From 0315e1c40de6324fec3b22ab45442f6409adb7b3 Mon Sep 17 00:00:00 2001 From: halfrost Date: Sun, 21 Jun 2026 16:38:03 -0700 Subject: [PATCH 1/4] add test case --- coverage.txt | 6616 ++++++++--------- .../4. Median of Two Sorted Arrays_test.go | 50 +- .../5. Longest Palindromic Substring_test.go | 5 + .../8. String to Integer atoi_test.go | 15 + .../9. Palindrome Number_test.go | 14 +- .../13. Roman to Integer_test.go | 13 +- .../16. 3Sum Closest_test.go | 24 +- ...ter Combinations of a Phone Number_test.go | 24 +- leetcode/0018.4Sum/18. 4Sum_test.go | 56 +- .... Remove Nth Node From End of List_test.go | 8 + .../22. Generate Parentheses_test.go | 4 + ...emove Duplicates from Sorted Array_test.go | 34 +- .../27. Remove Element_test.go | 5 + .../29. Divide Two Integers.go | 11 +- .../29. Divide Two Integers_test.go | 36 +- ...33. Search in Rotated Sorted Array_test.go | 28 +- ...osition of Element in Sorted Array_test.go | 15 + .../0036.Valid-Sudoku/36. Valid Sudoku.go | 4 +- .../36. Valid Sudoku_test.go | 71 +- .../37. Sudoku Solver_test.go | 12 + .../39. Combination Sum_test.go | 5 + .../40. Combination Sum II_test.go | 5 + .../43. Multiply Strings_test.go | 13 +- .../45. Jump Game II_test.go | 18 +- .../46. Permutations_test.go | 5 + .../47. Permutations II_test.go | 5 + .../48. Rotate Image_test.go | 5 + leetcode/0050.Powx-n/50. Pow(x, n)_test.go | 5 + .../53. Maximum Subarray_test.go | 9 +- .../0054.Spiral-Matrix/54. Spiral Matrix.go | 3 - .../54. Spiral Matrix_test.go | 37 +- leetcode/0055.Jump-Game/55. Jump Game_test.go | 16 +- .../56. Merge Intervals_test.go | 1 + .../58.Length of Last Word_test.go | 13 +- .../59. Spiral Matrix II.go | 3 - .../59. Spiral Matrix II_test.go | 15 + .../60. Permutation Sequence_test.go | 13 +- .../0061.Rotate-List/61. Rotate List_test.go | 5 + .../63. Unique Paths II_test.go | 21 +- .../64. Minimum Path Sum_test.go | 38 +- .../65. Valid Number_test.go | 15 + .../0067.Add-Binary/67. Add Binary_test.go | 5 + .../73. Set Matrix Zeroes_test.go | 14 + .../74. Search a 2D Matrix_test.go | 5 + .../76. Minimum Window Substring_test.go | 13 +- .../77. Combinations_test.go | 4 + ... Search in Rotated Sorted Array II_test.go | 43 +- ...ove Duplicates from Sorted List II_test.go | 1 + ...Remove Duplicates from Sorted List_test.go | 10 + .../86. Partition List_test.go | 5 + .../93. Restore IP Addresses_test.go | 5 + .../95. Unique Binary Search Trees II_test.go | 5 + .../97. Interleaving String_test.go | 13 +- .../104. Maximum Depth of Binary Tree_test.go | 13 +- ...nvert Sorted List to Binary Search Tree.go | 3 - ... Sorted List to Binary Search Tree_test.go | 9 + .../111. Minimum Depth of Binary Tree_test.go | 5 + .../0113.Path-Sum-II/113. Path Sum II_test.go | 15 +- ...Flatten Binary Tree to Linked List_test.go | 21 +- .../115. Distinct Subsequences_test.go | 11 +- ...g Next Right Pointers in Each Node_test.go | 4 + leetcode/0120.Triangle/120. Triangle_test.go | 32 +- .../126. Word Ladder II_test.go | 6 + .../130. Surrounded Regions_test.go | 31 +- .../131. Palindrome Partitioning_test.go | 5 + .../141. Linked List Cycle_test.go | 31 +- .../142. Linked List Cycle II_test.go | 63 +- .../0146.LRU-Cache/146. LRU Cache_test.go | 20 + .../0148.Sort-List/148. Sort List_test.go | 9 + .... Evaluate Reverse Polish Notation_test.go | 4 + ...nd Minimum in Rotated Sorted Array_test.go | 24 +- .../162. Find Peak Element_test.go | 13 +- ...Two Sum II - Input array is sorted_test.go | 23 +- .../169. Majority Element_test.go | 17 +- .../174. Dungeon Game_test.go | 10 +- .../187. Repeated DNA Sequences_test.go | 4 + .../198. House Robber_test.go | 23 +- .../200. Number of Islands_test.go | 18 +- .../205. Isomorphic Strings_test.go | 10 + .../208. Implement Trie (Prefix Tree)_test.go | 10 + .../209. Minimum Size Subarray Sum_test.go | 12 +- ...dd and Search Words Data Structure_test.go | 2 + .../213. House Robber II_test.go | 8 + .../216. Combination Sum III_test.go | 4 + .../218. The Skyline Problem_test.go | 32 + .../219. Contains Duplicate II_test.go | 18 +- .../220. Contains Duplicate III_test.go | 43 +- .../223. Rectangle Area_test.go | 12 +- .../224. Basic Calculator_test.go | 24 + .../229. Majority Element II_test.go | 10 + .../232. Implement Queue using Stacks_test.go | 10 + .../234. Palindrome Linked List_test.go | 9 + ...n Ancestor of a Binary Search Tree_test.go | 19 +- ...t Common Ancestor of a Binary Tree_test.go | 21 +- .../239. Sliding Window Maximum_test.go | 22 +- .../240. Search a 2D Matrix II_test.go | 17 +- leetcode/0274.H-Index/274. H-Index.go | 7 +- .../279. Perfect Squares_test.go | 8 + .../0283.Move-Zeroes/283. Move Zeroes_test.go | 5 + .../284. Peeking Iterator_test.go | 47 + .../287. Find the Duplicate Number_test.go | 18 +- .../290. Word Pattern_test.go | 5 + .../299.Bulls and Cows_test.go | 13 +- ...00. Longest Increasing Subsequence_test.go | 14 +- ...04. Range Sum Query 2D - Immutable_test.go | 5 + .../306. Additive Number_test.go | 33 +- ...15. Count of Smaller Numbers After Self.go | 7 +- ...ount of Smaller Numbers After Self_test.go | 22 +- ...8. Maximum Product of Word Lengths_test.go | 5 + .../324. Wiggle Sort II_test.go | 4 + .../327. Count of Range Sum.go | 9 +- .../327. Count of Range Sum_test.go | 8 + .../341. Flatten Nested List Iterator.go | 14 +- .../341. Flatten Nested List Iterator_test.go | 64 +- ....Data Stream as Disjoint Intervals_test.go | 3 + .... Count Numbers with Unique Digits_test.go | 23 +- .../368. Largest Divisible Subset_test.go | 10 + .../371. Sum of Two Integers_test.go | 18 +- .../0372.Super-Pow/372. Super Pow_test.go | 6 +- ...3. Find K Pairs with Smallest Sums_test.go | 5 + .../376. Wiggle Subsequence_test.go | 5 + .../377. Combination Sum IV_test.go | 17 +- ...mallest Element in a Sorted Matrix_test.go | 22 +- .../0383.Ransom-Note/383.Ransom Note_test.go | 5 + .../0385.Mini-Parser/385. Mini Parser_test.go | 28 +- ...First Unique Character in a String_test.go | 14 +- .../390. Elimination Game_test.go | 13 +- .../391.Perfect Rectangle_test.go | 13 +- .../393. UTF-8 Validation_test.go | 18 + ...th At Least K Repeating Characters_test.go | 12 +- .../397. Integer Replacement_test.go | 5 + .../399. Evaluate Division.go | 12 +- .../399. Evaluate Division_test.go | 20 +- .../401. Binary Watch_test.go | 8 + ...5. Convert a Number to Hexadecimal_test.go | 10 +- .../410. Split Array Largest Sum_test.go | 4 + .../0412.Fizz-Buzz/412. Fizz Buzz_test.go | 5 + .../413. Arithmetic Slices_test.go | 15 +- .../417. Pacific Atlantic Water Flow_test.go | 5 + .../419. Battleships in a Board_test.go | 18 +- ...mum XOR of Two Numbers in an Array_test.go | 12 +- .... N-ary Tree Level Order Traversal_test.go | 55 +- .../433. Minimum Genetic Mutation.go | 9 +- .../435. Non-overlapping Intervals_test.go | 47 +- .../436. Find Right Interval_test.go | 17 +- .../437. Path Sum III_test.go | 13 +- .../441. Arranging Coins_test.go | 14 +- .../445. Add Two Numbers II_test.go | 5 + .../451. Sort Characters By Frequency_test.go | 5 + .../0460.LFU-Cache/460. LFU Cache_test.go | 38 + .../473. Matchsticks to Square_test.go | 10 + .../474. Ones and Zeroes_test.go | 5 + ... Generate Random Point in a Circle_test.go | 7 + .../480. Sliding Window Median.go | 5 - .../480. Sliding Window Median_test.go | 30 +- .../491. Non-decreasing Subsequences_test.go | 5 + .../0493.Reverse-Pairs/493. Reverse Pairs.go | 6 +- .../493. Reverse Pairs_test.go | 32 +- leetcode/0494.Target-Sum/494. Target Sum.go | 2 +- .../0494.Target-Sum/494. Target Sum_test.go | 16 +- .../496. Next Greater Element I_test.go | 5 + ...dom Point in Non-overlapping Rectangles.go | 6 +- ...oint in Non-overlapping Rectangles_test.go | 35 + .../498. Diagonal Traverse_test.go | 23 +- .../500. Keyboard Row_test.go | 5 + leetcode/0504.Base-7/504.Base 7_test.go | 13 +- .../507. Perfect Number_test.go | 5 + .../509. Fibonacci Number_test.go | 5 + .../525. Contiguous Array_test.go | 5 + .../526. Beautiful Arrangement_test.go | 17 +- .../528. Random Pick with Weight_test.go | 15 + ...Minimum Absolute Difference in BST_test.go | 5 + ...0.Single Element in a Sorted Array_test.go | 13 +- .../541. Reverse String II_test.go | 13 +- .../0542.01-Matrix/542. 01 Matrix_test.go | 33 +- .../547. Number of Provinces_test.go | 17 +- .../559.Maximum Depth of N-ary Tree_test.go | 13 +- .../566. Reshape the Matrix_test.go | 5 + .../572. Subtree of Another Tree_test.go | 13 +- ...589. N-ary Tree Preorder Traversal_test.go | 8 + ...94. Longest Harmonious Subsequence_test.go | 5 + .../622. Design Circular Queue_test.go | 47 + .... Maximum Product of Three Numbers_test.go | 42 +- .../630. Course Schedule III_test.go | 12 +- .../648. Replace Words_test.go | 17 +- .../658. Find K Closest Elements_test.go | 18 +- .../662. Maximum Width of Binary Tree.go | 9 +- .../665. Non-decreasing Array_test.go | 5 + ... Continuous Increasing Subsequence_test.go | 13 +- .../677. Map Sum Pairs_test.go | 9 + .../684. Redundant Connection_test.go | 5 + .../685. Redundant Connection II_test.go | 10 + .../690. Employee Importance_test.go | 13 +- .../696. Count Binary Substrings_test.go | 10 + .../706. Design HashMap_test.go | 41 + .../707. Design Linked List_test.go | 27 + .../710. Random Pick with Blacklist_test.go | 5 + .../713. Subarray Product Less Than K_test.go | 18 +- ...aximum Length of Repeated Subarray_test.go | 20 +- .../726. Number of Atoms_test.go | 13 +- .../729. My Calendar I_test.go | 11 + .../732. My Calendar III_test.go | 3 + .../0733.Flood-Fill/733. Flood Fill_test.go | 49 +- .../745. Prefix and Suffix Search_test.go | 9 + .../752. Open the Lock_test.go | 15 + .../765. Couples Holding Hands_test.go | 5 + .../767. Reorganize String_test.go | 5 + ...Minimum Distance Between BST Nodes_test.go | 5 + .../784. Letter Case Permutation_test.go | 5 + .../786. K-th Smallest Prime Fraction_test.go | 16 +- ... Size of Factorial Zeroes Function_test.go | 11 +- .../794.Valid Tic-Tac-Toe State_test.go | 12 + .../803. Bricks Falling When Hit_test.go | 5 + .../810. Chalkboard XOR Game_test.go | 5 + .../811. Subdomain Visit Count_test.go | 15 + .../0815.Bus-Routes/815. Bus Routes_test.go | 15 +- .../817. Linked List Components_test.go | 5 + .../819. Most Common Word_test.go | 5 + .../820. Short Encoding of Words_test.go | 28 +- .../825. Friends Of Appropriate Ages.go | 3 - .../825. Friends Of Appropriate Ages_test.go | 21 +- .../826. Most Profit Assigning Work_test.go | 13 +- ...f All Substrings of a Given String_test.go | 11 +- ...plit Array into Fibonacci Sequence_test.go | 5 + .../850. Rectangle Area II.go | 6 + .../850. Rectangle Area II_test.go | 47 + .../852. Peak Index in a Mountain Array.go | 7 +- ...52. Peak Index in a Mountain Array_test.go | 17 +- .../0853.Car-Fleet/853. Car Fleet_test.go | 8 + .../859.Buddy Strings_test.go | 15 + ...ll Nodes Distance K in Binary Tree_test.go | 75 +- .../872. Leaf-Similar Trees_test.go | 16 +- .../880. Decoded String at Index_test.go | 5 + .../890. Find and Replace Pattern_test.go | 5 + .../896. Monotonic Array_test.go | 10 + .../909. Snakes and Ladders.go | 5 +- .../909. Snakes and Ladders_test.go | 17 +- ...imum Add to Make Parentheses Valid_test.go | 5 + .../923. 3Sum With Multiplicity_test.go | 5 + .../924. Minimize Malware Spread_test.go | 15 +- .../925. Long Pressed Name_test.go | 23 +- .../927. Three Equal Parts_test.go | 20 + .../928. Minimize Malware Spread II.go | 3 - .../928. Minimize Malware Spread II_test.go | 18 +- .../933. Number of Recent Calls.go | 3 - ...st Component Size by Common Factor_test.go | 11 +- ...953. Verifying an Alien Dictionary_test.go | 5 + ...