########################################################################################

##

## An intro to Python for biology

##

########################################################################################

########################################################################################

######################## Variables and print statements ################################

########################################################################################

# this is a comment, use these to tell people what your code does

mystring = "Homo sapiens" # a string, letters, words, sentences, anything in quotes

myinteger = 4 # an integer

myfloat = 4.0 # a float (a number with a decimal point)

print "This is a string: %s, this is a float: %f, and this is an integer: %d" % (mystring,myfloat,myinteger)

print "We are %s and there are %d bases in our DNA" % (mystring, myinteger)

# use %s when you need a string

# use %d when you need an integer

# use %f when you need a float (a number with a decimal point)

########################################################################################

################################### Basic Math #########################################

########################################################################################

myfloat = 2.0

yourfloat = 3.0

print myfloat/yourfloat

myint = 2

yourint = 3

print myint/yourint

# The anwer is 2/3 = 0.666666667 but Python and many other programming lanuages have a quirk where they think that any math you do with integers can only output another integer.

# Let's explore this and see if we can find tricks to deal with it

myint = 2

yourint = 3

# Which of these work and why?

print float(myint)/yourint # 1

print myint/float(yourint) # 2

print (myint+0.0)/yourint # 3

print myint/yourint + 0.0 # 4

print myint*1.0/yourint # 5

print myint/yourint*1.0 # 6

########################################################################################

########################### Lists, strings, and for loops ##############################

########################################################################################

####### LISTS #######

mylist = [6,3,6,7,2,6,2,9,7,0]

print mylist

print mylist[0]

print mylist[1]

print mylist[2]

###### STRINGS ######

# strings are like lists of letters, so you can get individual letters using the bracket notation

mystring = "ACGT"

print len(mystring) ## => 4

print mystring[0]

print mystring[1]

print mystring[2]

print mystring[3]

#print mystring[4] # Error:"string index out of range"

DNA = "CAACGGGCAATATGTCTCTGTGTG"

print "Your DNA is %d bases long" % (len(DNA))

print DNA[7]

######### lists can contain anything #########

mylist = [1,"anything",2.45,5,10,"Hello world"]

print mylist[4]

####### you can also make lists longer ######

print mylist

mylist.append(56)

print mylist

# this means you can start with an empty list and add to it:

nucleotides = []

nucleotides.append("A")

nucleotides.append("C")

nucleotides.append("G")

nucleotides.append("T")

print nucleotides

########## QUESTION 3: Which of these are correct? Which give errors? ###########

################ indexing lists ###################

mylist = range(10)

print mylist

print mylist[0:10]

print mylist[:]

print mylist[1:10]

print mylist[4:8]

print mylist[3:]

print mylist[0:10:2] # what does the third number do?

print mylist[0:7:3]

print mylist[::-1] # what does this do?

###### Two different versions of a "for loop" #######

for letter in DNA:

print letter

# the variable letter can be anything, try switching it out with tomato

for tomato in DNA:

print tomato

# we only call it letter so it makes sense. This becomes important when you have many more variables. At that point, naming them after fruits suddenly isn't funny anymore.

# you can also make a for loop like this:

# xrange gives a list from 0 to len(DNA), so i loops through that list

for i in xrange(len(DNA)):

print i

# when you do this, you get the bases in the DNA by saying DNA[i]

for i in xrange(len(DNA)):

print "Letter number %d in your DNA is %s" % (i,DNA[i])

# sometimes we really care about the indices, like when we are dealing with 2 or more lists in parallel

DNA = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"

RNA = "AGCUUUUCAUUCUGACUGCAACGGGCAAUAUGUCUCUGUGUGGAUUAAAAAAAGAGUGUCUGAUAGCAGC"

length = len(DNA)

for i in xrange(length):

print "DNA: %s, RNA: %s" % (DNA[i],RNA[i])

