep 17 00:00:00 2001 From: David Leal Date: Tue, 13 Jun 2023 10:45:46 -0600 Subject: [PATCH 144/156] feat: add `dynamic_programming` to CMake lists (#1266) * feat: add `dynamic_programming` to CMake lists * updating DIRECTORY.md * chore: fix minor doc. issues and indentation --------- Co-authored-by: github-actions[bot] --- CMakeLists.txt | 1 + dynamic_programming/CMakeLists.txt | 18 +++++++++ dynamic_programming/lcs.c | 64 ++++++++++++++++++------------ 3 files changed, 57 insertions(+), 26 deletions(-) create mode 100644 dynamic_programming/CMakeLists.txt diff --git a/CMakeLists.txt b/CMakeLists.txt index eb925dc92a..29fb9d209b 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -65,6 +65,7 @@ add_subdirectory(process_scheduling_algorithms) add_subdirectory(numerical_methods) add_subdirectory(math) add_subdirectory(cipher) +add_subdirectory(dynamic_programming) ## Configure Doxygen documentation system cmake_policy(SET CMP0054 NEW) diff --git a/dynamic_programming/CMakeLists.txt b/dynamic_programming/CMakeLists.txt new file mode 100644 index 0000000000..a65bbb7da6 --- /dev/null +++ b/dynamic_programming/CMakeLists.txt @@ -0,0 +1,18 @@ +# If necessary, use the RELATIVE flag, otherwise each source file may be listed +# with full pathname. The RELATIVE flag makes it easier to extract an executable's name +# automatically. + +file( GLOB APP_SOURCES RELATIVE ${CMAKE_CURRENT_SOURCE_DIR} *.c ) +foreach( testsourcefile ${APP_SOURCES} ) + string( REPLACE ".c" "" testname ${testsourcefile} ) # File type. Example: `.c` + add_executable( ${testname} ${testsourcefile} ) + + if(OpenMP_C_FOUND) + target_link_libraries(${testname} OpenMP::OpenMP_C) + endif() + if(MATH_LIBRARY) + target_link_libraries(${testname} ${MATH_LIBRARY}) + endif() + install(TARGETS ${testname} DESTINATION "bin/dynamic_programming") # Folder name. Do NOT include `<>` + +endforeach( testsourcefile ${APP_SOURCES} ) diff --git a/dynamic_programming/lcs.c b/dynamic_programming/lcs.c index 5637a72dcd..bf360b7321 100644 --- a/dynamic_programming/lcs.c +++ b/dynamic_programming/lcs.c @@ -1,12 +1,15 @@ /** * @file - * @brief [Longest Common Subsequence](https://en.wikipedia.org/wiki/Longest_common_subsequence_problem) algorithm + * @brief [Longest Common + * Subsequence](https://en.wikipedia.org/wiki/Longest_common_subsequence_problem) + * algorithm * @details * From Wikipedia: The longest common subsequence (LCS) problem is the problem - * of finding the longest subsequence common to all sequences in a set of sequences - * (often just two sequences). + * of finding the longest subsequence common to all sequences in a set of + * sequences (often just two sequences). * @author [Kurtz](https://github.com/itskurtz) */ + #include /* for io operations */ #include /* for memory management & exit */ #include /* for string manipulation & ooperations */ @@ -15,13 +18,13 @@ enum {LEFT, UP, DIAG}; /** - * @breif Computes LCS between s1 and s2 using a dynamic-programming approach - * @param1 s1 first null-terminated string - * @param2 s2 second null-terminated string - * @param3 l1 length of s1 - * @param4 l2 length of s2 - * @param5 L matrix of size l1 x l2 - * @param6 B matrix of size l1 x l2 + * @brief Computes LCS between s1 and s2 using a dynamic-programming approach + * @param s1 first null-terminated string + * @param s2 second null-terminated string + * @param l1 length of s1 + * @param l2 length of s2 + * @param L matrix of size l1 x l2 + * @param B matrix of size l1 x l2 * @returns void */ void lcslen(const char *s1, const char *s2, int l1, int l2, int **L, int **B) { @@ -31,8 +34,8 @@ void lcslen(const char *s1, const char *s2, int l1, int l2, int **L, int **B) { /* loop over the simbols in my sequences save the directions according to the LCS */ - for (i = 1; i <= l1; ++i) - for (j = 1; j <= l2; ++j) + for (i = 1; i <= l1; ++i) { + for (j = 1; j <= l2; ++j) { if (s1[i-1] == s2[j-1]) { L[i][j] = 1 + L[i-1][j-1]; B[i][j] = DIAG; @@ -44,16 +47,18 @@ void lcslen(const char *s1, const char *s2, int l1, int l2, int **L, int **B) { else { L[i][j] = L[i-1][j]; B[i][j] = UP; - } + } + } + } } /** - * @breif Builds the LCS according to B using a traceback approach - * @param1 s1 first null-terminated string - * @param2 l1 length of s1 - * @param3 l2 length of s2 - * @param4 L matrix of size l1 x l2 - * @param5 B matrix of size l1 x l2 + * @brief Builds the LCS according to B using a traceback approach + * @param s1 first null-terminated string + * @param l1 length of s1 + * @param l2 length of s2 + * @param L matrix of size l1 x l2 + * @param B matrix of size l1 x l2 * @returns lcs longest common subsequence */ char *lcsbuild(const char *s1, int l1, int l2, int **L, int **B) { @@ -76,13 +81,18 @@ char *lcsbuild(const char *s1, int l1, int l2, int **L, int **B) { i = i - 1; j = j - 1; } - else if (B[i][j] == LEFT) - j = j - 1; - else - i = i - 1; + else if (B[i][j] == LEFT) + { + j = j - 1; + } + else + { + i = i - 1; + } } return lcs; } + /** * @brief Self-test implementations * @returns void @@ -132,9 +142,11 @@ static void test() { printf("LCS len:%3d\n", L[l1][l2]); printf("LCS: %s\n", lcs); - free(lcs); - for (j = 0; j <= l1; j++) - free(L[j]), free(B[j]); + free(lcs); + for (j = 0; j <= l1; j++) + { + free(L[j]), free(B[j]); + } free(L); free(B); From 8a3ff966e74f61b6ce75e174424a6939fb0451a7 Mon Sep 17 00:00:00 2001 From: David Leal Date: Wed, 14 Jun 2023 10:18:38 -0600 Subject: [PATCH 145/156] chore: run LeetCode directory writer on `main` only --- .github/workflows/leetcode_directory_writer.yml | 5 ++++- 1 file changed, 4 insertions(+), 1 deletion(-) diff --git a/.github/workflows/leetcode_directory_writer.yml b/.github/workflows/leetcode_directory_writer.yml index e6d666ce0d..8758df4f9c 100644 --- a/.github/workflows/leetcode_directory_writer.yml +++ b/.github/workflows/leetcode_directory_writer.yml @@ -5,6 +5,8 @@ on: push: paths: - "leetcode/src/**.c" + branches: + - main jobs: build: if: github.repository == 'TheAlgorithms/C' # We only need this to run in our repository. @@ -37,6 +39,7 @@ jobs: shell: bash run: | if [[ `git status --porcelain` ]]; then - gh pr create --base ${GITHUB_REF##*/} --head leetcode-directory-${{ github.sha }} --title 'docs: updating `leetcode/DIRECTORY.md`' --body 'Updated LeetCode directory (see the diff. for changes).' + gh pr create --base ${GITHUB_REF##*/} --head leetcode-directory-${{ github.sha }} --title 'docs: updating `leetcode/DIRECTORY.md`' --body 'Updated LeetCode directory (see the diff. for changes).' + fi env: GH_TOKEN: ${{ github.token }} From 8a1a4972a58ea279162626cc66dc6b796a0423e5 Mon Sep 17 00:00:00 2001 From: Ethan Fredsti Date: Tue, 20 Jun 2023 14:07:09 -0700 Subject: [PATCH 146/156] fix: change list length in `data_structures/list/list.c` (#1265) I changed the return value of n in List_length to reflect the number of items inside the list, so a newly initialized list will return a length of 0. To prevent items in List_toArray from being cut off, I addeone back to n at the beginning of the List_toArray function. --- data_structures/list/list.c | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/data_structures/list/list.c b/data_structures/list/list.c index 9731acf0a8..762ffdfaad 100644 --- a/data_structures/list/list.c +++ b/data_structures/list/list.c @@ -30,13 +30,13 @@ int List_length(L list) { int n; for (n = 0; list; list = list->next) n++; - return n; + return n - 1; } /* Convert list to array */ void **List_toArray(L list) { - int i, n = List_length(list); + int i, n = List_length(list) + 1; void **array = (void **)malloc((n + 1) * sizeof(*array)); for (i = 0; i < n; i++) From f4ee5743afc648cfbd65cc6add1b7d7f983bd8c4 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 23 Jun 2023 12:04:53 -0600 Subject: [PATCH 147/156] fix: use correct branch name --- .github/workflows/leetcode_directory_writer.