-Repeated Element in Size 2N Array_test.go | 5 + .../968. Binary Tree Cameras_test.go | 13 +- .../969. Pancake Sorting_test.go | 5 + .../970. Powerful Integers_test.go | 15 + .../978. Longest Turbulent Subarray_test.go | 25 +- .../984. String Without AAA or BBB_test.go | 15 + ...tisfiability of Equality Equations_test.go | 5 + .../993. Cousins in Binary Tree_test.go | 26 +- .../996. Number of Squareful Arrays.go | 16 +- .../996. Number of Squareful Arrays_test.go | 5 + .../997.Find the Town Judge_test.go | 5 + ... Word Is Valid After Substitutions_test.go | 10 + ...ity To Ship Packages Within D Days_test.go | 5 + .../1017. Convert to Base -2_test.go | 5 + ...Sum of Root To Leaf Binary Numbers_test.go | 5 + ...ver a Tree From Preorder Traversal_test.go | 5 + ...Moving Stones Until Consecutive II_test.go | 5 + .../1054. Distant Barcodes_test.go | 5 + ...073. Adding Two Negabinary Numbers_test.go | 5 + .../1078. Occurrences After Bigram_test.go | 5 + ...91. Shortest Path in Binary Matrix_test.go | 24 +- ...10. Delete Nodes And Return Forest_test.go | 8 + ... Number of Equivalent Domino Pairs_test.go | 20 +- .../1143. Longest Common Subsequence_test.go | 5 + ...nline Majority Element In Subarray_test.go | 6 + ...Consecutive Nodes from Linked List_test.go | 5 + .../1189. Maximum Number of Balloons_test.go | 5 + .... Maximum Profit in Job Scheduling_test.go | 5 + ...ated String with Unique Characters_test.go | 5 + .../1254. Number of Closed Islands_test.go | 18 +- ... Find Winner on a Tic Tac Toe Game_test.go | 44 +- ...ring More Than 25% In Sorted Array_test.go | 13 +- ...th in a Grid with Obstacles Elimination.go | 7 - ...m Points You Can Obtain from Cards_test.go | 5 + ...allest Sum of a Matrix With Sorted Rows.go | 2 +- ...t Sum of a Matrix With Sorted Rows_test.go | 24 +- .../1446.Consecutive Characters_test.go | 13 +- ...After Horizontal and Vertical Cuts_test.go | 5 + .../1603. Design Parking System_test.go | 7 + ...X Elements Greater Than or Equal X_test.go | 5 + .../1609.Even Odd Tree_test.go | 31 + .../1631. Path With Minimum Effort_test.go | 20 +- ...2. Furthest Building You Can Reach_test.go | 18 +- ...reate Sorted Array through Instructions.go | 6 +- ... Sorted Array through Instructions_test.go | 14 +- .../1652. Defuse the Bomb_test.go | 5 + ...mum Operations to Reduce X to Zero_test.go | 18 +- .../1659. Maximize Grid Happiness_test.go | 5 + ...llest String With A Given Numeric Value.go | 5 +- ... String With A Given Numeric Value_test.go | 12 +- ...mum Initial Energy to Finish Tasks_test.go | 1 + .../1668. Maximum Repeating Substring.go | 8 +- ...70. Design Front Middle Back Queue_test.go | 20 + .../1675. Minimize Deviation in Array_test.go | 5 + .../1678. Goal Parser Interpretation_test.go | 5 + .../1681. Minimum Incompatibility.go | 5 +- ...Maximum Height by Stacking Cuboids_test.go | 5 + .../1695. Maximum Erasure Value_test.go | 5 + .../1696. Jump Game VI_test.go | 11 +- ...705.Maximum Number of Eaten Apples_test.go | 23 +- ...st Time by Replacing Hidden Digits_test.go | 23 +- ...d Kth Largest XOR Coordinate Value_test.go | 8 + ...8. Minimum Absolute Sum Difference_test.go | 13 +- .../2043.Simple Bank System_test.go | 6 + ...From a Binary Tree Node to Another_test.go | 5 + ...est Value of the Rearranged Number_test.go | 5 + ...ions to Make the Array Alternating_test.go | 24 + ...2181. Merge Nodes in Between Zeros_test.go | 5 + .../132. Palindrome Partitioning II_test.go | 28 +- ... Data Stream as Disjoint Intervals_test.go | 28 + .../975. Odd Even Jump.go | 8 +- 318 files changed, 7296 insertions(+), 3751 deletions(-) diff --git a/coverage.txt b/coverage.txt index 512b2d735..dbceaf8f0 100644 --- a/coverage.txt +++ b/coverage.txt @@ -4,59 +4,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0001.Two-Sum/1. Two Sum.go:5.25,6.33 1 github.com/halfrost/LeetCode-Go/leetcode/0001.Two-Sum/1. Two Sum.go:6.33,8.4 1 4 github.com/halfrost/LeetCode-Go/leetcode/0001.Two-Sum/1. Two Sum.go:9.3,9.11 1 9 github.com/halfrost/LeetCode-Go/leetcode/0001.Two-Sum/1. Two Sum.go:11.2,11.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:3.32,5.18 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:5.18,8.34 3 9 -github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:8.34,11.4 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:11.9,14.4 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:16.3,17.17 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:17.17,19.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:21.2,21.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:3.27,5.22 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:5.22,6.36 1 26 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:6.36,7.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:9.3,9.18 1 23 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:9.18,10.16 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:10.16,13.13 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:14.10,14.23 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:14.23,18.13 4 2 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:21.3,21.25 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:21.25,22.9 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:24.3,25.37 2 19 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:27.2,30.27 4 5 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:30.27,31.13 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:31.13,33.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:33.9,34.9 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:37.2,37.28 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:37.28,39.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:40.2,41.14 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:41.14,43.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:43.8,45.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:46.2,47.40 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:47.40,50.41 3 19 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:50.41,52.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:54.2,55.17 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:6.31,7.11 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:7.11,9.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:10.2,10.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:10.12,12.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:13.2,13.15 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:13.15,15.