# xrange can do many things:

for b in xrange(0,4,1): # start=0,stop=4,step=1

print b

for j in xrange(2,10,2):

print j

########## Now you try to print (1,3,5,7,9) using a for loop ###########

########### You can also make empty strings and add to them #############

DNA = "AGCTTTTCATTC"

# just like lists, you can also add to strings:

mystring = str() # makes an empty string, just like mylist = [] makes an empty list

for i in xrange(len(DNA)):

mystring+=DNA[i]

print mystring

# how is this different from making a list?

mylist = []

for i in xrange(len(DNA)):

mylist.append(DNA[i])

print mylist

# if you do make a list and want it to be a string, you can always just do this:

mystring = str()

for item in mylist:

mystring+=item

print mystring

########################################################################################

################################## If statements #######################################

########################################################################################

#What do you think this does?

correct=True # this is another kind of variable, called a boolean: it can only be True or False

if correct==True:

print "You are right!"

else:

print "You are wrong!"

# You can set as many cases as you want using elif (short for "else if")

mystring = "ABCYSGD"

for letter in mystring:

if letter == "A":

print "Alpha"

elif letter == "B":

print "Bravo"

elif letter == "C":

print "Charlie"

elif letter == "D":

print "Delta"

else:

print "Ummm, I don't know what %s is in military speak" % (letter)

# You can also use these if statements for input validation

# If you ask the user for a string of DNA, it would be nice to check that the string looks like DNA before you do a lot of work with it

############### Challenge: Loop through this string of DNA and output a message to the user for every letter that isn't A, T, C, or G

DNA = "AGCUUUUCATKCTGACUUNNNAACGGGCAATAUGTCTCTGTHTGGATTAAAAAAAGAGTGTCMGATAGCAGC"

# This is called "Input validation"

# Now that you can validate a user's input, let's learn how to actually ask the user for input. It's pretty simple:

DNA = raw_input('Enter your DNA: ')

# whatever the user writes before pressing enter gets stored in the variable DNA

######## We can also check multiple things at once #########

letter = "A"

if letter=="A" or letter=="G":

print "Purine"

elif letter=="U" or letter=="T" or letter=="C":

print "Pyrimidine"

else:

print "Not a nucleotide"

########################################################################################

##################################### Functions ########################################

########################################################################################

mylist = [1,2,3,4,100]

#built-in functions:

min(mylist)

max(mylist)

sum(mylist)

# General syntax for making your own functions:

def function_name(argument1,argument2,etc): # don't forget the colon

# do something with the arguments

something = argument1+argument2*etc

return something

result = function_name(3,4,2)

# an example:

def double(mylist):

doubled = []

for item in mylist:

doubled.append(item*2)

return doubled

result = double(mylist)

print result

# What happens if we call double() and pass it a string?

# Try it!

# write a function that takes in a list, loops through it, and adds each item to a string

# we saw some code that did that already, so just turn it into a function

# make sure to return the string at the end

########################################################################################

################################### Dictionaries #######################################

########################################################################################

# a dictionary is very useful, it is a data structure (meaning it keeps data organized)

# it has a bunch of key:value pairs just like a real dictionary, every word has a definition

# you can also think of it as a decoder, every key is a code, and every value

# stored with the code is what that code means

my_dictionary = {"key":"value","secondkey":"secondvalue","thirdkey":"thirdvalue"}

print my_dictionary["secondkey"]

print my_dictionary.keys()

print my_dictionary.values()

for key in my_dictionary:

print "Key: %s, Value: %s" % (key,my_dictionary[key])

# notice that the order of the dictionary isn't how we started it

# dictionaries are automatically sorted so they are really fast to search

# we use a key in a dictionary just like we normally use an index in a list or array

# the useful part is when we use the dictionary as a decoder:

mystring = "ABCYSGD"

military = {"A":"Alpha", "B":"Bravo", "C":"Charlie", "D":"Delta"}

for letter in mystring:

print military.get(letter,"Ummm, I don't know what %s is in military speak" % letter)