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/workflows/leetcode_directory_writer.yml b/.github/workflows/leetcode_directory_writer.yml index 8758df4f9c..a1189165b7 100644 --- a/.github/workflows/leetcode_directory_writer.yml +++ b/.github/workflows/leetcode_directory_writer.yml @@ -6,7 +6,7 @@ on: paths: - "leetcode/src/**.c" branches: - - main + - master jobs: build: if: github.repository == 'TheAlgorithms/C' # We only need this to run in our repository. From db69d0a539d2248c61ce2849dd12f9487d998d64 Mon Sep 17 00:00:00 2001 From: hemanth8819 <119241921+hemanth8819@users.noreply.github.com> Date: Wed, 28 Jun 2023 01:19:43 +0530 Subject: [PATCH 148/156] feat: add LeetCode problem 69 (#1259) * feat: add LeetCode problem 69 Here is the code for the problem 69 of leetcode as there are many ways to do it we programmers need to find the most optimal way to solve a problem statement so i used binary-search approach inorder to solve it. All suggestions are accepted!!! * Update 69.c I have updated the solution according to the suggestions. * Update 69.c * Update 69.c --- leetcode/src/69.c | 23 +++++++++++++++++++++++ 1 file changed, 23 insertions(+) create mode 100644 leetcode/src/69.c diff --git a/leetcode/src/69.c b/leetcode/src/69.c new file mode 100644 index 0000000000..63c0d02519 --- /dev/null +++ b/leetcode/src/69.c @@ -0,0 +1,23 @@ +//using the binary search method is one of the efficient ones for this problem statement. +int mySqrt(int x){ +int start=0; + int end=x; + long long int ans=0; + while(start <= end){ + long long int mid=(start+end)/2; + long long int val=mid*mid; + if( val == x){ + return mid; + } +//if mid is less than the square root of the number(x) store the value of mid in ans. + if( val < x){ + ans = mid; + start = mid+1; + } +//if mid is greater than the square root of the number(x) then ssign the value mid-1 to end. + if( val > x){ + end = mid-1; + } + } + return ans; +} From f241de90e1691dc7cfcafcbecd89ef12db922e6b Mon Sep 17 00:00:00 2001 From: David Leal Date: Sun, 2 Jul 2023 19:41:54 -0600 Subject: [PATCH 149/156] chore: add codeowners (#1264) --- .github/CODEOWNERS | 1 + 1 file changed, 1 insertion(+) create mode 100644 .github/CODEOWNERS diff --git a/.github/CODEOWNERS b/.github/CODEOWNERS new file mode 100644 index 0000000000..dda50c14f8 --- /dev/null +++ b/.github/CODEOWNERS @@ -0,0 +1 @@ +* @Panquesito7 @tjgurwara99 @alexpantyukhin From 1a5b31d3d1a4b7d043266fb9a2252a3829315b57 Mon Sep 17 00:00:00 2001 From: David Leal Date: Tue, 18 Jul 2023 20:39:51 -0600 Subject: [PATCH 150/156] docs: update workflow versions in `README.md` (#1273) * updating DIRECTORY.md * docs: update workflow versions in `README.md` Windows was removed from the list as the code is no longer being tested on Windows. --------- Co-authored-by: github-actions[bot] --- README.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/README.md b/README.md index 85768c923e..9670d2bb07 100644 --- a/README.md +++ b/README.md @@ -21,7 +21,7 @@ The repository is a collection of open-source implementations of a variety of al * The repository provides implementations of various algorithms in one of the most fundamental general purpose languages - [C](https://en.wikipedia.org/wiki/C_(programming_language)). * Well documented source code with detailed explanations provide a valuable resource for educators and students alike. * Each source code is atomic using standard C library [`libc`](https://en.wikipedia.org/wiki/C_standard_library) and _no external libraries_ are required for their compilation and execution. Thus the fundamentals of the algorithms can be studied in much depth. -* Source codes are [compiled and tested](https://github.com/TheAlgorithms/C/actions?query=workflow%3A%22Awesome+CI+Workflow%22) for every commit on the latest versions of three major operating systems viz., Windows, MacOS and Ubuntu (Linux) using MSVC 16 2019, AppleClang 11.0 and GNU 7.5.0 respectively. +* Source codes are [compiled and tested](https://github.com/TheAlgorithms/C/actions?query=workflow%3A%22Awesome+CI+Workflow%22) for every commit on the latest versions of two major operating systems viz., MacOS and Ubuntu (Linux) using AppleClang 14.0.0 and GNU 11.3.0 respectively. * Strict adherence to [C11](https://en.wikipedia.org/wiki/C11_(C_standard_revision)) standard ensures portability of code to embedded systems as well like ESP32, ARM Cortex, etc. with little to no changes. * Self-checks within programs ensure correct implementations with confidence. * Modular implementations and OpenSource licensing enable the functions to be utilized conveniently in other applications. From 77522fdbc1d9960147032316cb00c47cfe3acb67 Mon Sep 17 00:00:00 2001 From: David Leal Date: Tue, 18 Jul 2023 20:41:49 -0600 Subject: [PATCH 151/156] fix: LeetCode directory writer (#1281) --- .github/workflows/leetcode_directory_writer.yml | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/.github/workflows/leetcode_directory_writer.yml b/.github/workflows/leetcode_directory_writer.yml index a1189165b7..9d4ab38b89 100644 --- a/.github/workflows/leetcode_directory_writer.yml +++ b/.github/workflows/leetcode_directory_writer.yml @@ -33,13 +33,13 @@ jobs: shell: bash run: | git checkout -b leetcode-directory-${{ github.sha }} - git commit -m "docs: updating `leetcode/DIRECTORY.md` + git commit -m "docs: updating `leetcode/DIRECTORY.md`" git push origin leetcode-directory-${{ github.sha }}:leetcode-directory-${{ github.sha }} - name: Creating the pull request shell: bash run: | - if [[ `git status --porcelain` ]]; then - gh pr create --base ${GITHUB_REF##*/} --head leetcode-directory-${{ github.sha }} --title 'docs: updating `leetcode/DIRECTORY.md`' --body 'Updated LeetCode directory (see the diff. for changes).' + if [[ $(git log --branches --not --remotes) ]]; then + gh pr create --base ${GITHUB_REF##*/} --head leetcode-directory-${{ github.sha }} --title 'docs: updating `leetcode/DIRECTORY.md`' --body 'Updated LeetCode directory (see the diff. for changes).' || true fi env: GH_TOKEN: ${{ github.token }} From 1bbbac6546a95ea304f220ae71b7efb960f44ca6 Mon Sep 17 00:00:00 2001 From: Ryan Bevin Date: Wed, 19 Jul 2023 03:53:50 +0100 Subject: [PATCH 152/156] chore: update CMake version #1271 (#1284) * update cmake version * chore: Update cmake version * chore: Using latest version of cmake --------- Co-authored-by: rbevin777 Co-authored-by: ryanbevin Co-authored-by: David Leal --- CMakeLists.txt | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/CMakeLists.txt b/CMakeLists.txt index 29fb9d209b..f85692ad6d 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -1,4 +1,4 @@ -cmake_minimum_required(VERSION 3.6) +cmake_minimum_required(VERSION 3.22) project(Algorithms_in_C LANGUAGES C VERSION 1.0.0 From 518a7cafd50821c63eed4167a7852c7b2f30058f Mon Sep 17 00:00:00 2001 From: David Leal Date: Tue, 18 Jul 2023 21:00:14 -0600 Subject: [PATCH 153/156] chore: add the linter to a separate Python script (#1272) * updating DIRECTORY.md * chore: add the linter to a separate Python script --------- Co-authored-by: github-actions[bot] --- .github/workflows/awesome_workflow.yml | 44 ++------------------------ .gitignore | 1 + scripts/file_linter.py | 40 +++++++++++++++++++++++ 3 files changed, 43 insertions(+), 42 deletions(-) create mode 100644 scripts/file_linter.py diff --git a/.github/workflows/awesome_workflow.yml b/.github/workflows/awesome_workflow.yml index 968aff2d97..dc3c8532f7 100644 --- a/.github/workflows/awesome_workflow.yml +++ b/.github/workflows/awesome_workflow.yml @@ -42,48 +42,8 @@ jobs: # be able to catch any errors for other platforms. run: cmake -B build -S . -DCMAKE_EXPORT_COMPILE_COMMANDS=ON - name: Lint modified files - shell: python - run: | - import os - import subprocess - import sys - - print("Python {}.{}.{}".format(*sys.version_info)) # Python 3.8 - with open("git_diff.txt") as in_file: - modified_files = sorted(in_file.read().splitlines()) - print("{} files were modified.".format(len(modified_files))) - - cpp_exts = tuple(".c .c++ .cc .cpp .cu .cuh .cxx .h .h++ .hh .hpp .hxx".split()) - cpp_files = [file for file in modified_files if file.lower().endswith(cpp_exts)] - print(f"{len(cpp_files)} C++ files were modified.") - if not cpp_files: - sys.exit(0) - subprocess.run(["clang-tidy", "-p=build", "--fix", *cpp_files, "--"], - check=True, text=True, stderr=subprocess.STDOUT) - subprocess.run(["clang-format", "-i", *cpp_files], - check=True, text=True, stderr=subprocess.STDOUT) - - upper_files = [file for file in cpp_files if file != file.lower()] - if upper_files: - print(f"{len(upper_files)} files contain uppercase characters:") - print("\n".join(upper_files) + "\n") - - space_files = [file for file in cpp_files if " " in file or "-" in file] - if space_files: - print(f"{len(space_files)} files contain space or dash characters:") - print("\n".join(space_files) + "\n") - - nodir_files = [file for file in cpp_files if file.count(os.sep) != 1 and "project_euler" not in file and "data_structure" not in file] - if len(nodir_files) > 1: - nodir_file_bad_files = len(nodir_files) - 1 - print(f"{len(nodir_files)} files are not in one and only one directory:") - print("\n".join(nodir_files) + "\n") - else: - nodir_file_bad_files = 0 - - bad_files = nodir_file_bad_files + len(upper_files + space_files) - if bad_files: - sys.exit(bad_files) + shell: bash + run: python3 scripts/file_linter.py - name: Commit and push changes run: | git diff DIRECTORY.md diff --git a/.gitignore b/.gitignore index 59f569ad15..8b6b444d53 100644 --- a/.gitignore +++ b/.gitignore @@ -3,3 +3,4 @@ *.out .vscode/ build/ +git_diff.txt diff --git a/scripts/file_linter.py b/scripts/file_linter.py new file mode 100644 index 0000000000..bce3ad86fb --- /dev/null +++ b/scripts/file_linter.py @@ -0,0 +1,40 @@ +import os +import subprocess +import sys + +print("Python {}.{}.{}".format(*sys.version_info)) # Python 3.8 +with open("git_diff.txt") as in_file: + modified_files = sorted(in_file.read().splitlines()) + print("{} files were modified.".format(len(modified_files))) + + cpp_exts = tuple(".c .c++ .cc .cpp .cu .cuh .cxx .h .h++ .hh .hpp .hxx".split()) + cpp_files = [file for file in modified_files if file.lower().endswith(cpp_exts)] + print(f"{len(cpp_files)} C++ files were modified.") + if not cpp_files: + sys.exit(0) + subprocess.run(["clang-tidy", "-p=build", "--fix", *cpp_files, "--"], + check=True, text=True, stderr=subprocess.STDOUT) + subprocess.run(["clang-format", "-i", *cpp_files], + check=True, text=True, stderr=subprocess.STDOUT) + + upper_files = [file for file in cpp_files if file != file.lower()] + if upper_files: + print(f"{len(upper_files)} files contain uppercase characters:") + print("\n".join(upper_files) + "\n") + + space_files = [file for file in cpp_files if " " in file or "-" in file] + if space_files: + print(f"{len(space_files)} files contain space or dash characters:") + print("\n".join(space_files) + "\n") + + nodir_files = [file for file in cpp_files if file.count(os.sep) != 1 and "project_euler" not in file and "data_structure" not in file] + if len(nodir_files) > 1: + nodir_file_bad_files = len(nodir_files) - 1 + print(f"{len(nodir_files)} files are not in one and only one directory:") + print("\n".join(nodir_files) + "\n") + else: + nodir_file_bad_files = 0 + bad_files = nodir_file_bad_files + len(upper_files + space_files) + + if bad_files: + sys.exit(bad_files) From 1302bf41df2cdb53d3292076950414df04fde533 Mon Sep 17 00:00:00 2001 From: Ryan Bevin Date: Wed, 19 Jul 2023 08:34:19 +0100 Subject: [PATCH 154/156] fix: add missing `include` in CMakeLists #942 (#1285) * fix: missing include file for cmake function * fix: using newer version of check include file --------- Co-authored-by: rbevin777 --- client_server/CMakeLists.txt | 6 ++++-- 1 file changed, 4 insertions(+), 2 deletions(-) diff --git a/client_server/CMakeLists.txt b/client_server/CMakeLists.txt index 66a6b04392..c02e61858e 100644 --- a/client_server/CMakeLists.txt +++ b/client_server/CMakeLists.txt @@ -1,7 +1,9 @@ +include(CheckIncludeFile) + if(WIN32) - check_include_file(winsock2.h WINSOCK_HEADER) + CHECK_INCLUDE_FILE(winsock2.h WINSOCK_HEADER) else() - check_include_file(arpa/inet.h ARPA_HEADERS) + CHECK_INCLUDE_FILE(arpa/inet.h ARPA_HEADERS) endif() if(ARPA_HEADERS OR WINSOCK_HEADER) From db3d6e2886ba043b9b30f6448ca0bcf92e58e039 Mon Sep 17 00:00:00 2001 From: David Leal Date: Fri, 8 Sep 2023 15:38:14 -0600 Subject: [PATCH 155/156] feat: add Windows CI back (#1290) Signed-off-by: realstealthninja Co-authored-by: github-actions[bot] Co-authored-by: realstealthninja <68815218+realstealthninja@users.noreply.github.com> --- .github/workflows/awesome_workflow.yml | 4 +- CMakeLists.txt | 13 +- DIRECTORY.md | 2 + client_server/CMakeLists.txt | 24 +- client_server/bool.h | 55 ++++ client_server/fork.h | 298 ++++++++++++++++++ .../remote_command_exec_udp_client.c | 19 +- .../remote_command_exec_udp_server.c | 19 +- client_server/tcp_full_duplex_client.c | 22 +- client_server/tcp_full_duplex_server.c | 31 +- client_server/tcp_half_duplex_client.c | 19 +- client_server/tcp_half_duplex_server.c | 19 +- developer_tools/min_printf.h | 6 +- dynamic_programming/matrix_chain_order.c | 88 ++++-- graphics/CMakeLists.txt | 2 +- searching/exponential_search.c | 7 +- 16 files changed, 547 insertions(+), 