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:16.2,17.12 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:17.12,20.3 2 16 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:21.2,22.47 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:22.47,23.23 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:23.23,25.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:27.2,27.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:31.32,32.11 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:32.11,34.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:35.2,35.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:35.12,37.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:38.2,40.33 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:40.33,41.28 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:41.28,43.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:45.2,45.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:4.41,5.16 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:5.16,7.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:4.41,5.16 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:5.16,7.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:8.2,10.22 3 5 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:10.22,13.3 2 867 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:19.2,20.33 2 5 @@ -72,8 +21,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. L github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:46.24,47.11 1 919 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:47.11,49.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:50.2,50.10 1 918 -github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:54.42,55.17 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:55.17,57.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:54.42,55.17 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:55.17,57.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:58.2,59.20 2 6 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:59.20,61.49 1 864 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:61.49,63.4 1 61 @@ -83,57 +32,70 @@ github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. L github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:69.25,71.4 1 6 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:73.3,74.15 2 864 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:76.2,76.21 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:80.42,82.30 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:80.42,82.30 2 7 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:82.30,85.3 2 868 -github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:86.2,86.12 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:86.2,86.12 1 7 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:89.59,91.43 2 1736 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:91.43,95.3 3 1387 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:96.2,96.25 1 1736 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:96.25,98.3 1 12 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:99.2,99.12 1 1724 -github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:103.42,105.30 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:103.42,105.30 2 7 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:105.30,107.3 1 868 -github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:108.2,108.35 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:108.2,108.35 1 7 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:108.35,109.31 1 868 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:109.31,111.51 2 365117 github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:111.51,113.5 1 436 -github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:116.2,116.12 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:18.58,21.43 3 8 -github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:21.43,22.16 1 29 -github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:22.16,24.4 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:24.9,27.4 2 22 -github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:28.3,28.16 1 29 -github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:28.16,30.4 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:30.9,33.4 2 21 -github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:34.3,36.33 3 29 -github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:38.2,38.18 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:3.63,5.29 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:5.29,7.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:8.2,9.18 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:9.18,14.58 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:14.58,16.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:16.9,16.75 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:16.75,18.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:18.9,21.9 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:24.2,25.19 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:25.19,27.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:27.8,27.26 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:27.26,29.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:29.8,31.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:32.2,32.36 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:32.36,34.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:35.2,35.28 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:35.28,37.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:37.8,37.35 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:37.35,39.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:39.8,41.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:42.2,42.38 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:45.28,46.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:46.11,48.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:49.2,49.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:52.28,53.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:53.11,55.