Skip to content

Latest commit

 

History

History
136 lines (99 loc) · 4.61 KB

File metadata and controls

136 lines (99 loc) · 4.61 KB

Transcribing DNA into RNA

For this exercise, we’ll be applying what we learned about modifying strings to a variation on this Rosalind exercise that transcribes DNA into RNA:

You will write a Python program called transcribe.py that will accept:

  • One or more positional arguments which must be readable files

  • An optional -o or --outdir argument that names an output directory (default 'out')

You can use the os.path.isdir to check if the output directory exists. It works just like the os.path.isfile function we’ve used that will return True or False if a given string names an existing file, only this checks for a directory. Here assuming that "blargh" does not exist on your system:

>>> import os
>>> os.path.isdir('blargh')
False

If the directory does not exist, you should use the os.makedirs function to create it. Here is a bit of code you can put into your program:

if not os.path.isdir(out_dir):
    os.makedirs(out_dir)

Your program will read each of the input files which will contain a single DNA sequence on each line. The sequences will need to replace the T bases with U. For instance, the input1.txt file contains a single sequence 'GATGGAACTTGACTACGTAAATT' which will become 'GAUGGAACUUGACUACGUAAAUU'.

The new sequences from each input file will be written to a new output file in the --outdir. The name of the file will be the "basename" of the input file which you can get by using the os.path.basename function. For instance, the "basename" of './inputs/input1.txt' is 'input1.txt':

>>> base = os.path.basename('./inputs/input1.txt')
>>> base
'input1.txt'

If the output directory is 'out', you can create a new path for the output file by using the os.path.join function with the basename of the input file’s basename:

>>> out_dir = 'out'
>>> os.path.join(out_dir, base)
'out/input1.txt'

If you declare your args.file parameter using type=argparse.FileType('r'), then you’ll be iterating over a list of open file handles. You can use the fh.name to get the name of the file:

for fh in args.file:
    out_file = os.path.join(out_dir, os.path.basename(fh.name))
    out_fh = open(out_file, 'wt')

You will have two levels of iteration:

  • Each file argument

  • Each line in each file

You will need to open the output file for writing text, iterate over each line in the input file, and print the transcribed sequences to the output file.

Your program should print a brief usage when given no arguments:

$ ./transcribe.py
usage: transcribe.py [-h] [-o DIR] FILE [FILE ...]
transcribe.py: error: the following arguments are required: FILE

And a longer usage for -h and --help:

$ ./transcribe.py -h
usage: transcribe.py [-h] [-o DIR] FILE [FILE ...]

Transcribing DNA into RNA

positional arguments:
  FILE                  Input file(s)

optional arguments:
  -h, --help            show this help message and exit
  -o DIR, --outdir DIR  Output directory (default: out)

The output from the program should summarize how many sequences and files were processed. For example, the input1.txt file contains a single line/sequence, so the result should be this:

$ ./transcribe.py inputs/input1.txt
Done, wrote 1 sequence in 1 file to directory "out".

While the input2.txt file contains two lines/sequences:

$ ./transcribe.py inputs/input2.txt
Done, wrote 2 sequences in 1 file to directory "out".

When you process both together, it should summarize for all the inputs:

$ ./transcribe.py inputs/*
Done, wrote 3 sequences in 2 files to directory "out".

Note that you must use the correct singular/plural for both "sequence(s)" and "file(s)."

Many elements of this program are almost identical to the wc.py program, so I would recommend you revisit that.

A passing test suite looks like this:

$ make test
pytest -xv test.py
============================= test session starts ==============================
...
collected 7 items

test.py::test_exists PASSED                                              [ 14%]
test.py::test_usage PASSED                                               [ 28%]
test.py::test_no_args PASSED                                             [ 42%]
test.py::test_bad_file PASSED                                            [ 57%]
test.py::test_good_input1 PASSED                                         [ 71%]
test.py::test_good_input2 PASSED                                         [ 85%]
test.py::test_good_multiple_inputs PASSED                                [100%]

============================== 7 passed in 0.36s ===============================