81 deletions(-) create mode 100644 client_server/bool.h create mode 100644 client_server/fork.h diff --git a/.github/workflows/awesome_workflow.yml b/.github/workflows/awesome_workflow.yml index dc3c8532f7..728238e88f 100644 --- a/.github/workflows/awesome_workflow.yml +++ b/.github/workflows/awesome_workflow.yml @@ -57,14 +57,14 @@ jobs: needs: [MainSequence] strategy: matrix: - os: [ubuntu-latest, macOS-latest] + os: [windows-latest, ubuntu-latest, macOS-latest] steps: - uses: actions/checkout@v3 with: submodules: true - run: | cmake -B ./build -S . - cmake --build build + cmake --build build --config Release - name: Label on PR fail uses: actions/github-script@v6 if: ${{ failure() && matrix.os == 'ubuntu-latest' && github.event_name == 'pull_request' }} diff --git a/CMakeLists.txt b/CMakeLists.txt index f85692ad6d..01a43e6617 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -1,18 +1,17 @@ cmake_minimum_required(VERSION 3.22) project(Algorithms_in_C - LANGUAGES C - VERSION 1.0.0 - DESCRIPTION "Set of algorithms implemented in C." -) + LANGUAGES C + VERSION 1.0.0 + DESCRIPTION "Set of algorithms implemented in C." + ) # Set compilation standards set(CMAKE_C_STANDARD 11) set(CMAKE_C_STANDARD_REQUIRED YES) - -if(MSVC) +if (MSVC) add_compile_definitions(_CRT_SECURE_NO_WARNINGS) # add_compile_options(/Za) -endif(MSVC) +endif (MSVC) # check for math library # addresses a bug when linking on OSX diff --git a/DIRECTORY.md b/DIRECTORY.md index 1493a4804d..1339bc6ffc 100644 --- a/DIRECTORY.md +++ b/DIRECTORY.md @@ -7,7 +7,9 @@ * [Rot13](https://github.com/TheAlgorithms/C/blob/HEAD/cipher/rot13.c) ## Client Server + * [Bool](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/bool.h) * [Client](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/client.c) + * [Fork](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/fork.h) * [Remote Command Exec Udp Client](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/remote_command_exec_udp_client.c) * [Remote Command Exec Udp Server](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/remote_command_exec_udp_server.c) * [Server](https://github.com/TheAlgorithms/C/blob/HEAD/client_server/server.c) diff --git a/client_server/CMakeLists.txt b/client_server/CMakeLists.txt index c02e61858e..58d0aeb87c 100644 --- a/client_server/CMakeLists.txt +++ b/client_server/CMakeLists.txt @@ -6,6 +6,7 @@ else() CHECK_INCLUDE_FILE(arpa/inet.h ARPA_HEADERS) endif() +include(CheckSymbolExists) if(ARPA_HEADERS OR WINSOCK_HEADER) # If necessary, use the RELATIVE flag, otherwise each source file may be listed # with full pathname. RELATIVE may makes it easier to extract an executable name @@ -15,16 +16,21 @@ if(ARPA_HEADERS OR WINSOCK_HEADER) # AUX_SOURCE_DIRECTORY(${CMAKE_CURRENT_SOURCE_DIR} APP_SOURCES) foreach( testsourcefile ${APP_SOURCES} ) # I used a simple string replace, to cut off .cpp. - string( REPLACE ".c" "" testname ${testsourcefile} ) - add_executable( ${testname} ${testsourcefile} ) - - if(OpenMP_C_FOUND) - target_link_libraries(${testname} PRIVATE OpenMP::OpenMP_C) + string(REPLACE ".c" "" testname ${testsourcefile}) + + if(NOT WIN32) + if(${testname} STREQUAL "fork" OR ${testname} STREQUAL "bool") + continue() + endif() endif() - if(MATH_LIBRARY) + add_executable(${testname} ${testsourcefile}) + + if (OpenMP_C_FOUND) + target_link_libraries(${testname} PRIVATE OpenMP::OpenMP_C) + endif () + if (MATH_LIBRARY) target_link_libraries(${testname} PRIVATE ${MATH_LIBRARY}) - endif() - + endif () # if(HAS_UNISTD) # target_compile_definitions(${testname} PRIVATE HAS_UNISTD) # endif() @@ -34,7 +40,7 @@ if(ARPA_HEADERS OR WINSOCK_HEADER) # target_compile_definitions(${testname} PRIVATE WINSOCK_HEADER) # endif() - if(WINSOCK_HEADER) + if (WINSOCK_HEADER) target_link_libraries(${testname} PRIVATE ws2_32) # link winsock library on windows endif() diff --git a/client_server/bool.h b/client_server/bool.h new file mode 100644 index 0000000000..25cc9a72df --- /dev/null +++ b/client_server/bool.h @@ -0,0 +1,55 @@ +/* + * Scilab ( http://www.scilab.org/ ) - This file is part of Scilab + * Copyright (C) 2007 - INRIA + * + * Copyright (C) 2012 - 2016 - Scilab Enterprises + * + * This file is hereby licensed under the terms of the GNU GPL v2.0, + * pursuant to article 5.3.4 of the CeCILL v.2.1. + * This file was originally licensed under the terms of the CeCILL v2.1, + * and continues to be available under such terms. + * For more information, see the COPYING file which you should have received + * along with this program. + * + */ +#ifndef __BOOL_H__ +#define __BOOL_H__ + +/* define boolean type */ +#ifdef BOOL +#undef BOOL +#endif + +#ifdef TRUE +#undef TRUE +#endif + +#ifdef FALSE +#undef FALSE +#endif + + +#ifndef _MSC_VER +typedef enum +{ + FALSE = 0, + TRUE = 1 +} BOOL; + +#else +/* Please notice that BOOL is defined in */ +/* BUT windef.h includes all others windows include */ +/* it is better to redefine as */ +typedef int BOOL; +#define FALSE 0 +#define TRUE 1 + +#endif +/* converts BOOL to bool */ +#define BOOLtobool(w) ((w != FALSE) ? true : false) + +/* converts bool to BOOL */ +#define booltoBOOL(w) ((w == true) ? TRUE : FALSE) + +#endif /* __BOOL_H__ */ +/*--------------------------------------------------------------------------*/ diff --git a/client_server/fork.h b/client_server/fork.h new file mode 100644 index 0000000000..3221d20454 --- /dev/null +++ b/client_server/fork.h @@ -0,0 +1,298 @@ +/* + * Scilab ( http://www.scilab.org/ ) - This file is part of Scilab + * Copyright (C) DIGITEO - 2010 - Allan CORNET + * + * Copyright (C) 2012 - 2016 - Scilab Enterprises + * + * This file is hereby licensed under the terms of the GNU GPL v2.0, + * pursuant to article 5.3.4 of the CeCILL v.2.1. + * This file was originally licensed under the terms of the CeCILL v2.1, + * and continues to be available under such terms. + * For more information, see the COPYING file which you should have received + * along with this program. + * + */ +/*--------------------------------------------------------------------------*/ +#ifndef __FORK_H__ +#define __FORK_H__ + +/* http://technet.microsoft.com/en-us/library/bb497007.aspx */ +/* http://undocumented.ntinternals.net/ */ + +#include +#include + +#include "bool.h" + +/** + * simulate fork on Windows + */ +int fork(void); + +/** + * check if symbols to simulate fork are present + * and load these symbols + */ +BOOL haveLoadedFunctionsForFork(void); + +/*--------------------------------------------------------------------------*/ +typedef LONG NTSTATUS; +/*--------------------------------------------------------------------------*/ +typedef struct _SYSTEM_HANDLE_INFORMATION +{ + ULONG ProcessId; + UCHAR ObjectTypeNumber; + UCHAR Flags; + USHORT Handle; + PVOID Object; + ACCESS_MASK GrantedAccess; +} SYSTEM_HANDLE_INFORMATION, *PSYSTEM_HANDLE_INFORMATION; +/*--------------------------------------------------------------------------*/ +typedef struct _OBJECT_ATTRIBUTES +{ + ULONG Length; + HANDLE RootDirectory; + PVOID /* really PUNICODE_STRING */ ObjectName; + ULONG