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:56.2,56.10 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring.go:116.2,116.12 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:3.27,5.22 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:5.22,6.36 1 44 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:6.36,7.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:9.3,9.18 1 41 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:9.18,10.16 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:10.16,13.13 3 1 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:14.10,14.23 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:14.23,18.13 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:21.3,21.25 1 38 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:21.25,22.9 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:24.3,25.37 2 36 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:27.2,30.27 4 8 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:30.27,31.13 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:31.13,33.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:33.9,34.9 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:37.2,37.28 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:37.28,39.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:40.2,41.14 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:41.14,43.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:43.8,45.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:46.2,47.40 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:47.40,50.41 3 34 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:50.41,52.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi.go:54.2,55.17 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:6.31,7.11 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:7.11,9.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:10.2,10.12 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:10.12,12.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:13.2,13.15 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:13.15,15.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:16.2,17.12 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:17.12,20.3 2 32 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:21.2,22.47 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:22.47,23.23 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:23.23,25.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:27.2,27.13 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:31.32,32.11 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:32.11,34.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:35.2,35.12 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:35.12,37.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:38.2,40.33 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:40.33,41.28 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:41.28,43.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0009.Palindrome-Number/9. Palindrome Number.go:45.2,45.13 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:3.26,5.13 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:5.13,8.3 2 19 +github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:9.2,9.37 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:9.37,11.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:12.2,12.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters.go:4.45,5.17 1 4 github.com/halfrost/LeetCode-Go/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters.go:5.17,7.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters.go:8.2,10.20 3 3 @@ -161,6 +123,49 @@ github.com/halfrost/LeetCode-Go/leetcode/0003.Longest-Substring-Without-Repeatin github.com/halfrost/LeetCode-Go/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters.go:66.28,67.11 1 57 github.com/halfrost/LeetCode-Go/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters.go:67.11,69.3 1 25 github.com/halfrost/LeetCode-Go/leetcode/0003.Longest-Substring-Without-Repeating-Characters/3. Longest Substring Without Repeating Characters.go:70.2,70.10 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:18.58,21.43 3 8 +github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:21.43,22.16 1 29 +github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:22.16,24.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:24.9,27.4 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:28.3,28.16 1 29 +github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:28.16,30.4 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:30.9,33.4 2 21 +github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:34.3,36.33 3 29 +github.com/halfrost/LeetCode-Go/leetcode/0002.Add-Two-Numbers/2. Add Two Numbers.go:38.2,38.18 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:3.32,5.18 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:5.18,8.34 3 9 +github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:8.34,11.4 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:11.9,14.4 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:16.3,17.17 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:17.17,19.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0011.Container-With-Most-Water/11. Container With Most Water.go:21.2,21.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:3.63,5.29 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:5.29,7.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:8.2,9.18 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:9.18,14.58 3 14 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:14.58,16.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:16.9,16.75 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:16.75,18.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:18.9,21.9 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:24.2,25.19 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:25.19,27.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:27.8,27.26 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:27.26,29.