Create a test for issue biojava#288 sub-optimal MSA

lafita · lafita · commit e449976f578c · 2016-03-08T11:36:45.000+01:00
One of the tests is ignored until issue is fixed.
diff --git a/biojava-alignment/src/test/java/org/biojava/nbio/alignment/TestSubOptimalMSA.java b/biojava-alignment/src/test/java/org/biojava/nbio/alignment/TestSubOptimalMSA.java
@@ -0,0 +1,81 @@
+/*
+ *                    BioJava development code
+ *
+ * This code may be freely distributed and modified under the
+ * terms of the GNU Lesser General Public Licence.  This should
+ * be distributed with the code.  If you do not have a copy,
+ * see:
+ *
+ *      http://www.gnu.org/copyleft/lesser.html
+ *
+ * Copyright for this code is held jointly by the individual
+ * authors.  These should be listed in @author doc comments.
+ *
+ * For more information on the BioJava project and its aims,
+ * or to join the biojava-l mailing list, visit the home page
+ * at:
+ *
+ *      http://www.biojava.org/
+ *
+ */
+package org.biojava.nbio.alignment;
+
+import static org.junit.Assert.*;
+
+import org.biojava.nbio.core.alignment.template.Profile;
+import org.biojava.nbio.core.exceptions.CompoundNotFoundException;
+import org.biojava.nbio.core.sequence.DNASequence;
+import org.biojava.nbio.core.sequence.compound.NucleotideCompound;
+import org.biojava.nbio.core.util.ConcurrencyTools;
+import org.junit.Before;
+import org.junit.Ignore;
+import org.junit.Test;
+
+import java.util.ArrayList;
+import java.util.List;
+
+public class TestSubOptimalMSA {
+	
+	private List<DNASequence> sequences = new ArrayList<DNASequence>();
+	
+	@Before
+	public void setUp() {
+		try {
+			sequences.add(new DNASequence("TTGGGGCCTCTAAACGGGGTCTT"));
+			sequences.add(new DNASequence("TTGGGGCCTCTAAACGGGTCTT"));
+			sequences.add(new DNASequence("TTGGGGCTCTAACGGGTCTT"));
+		} catch (CompoundNotFoundException e) {
+			e.printStackTrace();
+		}
+	}
+
+	@Test
+	public void gapPenalty52() {
+		SimpleGapPenalty gapP = new SimpleGapPenalty((short) 5, (short) 2);
+		Profile<DNASequence, NucleotideCompound> msa = Alignments
+				.getMultipleSequenceAlignment(sequences, gapP);
+		
+		assertEquals("TTGGGGCCTCTAAACGGGGTCTT\n"
+				+ "TTGGGGCCTCTAAACGGG-TCTT\n"
+				+ "TTGGGGC-TCTAA-CGGG-TCTT\n", 
+				msa.toString());
+		
+		ConcurrencyTools.shutdown();
+	}
+	
+	@Test @Ignore
+	public void gapPenaltyDefault() {
+		// Default is currently 10-1
+		SimpleGapPenalty gapP = new SimpleGapPenalty((short) 10, (short) 1);
+		Profile<DNASequence, NucleotideCompound> msa = Alignments
+				.getMultipleSequenceAlignment(sequences, gapP);
+		
+		// TODO test not passing (see issue 288 in github) - Aleix 03.2016
+		assertEquals("TTGGGGCCTCTAAACGGGGTCTT\n"
+				+ "TTGGGGCCTCTAAACGGG-TCTT\n"
+				+ "TTGGGGC-TCTAA-CGGG-TCTT\n", 
+				msa.toString());
+		
+		ConcurrencyTools.shutdown();
+	}
+}