Attributes; + PVOID SecurityDescriptor; /* type SECURITY_DESCRIPTOR */ + PVOID SecurityQualityOfService; /* type SECURITY_QUALITY_OF_SERVICE */ +} OBJECT_ATTRIBUTES, *POBJECT_ATTRIBUTES; +/*--------------------------------------------------------------------------*/ +typedef enum _MEMORY_INFORMATION_ +{ + MemoryBasicInformation, + MemoryWorkingSetList, + MemorySectionName, + MemoryBasicVlmInformation +} MEMORY_INFORMATION_CLASS; +/*--------------------------------------------------------------------------*/ +typedef struct _CLIENT_ID +{ + HANDLE UniqueProcess; + HANDLE UniqueThread; +} CLIENT_ID, *PCLIENT_ID; +/*--------------------------------------------------------------------------*/ +typedef struct _USER_STACK +{ + PVOID FixedStackBase; + PVOID FixedStackLimit; + PVOID ExpandableStackBase; + PVOID ExpandableStackLimit; + PVOID ExpandableStackBottom; +} USER_STACK, *PUSER_STACK; +/*--------------------------------------------------------------------------*/ +typedef LONG KPRIORITY; +typedef ULONG_PTR KAFFINITY; +typedef KAFFINITY *PKAFFINITY; +/*--------------------------------------------------------------------------*/ +typedef struct _THREAD_BASIC_INFORMATION +{ + NTSTATUS ExitStatus; + PVOID TebBaseAddress; + CLIENT_ID ClientId; + KAFFINITY AffinityMask; + KPRIORITY Priority; + KPRIORITY BasePriority; +} THREAD_BASIC_INFORMATION, *PTHREAD_BASIC_INFORMATION; +/*--------------------------------------------------------------------------*/ +typedef enum _SYSTEM_INFORMATION_CLASS +{ + SystemHandleInformation = 0x10 +} SYSTEM_INFORMATION_CLASS; +/*--------------------------------------------------------------------------*/ +typedef NTSTATUS(NTAPI *ZwWriteVirtualMemory_t)( + IN HANDLE ProcessHandle, IN PVOID BaseAddress, IN PVOID Buffer, + IN ULONG NumberOfBytesToWrite, OUT PULONG NumberOfBytesWritten OPTIONAL); +/*--------------------------------------------------------------------------*/ +typedef NTSTATUS(NTAPI *ZwCreateProcess_t)( + OUT PHANDLE ProcessHandle, IN ACCESS_MASK DesiredAccess, + IN POBJECT_ATTRIBUTES ObjectAttributes, IN HANDLE InheriteFromProcessHandle, + IN BOOLEAN InheritHandles, IN HANDLE SectionHandle OPTIONAL, + IN HANDLE DebugPort OPTIONAL, IN HANDLE ExceptionPort OPTIONAL); +/*--------------------------------------------------------------------------*/ +typedef NTSTATUS(WINAPI *ZwQuerySystemInformation_t)( + SYSTEM_INFORMATION_CLASS SystemInformationClass, PVOID SystemInformation, + ULONG SystemInformationLength, PULONG ReturnLength); +typedef NTSTATUS(NTAPI *ZwQueryVirtualMemory_t)( + IN HANDLE ProcessHandle, IN PVOID BaseAddress, + IN MEMORY_INFORMATION_CLASS MemoryInformationClass, + OUT PVOID MemoryInformation, IN ULONG MemoryInformationLength, + OUT PULONG ReturnLength OPTIONAL); +/*--------------------------------------------------------------------------*/ +typedef NTSTATUS(NTAPI *ZwGetContextThread_t)(IN HANDLE ThreadHandle, + OUT PCONTEXT Context); +typedef NTSTATUS(NTAPI *ZwCreateThread_t)( + OUT PHANDLE ThreadHandle, IN ACCESS_MASK DesiredAccess, + IN POBJECT_ATTRIBUTES ObjectAttributes, IN HANDLE ProcessHandle, + OUT PCLIENT_ID ClientId, IN PCONTEXT ThreadContext, + IN PUSER_STACK UserStack, IN BOOLEAN CreateSuspended); +/*--------------------------------------------------------------------------*/ +typedef NTSTATUS(NTAPI *ZwResumeThread_t)(IN HANDLE ThreadHandle, + OUT PULONG SuspendCount OPTIONAL); +typedef NTSTATUS(NTAPI *ZwClose_t)(IN HANDLE ObjectHandle); +typedef NTSTATUS(NTAPI *ZwQueryInformationThread_t)( + IN HANDLE ThreadHandle, IN THREAD_INFORMATION_CLASS ThreadInformationClass, + OUT PVOID ThreadInformation, IN ULONG ThreadInformationLength, + OUT PULONG ReturnLength OPTIONAL); +/*--------------------------------------------------------------------------*/ +static ZwCreateProcess_t ZwCreateProcess = NULL; +static ZwQuerySystemInformation_t ZwQuerySystemInformation = NULL; +static ZwQueryVirtualMemory_t ZwQueryVirtualMemory = NULL; +static ZwCreateThread_t ZwCreateThread = NULL; +static ZwGetContextThread_t ZwGetContextThread = NULL; +static ZwResumeThread_t ZwResumeThread = NULL; +static ZwClose_t ZwClose = NULL; +static ZwQueryInformationThread_t ZwQueryInformationThread = NULL; +static ZwWriteVirtualMemory_t ZwWriteVirtualMemory = NULL; +/*--------------------------------------------------------------------------*/ +#define NtCurrentProcess() ((HANDLE)-1) +#define NtCurrentThread() ((HANDLE)-2) +/* we use really the Nt versions - so the following is just for completeness */ +#define ZwCurrentProcess() NtCurrentProcess() +#define ZwCurrentThread() NtCurrentThread() +#define STATUS_INFO_LENGTH_MISMATCH ((NTSTATUS)0xC0000004L) +#define STATUS_SUCCESS ((NTSTATUS)0x00000000L) +/*--------------------------------------------------------------------------*/ +/* setjmp env for the jump back into the fork() function */ +static jmp_buf jenv; +/*--------------------------------------------------------------------------*/ +/* entry point for our child thread process - just longjmp into fork */ +static int child_entry(void) +{ + longjmp(jenv, 1); + return 0; +} +/*--------------------------------------------------------------------------*/ +static BOOL haveLoadedFunctionsForFork(void) +{ + HMODULE ntdll = GetModuleHandle("ntdll"); + if (ntdll == NULL) + { + return FALSE; + } + + if (ZwCreateProcess && ZwQuerySystemInformation && ZwQueryVirtualMemory && + ZwCreateThread && ZwGetContextThread && ZwResumeThread && + ZwQueryInformationThread && ZwWriteVirtualMemory && ZwClose) + { + return TRUE; + } + + ZwCreateProcess = + (ZwCreateProcess_t)GetProcAddress(ntdll, "ZwCreateProcess"); + ZwQuerySystemInformation = (ZwQuerySystemInformation_t)GetProcAddress( + ntdll, "ZwQuerySystemInformation"); + ZwQueryVirtualMemory = + (ZwQueryVirtualMemory_t)GetProcAddress(ntdll, "ZwQueryVirtualMemory"); + ZwCreateThread = (ZwCreateThread_t)GetProcAddress(ntdll, "ZwCreateThread"); + ZwGetContextThread = + (ZwGetContextThread_t)GetProcAddress(ntdll, "ZwGetContextThread"); + ZwResumeThread = (ZwResumeThread_t)GetProcAddress(ntdll, "ZwResumeThread"); + ZwQueryInformationThread = (ZwQueryInformationThread_t)GetProcAddress( + ntdll, "ZwQueryInformationThread"); + ZwWriteVirtualMemory = + (ZwWriteVirtualMemory_t)GetProcAddress(ntdll, "ZwWriteVirtualMemory"); + ZwClose = (ZwClose_t)GetProcAddress(ntdll, "ZwClose"); + + if (ZwCreateProcess && ZwQuerySystemInformation && ZwQueryVirtualMemory && + ZwCreateThread && ZwGetContextThread && ZwResumeThread && + ZwQueryInformationThread && ZwWriteVirtualMemory && ZwClose) + { + return TRUE; + } + else + { + ZwCreateProcess = NULL; + ZwQuerySystemInformation = NULL; + ZwQueryVirtualMemory = NULL; + ZwCreateThread = NULL; + ZwGetContextThread = NULL; + ZwResumeThread = NULL; + ZwQueryInformationThread = NULL; + ZwWriteVirtualMemory = NULL; + ZwClose = NULL; + } + return FALSE; +} +/*--------------------------------------------------------------------------*/ +int fork(void) +{ + HANDLE hProcess = 0, hThread = 0; + OBJECT_ATTRIBUTES oa = {sizeof(oa)}; + MEMORY_BASIC_INFORMATION mbi; + CLIENT_ID