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:29.8,31.3 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:32.2,32.36 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:32.36,34.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:35.2,35.28 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:35.28,37.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:37.8,37.35 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:37.35,39.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:39.8,41.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:42.2,42.38 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:45.28,46.11 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:46.11,48.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:49.2,49.10 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:52.28,53.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:53.11,55.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays.go:56.2,56.10 1 1 github.com/halfrost/LeetCode-Go/leetcode/0006.ZigZag-Conversion/6. ZigZag Conversion.go:3.44,5.27 2 3 github.com/halfrost/LeetCode-Go/leetcode/0006.ZigZag-Conversion/6. ZigZag Conversion.go:5.27,6.22 1 34 github.com/halfrost/LeetCode-Go/leetcode/0006.ZigZag-Conversion/6. ZigZag Conversion.go:6.22,10.4 3 22 @@ -171,18 +176,13 @@ github.com/halfrost/LeetCode-Go/leetcode/0006.ZigZag-Conversion/6. ZigZag Conver github.com/halfrost/LeetCode-Go/leetcode/0006.ZigZag-Conversion/6. ZigZag Conversion.go:20.29,21.28 1 8 github.com/halfrost/LeetCode-Go/leetcode/0006.ZigZag-Conversion/6. ZigZag Conversion.go:21.28,23.4 1 29 github.com/halfrost/LeetCode-Go/leetcode/0006.ZigZag-Conversion/6. ZigZag Conversion.go:25.2,25.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:3.26,5.13 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:5.13,8.3 2 19 -github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:9.2,9.37 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:9.37,11.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0007.Reverse-Integer/7. Reverse Integer.go:12.2,12.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/0012.Integer-to-Roman/12. Integer to Roman.go:3.33,7.15 4 7 github.com/halfrost/LeetCode-Go/leetcode/0012.Integer-to-Roman/12. Integer to Roman.go:7.15,8.23 1 23 github.com/halfrost/LeetCode-Go/leetcode/0012.Integer-to-Roman/12. Integer to Roman.go:8.23,10.4 1 75 github.com/halfrost/LeetCode-Go/leetcode/0012.Integer-to-Roman/12. Integer to Roman.go:11.3,12.20 2 23 github.com/halfrost/LeetCode-Go/leetcode/0012.Integer-to-Roman/12. Integer to Roman.go:14.2,14.12 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0013.Roman-to-Integer/13. Roman to Integer.go:13.31,14.13 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0013.Roman-to-Integer/13. Roman to Integer.go:14.13,16.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0013.Roman-to-Integer/13. Roman to Integer.go:13.31,14.13 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0013.Roman-to-Integer/13. Roman to Integer.go:14.13,16.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0013.Roman-to-Integer/13. Roman to Integer.go:17.2,18.30 2 6 github.com/halfrost/LeetCode-Go/leetcode/0013.Roman-to-Integer/13. Roman to Integer.go:18.30,21.20 3 28 github.com/halfrost/LeetCode-Go/leetcode/0013.Roman-to-Integer/13. Roman to Integer.go:21.20,23.4 1 8 @@ -223,119 +223,119 @@ github.com/halfrost/LeetCode-Go/leetcode/0015.3Sum/15. 3Sum.go:62.68,64.5 1 4 github.com/halfrost/LeetCode-Go/leetcode/0015.3Sum/15. 3Sum.go:65.4,66.41 2 158 github.com/halfrost/LeetCode-Go/leetcode/0015.3Sum/15. 3Sum.go:66.41,68.5 1 26 github.com/halfrost/LeetCode-Go/leetcode/0015.3Sum/15. 3Sum.go:71.2,71.12 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:9.50,11.11 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:11.11,13.28 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:13.28,14.37 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:14.37,15.13 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:17.4,17.33 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:17.33,19.31 2 14 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:19.31,21.6 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:22.5,22.22 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:22.22,24.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:24.11,24.28 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:9.50,11.11 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:11.11,13.28 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:13.28,14.37 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:14.37,15.13 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:17.4,17.33 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:17.33,19.31 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:19.31,21.6 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:22.5,22.22 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:22.22,24.6 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:24.11,24.28 1 21 github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:24.28,26.6 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:26.11,28.6 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:32.2,32.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:36.51,38.33 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:38.33,39.38 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:39.38,40.39 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:40.39,41.57 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:26.11,28.6 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:32.2,32.12 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:36.51,38.33 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:38.33,39.38 1 28 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:39.38,40.39 1 44 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:40.39,41.57 1 34 github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:41.57,44.6 2 13 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:48.2,48.