# remember we did the same thing with if statements before?

# military is a dictionary: the perfect decoder

# .get() is a method that all dictionaries have when they are created,

# the first argument is the key (or the code) and the second is the default

# the default is when the key isn't found

# military["Y"] # gives an error: you can try it

# but military.get("Y","?") # doesn't crash your application

# DNA has a recipe for proteins with the code being each set of three nucleotides

# then this is made into RNA (all the T's become U's)

# (bases or letters: AGA, ACU, GUU, etc.)

# the code "UUA" means the amino acid "L" or "Leucine"

# this website has all the codes, can you make them into a dictionary?

# https://www.manylabs.org/file/lessonMedia/69/geneticCode.png

# Hint: we are gonna use this for the third project!

########################################################################################

############################## File input/output #####################################

########################################################################################

############## INPUT ###############

# open a file

f = open("filename",'r') # 'r' means read

for line in f:

print line

f.close()

############## OUTPUT ###############

f2 = open("filename",'w') # 'w' means write, so you overwrite the file

f2.write("Hello world")

f2.write("\n") # \n means newline, as in pressing enter

for i in xrange(10):

f2.write("%d\t" % i) # \t means tab

f2.close()# close the file safely to make sure the last part you wrote is saved

# once f2 is closed, you can reuse the name

f2 = open("filename2",'a') # 'a' means append, so you add to the file each time

f2.write("Hello world")

f2.write("\n") # \n means newline, as in pressing enter

for i in xrange(10):

f2.write("%d\t" % i) # \t means tab

f2.close()

########################################################################################

###################################### Numpy #########################################

########################################################################################

# Try to find a function that would take the average, like mean(), average(), or avg() can you find one?

# If you want to do something simple and can't find a function for it, you can search online.

# Many of the simple math and science functions are in a module named numpy:

import numpy as np

# np is a common nickname for numpy, so now when you want to use it, you say:

print np.mean(mylist)

# Modules are packages of functions and other useful things, including something called an array

# arrays are a bit like lists, but they are only for numbers,

# that way you can do math on an entire array at once instead of looping through the list and doubling every element like we did before

mylist = [1,2,3,4,100]

myarray = np.array(mylist) # this takes mylist and makes it into an array, once again np is just the nickname for numpy

print "doubling a list:"

print mylist*2

print "doubling an array:"

print myarray*2

# many things we do are easier with arrays, including anything involving math

# An important thing to keep in mind is how to start an empty array if you don't want to just make a list into an array

# if you have a sentence, and you want to save the lengths of all the words:

sentence = "if you have a sentence, and you want to save the lengths of all the words"

# one of many built-in tricks:

words = sentence.split()

# this one looks like a function but flipped around. This is because it's a built-in method for a string.

# sentence is a string, and all strings have a bunch of methods that you can call by doing sentence.methodname()

# Methods are functions that belong to objects, so split() is a method that all strings have when they are created, and you can use them whenever you need to

# Other functions we made don't belong to any particular object, so they are very flexible.

# using a list:

lengths=[]

for word in words:

lengths.append(len(word))

print lengths

# you can then convert this to an array:

lengths=np.array(lengths)

# using an array:

lengths = np.zeros(len(words))

for i in xrange(len(words)):

lengths[i]=len(words[i])

print lengths

# using the array seems harder in this case, but sometimes it might come in handy.

# I usually start with lists and convert them to arrays right before I have to do math on them

######## useful numpy functions ###########

print np.std(myarray)

print np.random.rand(10) # multiply, add, or round to get the random numbers you need

# I want 100 random numbers from 10 up to and including 15, but only integers

print np.floor(np.random.rand(100)*6+10)

# np.floor() rounds down, you can also use np.ceil() to round up, or np.around() to round up or down, whichever is closest (like you learn in school)

# There are tons of numpy modules, just search online.

# Anything you have ever seen in a math class will probably exist in numpy