cid; + USER_STACK stack; + PNT_TIB tib; + THREAD_BASIC_INFORMATION tbi; + + CONTEXT context = {CONTEXT_FULL | CONTEXT_DEBUG_REGISTERS | + CONTEXT_FLOATING_POINT}; + + if (setjmp(jenv) != 0) + { + return 0; /* return as a child */ + } + + /* check whether the entry points are initilized and get them if necessary + */ + if (!ZwCreateProcess && !haveLoadedFunctionsForFork()) + { + return -1; + } + + /* create forked process */ + ZwCreateProcess(&hProcess, PROCESS_ALL_ACCESS, &oa, NtCurrentProcess(), + TRUE, 0, 0, 0); + + /* set the Eip for the child process to our child function */ + ZwGetContextThread(NtCurrentThread(), &context); + + /* In x64 the Eip and Esp are not present, their x64 counterparts are Rip + and Rsp respectively. + */ +#if _WIN64 + context.Rip = (ULONG)child_entry; +#else + context.Eip = (ULONG)child_entry; +#endif + +#if _WIN64 + ZwQueryVirtualMemory(NtCurrentProcess(), (PVOID)context.Rsp, + MemoryBasicInformation, &mbi, sizeof mbi, 0); +#else + ZwQueryVirtualMemory(NtCurrentProcess(), (PVOID)context.Esp, + MemoryBasicInformation, &mbi, sizeof mbi, 0); +#endif + + stack.FixedStackBase = 0; + stack.FixedStackLimit = 0; + stack.ExpandableStackBase = (PCHAR)mbi.BaseAddress + mbi.RegionSize; + stack.ExpandableStackLimit = mbi.BaseAddress; + stack.ExpandableStackBottom = mbi.AllocationBase; + + /* create thread using the modified context and stack */ + ZwCreateThread(&hThread, THREAD_ALL_ACCESS, &oa, hProcess, &cid, &context, + &stack, TRUE); + + /* copy exception table */ + ZwQueryInformationThread(NtCurrentThread(), ThreadMemoryPriority, &tbi, + sizeof tbi, 0); + tib = (PNT_TIB)tbi.TebBaseAddress; + ZwQueryInformationThread(hThread, ThreadMemoryPriority, &tbi, sizeof tbi, + 0); + ZwWriteVirtualMemory(hProcess, tbi.TebBaseAddress, &tib->ExceptionList, + sizeof tib->ExceptionList, 0); + + /* start (resume really) the child */ + ZwResumeThread(hThread, 0); + + /* clean up */ + ZwClose(hThread); + ZwClose(hProcess); + + /* exit with child's pid */ + return (int)cid.UniqueProcess; +} + +#endif /* __FORK_H__ */ +/*--------------------------------------------------------------------------*/ diff --git a/client_server/remote_command_exec_udp_client.c b/client_server/remote_command_exec_udp_client.c index 8a2afa0c52..6669919f5a 100644 --- a/client_server/remote_command_exec_udp_client.c +++ b/client_server/remote_command_exec_udp_client.c @@ -14,17 +14,26 @@ * using UDP is shown using the server-client model & socket programming */ +#ifdef _WIN32 +#define bzero(b, len) \ + (memset((b), '\0', (len)), (void)0) /**< BSD name not in windows */ +#define close _close +#include +#include +#include /// For the type in_addr_t and in_port_t +#else #include /// For the type in_addr_t and in_port_t -#include /// To indicate what went wrong if an error occurs #include /// For structures returned by the network database library - formatted internet addresses and port numbers #include /// For in_addr and sockaddr_in structures -#include /// For specific bit size values of variables +#include /// For macro definitions related to the creation of sockets +#include /// For definitions to allow for the porting of BSD programs +#include +#endif +#include /// To indicate what went wrong if an error occurs +#include /// For specific bit size values of variables #include /// Variable types, several macros, and various functions for performing input and output #include /// Variable types, several macros, and various functions for performing general functions #include /// Various functions for manipulating arrays of characters -#include /// For macro definitions related to the creation of sockets -#include /// For definitions to allow for the porting of BSD programs -#include /// For miscellaneous symbolic constants and types, and miscellaneous functions #define PORT 10000 /// Define port over which communication will take place diff --git a/client_server/remote_command_exec_udp_server.c b/client_server/remote_command_exec_udp_server.c index 619c116cf2..67d623904e 100644 --- a/client_server/remote_command_exec_udp_server.c +++ b/client_server/remote_command_exec_udp_server.c @@ -14,17 +14,26 @@ * using UDP is shown using the server-client model & socket programming */ +#ifdef _WIN32 +#define bzero(b, len) \ + (memset((b), '\0', (len)), (void)0) /**< BSD name not in windows */ +#define close _close +#include +#include +#include /// For the type in_addr_t and in_port_t +#else #include /// For the type in_addr_t and in_port_t -#include /// To indicate what went wrong if an error occurs #include /// For structures returned by the network database library - formatted internet addresses and port numbers #include /// For in_addr and sockaddr_in structures -#include /// For specific bit size values of variables +#include /// For macro definitions related to the creation of sockets +#include /// For definitions to allow for the porting of BSD programs +#include +#endif +#include /// To indicate what went wrong if an error occurs +#include /// For specific bit size values of variables #include /// Variable types, several macros, and various functions for performing input and output #include /// Variable types, several macros, and various functions for performing general functions #include /// Various functions for manipulating arrays of characters -#include /// For macro definitions related to the creation of sockets -#include /// For definitions to allow for the porting of BSD programs -#include /// For miscellaneous symbolic constants and types, and miscellaneous functions #define PORT 10000 /// Define port over which communication will take place diff --git a/client_server/tcp_full_duplex_client.c b/client_server/tcp_full_duplex_client.c index 25c21b4684..12836c598e 100644 --- a/client_server/tcp_full_duplex_client.c +++ b/client_server/tcp_full_duplex_client.c @@ -17,16 +17,29 @@ * can be represented using the TCP server-client model & socket programming */ +#ifdef _WIN32 +#define bzero(b, len) \ + (memset((b), '\0', (len)), (void)0) /**< BSD name not in windows */ +#define pid_t int +#define close _close +#include +#include +#include +#include +#include "fork.h" +#define sleep(a) Sleep(a * 1000) +#else #include /// For the type in_addr_t and in_port_t #include /// For structures returned by the network database library - formatted internet addresses and port numbers #include /// For in_addr and sockaddr_in structures -#include /// For specific bit size values of variables +#include /// For macro definitions related to the creation of sockets +#include /// For definitions to allow for the porting of BSD programs +#include +#endif +#include /// For specific bit size values of variables #include /// Variable types, several macros, and various functions for performing input and output #include /// Variable types, several macros, and various functions for performing general functions #include /// Various functions for manipulating arrays of characters -#include /// For macro definitions related to the creation of sockets -#include /// For definitions to allow for