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:51.21,52.11 1 59 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:48.2,48.12 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:51.21,52.11 1 86 github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:52.11,54.3 1 22 -github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:55.2,55.11 1 37 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:21.49,22.18 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:22.18,24.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0016.3Sum-Closest/16. 3Sum Closest.go:55.2,55.11 1 64 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:21.49,22.18 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:22.18,24.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:25.2,27.12 3 2 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:30.59,31.27 1 17 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:31.27,34.3 2 12 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:35.2,37.35 3 5 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:37.35,39.3 1 15 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:40.2,40.8 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:44.50,45.18 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:45.18,47.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:48.2,51.35 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:51.35,52.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:52.20,54.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:55.3,55.33 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:55.33,57.4 1 27 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:59.2,63.16 5 1 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:63.16,66.3 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:67.2,67.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:83.51,85.18 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:85.18,87.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:44.50,45.18 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:45.18,47.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:48.2,51.35 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:51.35,52.20 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:52.20,54.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:55.3,55.33 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:55.33,57.4 1 30 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:59.2,63.16 5 2 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:63.16,66.3 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:67.2,67.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:83.51,85.18 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:85.18,87.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:88.2,89.15 2 1 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:92.44,93.18 1 13 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:93.18,96.3 2 9 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:97.2,99.36 3 4 github.com/halfrost/LeetCode-Go/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number.go:99.36,103.3 3 12 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:6.60,9.78 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:9.78,10.86 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:10.86,11.12 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:13.3,13.81 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:13.81,14.87 1 42 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:6.60,9.78 3 9 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:9.78,10.86 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:10.86,11.12 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:13.3,13.81 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:13.81,14.87 1 46 github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:14.87,15.13 1 29 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:17.4,17.47 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:17.47,18.75 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:18.75,20.69 2 13 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:20.70,21.7 0 18 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:22.6,22.73 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:22.74,23.7 0 0 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:24.11,24.28 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:24.28,26.6 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:17.4,17.47 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:17.47,18.75 1 37 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:18.75,20.69 2 17 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:20.70,21.7 0 19 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:22.6,22.73 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:22.74,23.7 0 1 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:24.11,24.28 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:24.28,26.6 1 15 github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:26.11,28.6 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:32.2,32.8 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:36.47,41.2 4 5 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:43.84,44.82 1 64 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:44.82,46.3 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:47.2,47.12 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:47.12,50.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:50.8,51.37 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:51.37,52.55 1 118 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:52.55,57.5 4 59 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:63.79,64.19 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:64.19,66.20 2 39 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:66.20,75.51 8 13 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:75.51,77.5 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:78.4,78.53 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:78.53,80.