the porting of BSD programs -#include /// For miscellaneous symbolic constants and types, and miscellaneous functions #define PORT 10000 /// Define port over which communication will take place @@ -141,6 +154,7 @@ int main() */ pid_t pid; pid = fork(); + if (pid == 0) /// Value of 0 is for child process { while (1) diff --git a/client_server/tcp_full_duplex_server.c b/client_server/tcp_full_duplex_server.c index da3635c6d2..aab2ea8dfa 100644 --- a/client_server/tcp_full_duplex_server.c +++ b/client_server/tcp_full_duplex_server.c @@ -3,7 +3,7 @@ * @author [NVombat](https://github.com/NVombat) * @brief Server-side implementation of [TCP Full Duplex * Communication](http://www.tcpipguide.com/free/t_SimplexFullDuplexandHalfDuplexOperation.htm) - * @see tcp_full_duplex_server.c + * @see tcp_full_duplex_client.c * * @details * The algorithm is based on the simple TCP client and server model. However, @@ -17,16 +17,29 @@ * can be represented using the TCP server-client model & socket programming */ +#ifdef _WIN32 +#define bzero(b, len) \ + (memset((b), '\0', (len)), (void)0) /**< BSD name not in windows */ +#define pid_t int +#define close _close +#include +#include +#include +#include +#include "fork.h" +#define sleep(a) Sleep(a * 1000) +#else #include /// For the type in_addr_t and in_port_t #include /// For structures returned by the network database library - formatted internet addresses and port numbers #include /// For in_addr and sockaddr_in structures -#include /// For specific bit size values of variables +#include /// For macro definitions related to the creation of sockets +#include /// For definitions to allow for the porting of BSD programs +#include +#endif +#include /// For specific bit size values of variables #include /// Variable types, several macros, and various functions for performing input and output #include /// Variable types, several macros, and various functions for performing general functions #include /// Various functions for manipulating arrays of characters -#include /// For macro definitions related to the creation of sockets -#include /// For definitions to allow for the porting of BSD programs -#include /// For miscellaneous symbolic constants and types, and miscellaneous functions #define PORT 10000 /// Define port over which communication will take place @@ -162,7 +175,15 @@ int main() * place simultaneously this represents FULL DUPLEX COMMUNICATION */ pid_t pid; + + #ifdef _WIN32 + #ifdef FORK_WINDOWS + pid = fork(); + #endif + #else pid = fork(); + #endif + if (pid == 0) /// Value of 0 is for child process { while (1) diff --git a/client_server/tcp_half_duplex_client.c b/client_server/tcp_half_duplex_client.c index 51cc98b9a3..0d77dedc17 100644 --- a/client_server/tcp_half_duplex_client.c +++ b/client_server/tcp_half_duplex_client.c @@ -15,15 +15,24 @@ * can be represented using the TCP server-client model & socket programming */ +#ifdef _WIN32 +#define bzero(b, len) \ + (memset((b), '\0', (len)), (void)0) /**< BSD name not in windows */ +#define close _close +#include +#include +#include +#else #include /// For structures returned by the network database library - formatted internet addresses and port numbers -#include /// For in_addr and sockaddr_in structures -#include /// For specific bit size values of variables +#include /// For macro definitions related to the creation of sockets +#include /// For definitions to allow for the porting of BSD programs +#include +#endif +// #include /// For in_addr and sockaddr_in structures +#include /// For specific bit size values of variables #include /// Variable types, several macros, and various functions for performing input and output #include /// Variable types, several macros, and various functions for performing general functions #include /// Various functions for manipulating arrays of characters -#include /// For macro definitions related to the creation of sockets -#include /// For definitions to allow for the porting of BSD programs -#include /// For miscellaneous symbolic constants and types, and miscellaneous functions #define PORT 8100 /// Define port over which communication will take place diff --git a/client_server/tcp_half_duplex_server.c b/client_server/tcp_half_duplex_server.c index 9a1a7c1d05..266d9896bc 100644 --- a/client_server/tcp_half_duplex_server.c +++ b/client_server/tcp_half_duplex_server.c @@ -15,15 +15,24 @@ * can be represented using the TCP server-client model & socket programming */ +#ifdef _WIN32 +#define bzero(b, len) \ + (memset((b), '\0', (len)), (void)0) /**< BSD name not in windows */ +#define close _close +#include +#include +#include +#else #include /// For structures returned by the network database library - formatted internet addresses and port numbers -#include /// For in_addr and sockaddr_in structures -#include /// For specific bit size values of variables +#include /// For macro definitions related to the creation of sockets +#include /// For definitions to allow for the porting of BSD programs +#include +#endif +// #include /// For in_addr and sockaddr_in structures +#include /// For specific bit size values of variables #include /// Variable types, several macros, and various functions for performing input and output #include /// Variable types, several macros, and various functions for performing general functions #include /// Various functions for manipulating arrays of characters -#include /// For macro definitions related to the creation of sockets -#include /// For definitions to allow for the porting of BSD programs -#include /// For miscellaneous symbolic constants and types, and miscellaneous functions #define PORT 8100 /// Define port over which communication will take place diff --git a/developer_tools/min_printf.h b/developer_tools/min_printf.h index b58db13d26..395331c18f 100644 --- a/developer_tools/min_printf.h +++ b/developer_tools/min_printf.h @@ -19,7 +19,11 @@ #define MIN_PRINTF_H #include /// for `malloc` and `free` functions -#include /// for `write` function +#ifdef _WIN32 + #include /// for `write` function +#else + #include /// for `write` function +#endif #include /// for `va_start` and `va_arg` functions #define INT_MAX_LENGTH 10 /// used as standard length of string to store integers diff --git a/dynamic_programming/matrix_chain_order.c b/dynamic_programming/matrix_chain_order.c index d0ee8cacee..7b48f4ca5e 100644 --- a/dynamic_programming/matrix_chain_order.c +++ b/dynamic_programming/matrix_chain_order.c @@ -1,18 +1,20 @@ /** * @file - * @brief [Matrix Chain Order](https://en.wikipedia.org/wiki/Matrix_chain_multiplication) + * @brief [Matrix Chain + * Order](https://en.wikipedia.org/wiki/Matrix_chain_multiplication) * @details - * From Wikipedia: Matrix chain multiplication (or the matrix chain ordering problem) - * is an optimization problem concerning the most efficient way to multiply a given sequence of matrices. - * The problem is not actually to perform the multiplications, - * but merely to decide the sequence of the matrix multiplications involved. + * From Wikipedia: Matrix chain multiplication (or the matrix chain ordering + * problem) is an optimization problem concerning the most efficient way to + * multiply a given sequence of matrices. The problem is not actually to perform + * the multiplications, but merely to decide the sequence of the matrix + * multiplications involved. * @author [CascadingCascade](https://github.com/CascadingCascade) */ -#include /// for assert -#include /// for IO operations -#include /// for INT_MAX macro -#include /// for malloc() and free() +#include /// for assert +#include /// for INT_MAX macro +#include /// for IO operations +#include /// for malloc() and free() /** * @brief Finds the optimal sequence using the classic O(n^3) algorithm. @@ -21,27 +23,49 @@ * @param s location to store results * @returns number of operations */ -int matrixChainOrder(int l,const int *p, int *s) { - // mat stores the cost for a chain that starts at i and ends on j (inclusive on both ends) - int mat[l][l]; - for (int i = 0; i < l; ++i) { +int matrixChainOrder(int l, const int *p, int *s) +{ + // mat stores the cost for a chain that starts at i and ends on j (inclusive + // on both ends) + int **mat = malloc(l * sizeof(int *)); + for (int i = 0; i < l; ++i) + { + mat[i] = malloc(l * sizeof(int)); + } + + for (int i = 0; i < l; ++i) + { mat[i][i] = 0; } - // cl denotes the difference between start / end indices, cl + 1 would be chain length. - for (int cl = 1; cl < l; ++cl) { - for (int i = 0; i < l - cl; ++i) { + // cl denotes the difference between start / end indices, cl + 1 would be + // chain length. + for (int cl = 1; cl < l; ++cl) + { + for (int i = 0; i < l - cl; ++i) + { int j = i + cl; mat[i][j] = INT_MAX; - for (int div = i; div < j; ++div) { + for (int div = i; div < j; ++div) + { int q = mat[i][div] + mat[div + 1][j] + p[i] * p[div] * p[j]; - if (q < mat[i][j]) { + if (q < mat[i][j]) + { mat[i][j] = q; s[i * l + j] = div; } } } } - return mat[0][l - 1]; + int result = mat[0][l - 1]; + + // Free dynamically allocated memory + for (int i = 0; i < l; ++i) + { + free(mat[i]); + } + free(mat); + + return result; } /** @@ -52,14 +76,16 @@ int matrixChainOrder(int l,const int *p, int *s) { * @param j ending index * @returns void */ -void printSolution(int l,int *s,int i,int j) { - if(i == j) { - printf("A%d",i); +void printSolution(int l, int *s, int i, int j) +{ + if (i == j) + { + printf("A%d", i); return; } putchar('('); - printSolution(l,s,i,s[i * l + j]); - printSolution(l,s,s[i * l + j] + 1,j); + printSolution(l, s, i, s[i * l + j]); + printSolution(l, s, s[i * l + j] + 1, j); putchar(')'); } @@ -67,15 +93,16 @@ void printSolution(int l,int *s,int i,int j) { * @brief Self-test implementations * @returns void */ -static void test() { - int sizes[] = {35,15,5,10,20,25}; +static void test() +{ + int sizes[] = {35, 15, 5, 10, 20, 25}; int len = 6; int *sol = malloc(len * len * sizeof(int)); - int r = matrixChainOrder(len,sizes,sol); + int r = matrixChainOrder(len, sizes, sol); assert(r == 18625); - printf("Result : %d\n",r); + printf("Result : %d\n", r); printf("Optimal ordering : "); - printSolution(len,sol,0,5); + printSolution(len, sol, 0, 5); free(sol); printf("\n"); @@ -85,7 +112,8 @@ static void test() { * @brief Main function * @returns 0 */ -int main() { +int main() +{ test(); // run self-test implementations return 0; } diff --git a/graphics/CMakeLists.txt b/graphics/CMakeLists.txt index 6bb38bc294..89fc65659b 100644 --- a/graphics/CMakeLists.txt +++ b/graphics/CMakeLists.txt @@ -8,7 +8,7 @@ if(OpenGL_FOUND) FREEGLUT-PRJ URL https://github.com/FreeGLUTProject/freeglut/releases/download/v3.2.1/freeglut-3.2.1.tar.gz URL_MD5 cd5c670c1086358598a6d4a9d166949d - CMAKE_GENERATOR ${CMAKE_GENERATOR} --config Release + CMAKE_GENERATOR ${CMAKE_GENERATOR} CMAKE_GENERATOR_TOOLSET ${CMAKE_GENERATOR_TOOLSET} CMAKE_GENERATOR_PLATFORM ${CMAKE_GENERATOR_PLATFORM} CMAKE_ARGS -DCMAKE_BUILD_TYPE=Release diff --git a/searching/exponential_search.c b/searching/exponential_search.c index 7f30b4430c..efb1ec7105 100644 --- a/searching/exponential_search.c +++ b/searching/exponential_search.c @@ -3,8 +3,9 @@ * \brief [Exponential Search](https://github.com/TheAlgorithms/Algorithms-Explanation/blob/master/en/Search%20Algorithms/Exponential%20Search.md) * \author [Alessio Farinelli](https://github.com/faridevnz) */ -#include /// for assert +#include /// for assert #include /// for int64_t, uint16_t +#include /// for printf #define ELEMENT -10 @@ -81,7 +82,7 @@ int main() static void test() { // empty array - int64_t arr_empty[] = {}; + int64_t arr_empty[] = { 0 }; assert(exponential_search(arr_empty, 0, 10) == -1); // elent not found int64_t arr_found[] = {1, 2, 3}; @@ -104,4 +105,6 @@ static void test() // find an element in an array of length n int64_t arr_middle[] = {-1, 2, 4, 6, 8}; assert(exponential_search(arr_middle, 5, 6) == 3); + + printf("All tests have successfully passed!\n"); } From e5dad3fa8def3726ec850ca66a7f51521f8ad393 Mon Sep 17 00:00:00 2001 From: David Leal Date: Wed, 27 Sep 2023 12:35:39 -0600 Subject: [PATCH 156/156] feat: use directory workflow from the `scripts` repository (#1278) * feat: use directory workflow from the... ...`scripts` repository. * fix: `on` event * chore: run directory workflow daily --- .github/workflows/awesome_workflow.yml | 5 ----- .github/workflows/directory_writer.yml | 29 ++++++++++++++++++++++++++ 2 files changed, 29 insertions(+), 5 deletions(-) create mode 100644 .github/workflows/directory_writer.yml diff --git a/.github/workflows/awesome_workflow.yml b/.github/workflows/awesome_workflow.yml index 728238e88f..d57946e53c 100644 --- a/.github/workflows/awesome_workflow.yml +++ b/.github/workflows/awesome_workflow.yml @@ -26,11 +26,6 @@ jobs: uses: TheAlgorithms/scripts/formatter@main with: filetypes: .c,.h - - name: Update DIRECTORY.md - run: | - wget https://raw.githubusercontent.com/TheAlgorithms/scripts/main/build_directory_md.py - python3 build_directory_md.py C . .c,.h leetcode/ > DIRECTORY.md - git commit -m "updating DIRECTORY.md" DIRECTORY.md || true - name: Get file changes run: | git branch diff --git a/.github/workflows/directory_writer.yml b/.github/workflows/directory_writer.yml new file mode 100644 index 0000000000..527a55e27d --- /dev/null +++ b/.github/workflows/directory_writer.yml @@ -0,0 +1,29 @@ +name: Directory writer +on: + schedule: + # ┌───────────── minute (0 - 59) + # │ ┌───────────── hour (0 - 23) + # │ │ ┌───────────── day of the month (1 - 31) + # │ │ │ ┌───────────── month (1 - 12 or JAN-DEC) + # │ │ │ │ ┌───────────── day of the week (0 - 6 or SUN-SAT) + # │ │ │ │ │ + # │ │ │ │ │ + # │ │ │ │ │ + # * * * * * + - cron: '0 0 * * *' + workflow_dispatch: +jobs: + build: + if: github.repository == 'TheAlgorithms/C' # We only need this to run in our repository. + runs-on: ubuntu-latest + steps: + - uses: actions/checkout@v3 + with: + fetch-depth: 0 + - name: Build directory + uses: TheAlgorithms/scripts/directory_md@main + with: + language: C + working-directory: . + filetypes: .c,.h + ignored-directories: leetcode/,scripts/