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:81.9,81.26 1 26 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:81.26,83.4 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:83.9,85.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:90.47,93.29 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:93.29,95.3 1 38 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:97.2,98.27 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:98.27,100.3 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:101.2,103.37 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:103.37,104.61 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:104.61,106.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:107.3,107.42 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:107.42,108.73 1 36 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:32.2,32.8 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:36.47,41.2 4 9 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:43.84,44.82 1 91 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:44.82,46.3 1 46 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:47.2,47.12 1 45 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:47.12,50.3 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:50.8,51.37 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:51.37,52.55 1 157 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:52.55,57.5 4 82 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:63.79,64.19 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:64.19,66.20 2 46 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:66.20,75.51 8 17 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:75.51,77.5 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:78.4,78.53 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:78.53,80.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:81.9,81.26 1 29 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:81.26,83.4 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:83.9,85.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:90.47,93.29 3 9 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:93.29,95.3 1 60 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:97.2,98.27 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:98.27,100.3 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:101.2,103.37 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:103.37,104.61 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:104.61,106.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:107.3,107.42 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:107.42,108.73 1 49 github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:108.73,110.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:111.4,111.73 1 36 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:111.4,111.73 1 49 github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:111.73,113.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:114.4,114.103 1 36 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:114.103,116.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:117.4,117.43 1 36 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:117.43,118.86 1 34 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:118.86,120.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:121.5,121.86 1 34 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:114.4,114.103 1 49 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:114.103,116.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:117.4,117.43 1 49 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:117.43,118.86 1 40 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:118.86,120.6 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:121.5,121.86 1 40 github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:121.86,123.6 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:124.5,124.86 1 34 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:124.5,124.86 1 40 github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:124.86,126.6 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:127.5,128.42 2 34 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:127.5,128.42 2 40 github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:128.42,130.6 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:134.2,134.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0018.4Sum/18. 4Sum.go:134.2,134.12 1 9 github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:19.56,22.18 3 9 github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:22.18,23.13 1 34 github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:23.13,26.4 2 10 github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:27.3,28.19 2 34 github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:30.2,31.23 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:35.57,36.17 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:36.17,38.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:39.2,39.12 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:39.12,41.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:35.57,36.17 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:36.17,38.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:39.2,39.12 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:39.12,41.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:42.2,44.21 3 9 github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:44.21,47.3 2 34 github.com/halfrost/LeetCode-Go/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List.go:48.2,48.13 1 9 @@ -363,8 +363,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0021.Merge-Two-Sorted-Lists/21. Merge T github.com/halfrost/LeetCode-Go/leetcode/0021.Merge-Two-Sorted-Lists/21. Merge Two Sorted Lists.go:24.2,24.21 1 27 github.com/halfrost/LeetCode-Go/leetcode/0021.Merge-Two-Sorted-Lists/21. Merge Two Sorted Lists.go:24.21,27.3 2 13 github.com/halfrost/LeetCode-Go/leetcode/0021.Merge-Two-Sorted-Lists/21. Merge Two Sorted Lists.go:28.2,29.11 2 14 -github.com/halfrost/LeetCode-Go/leetcode/0022.Generate-Parentheses/22. Generate Parentheses.go:3.42,4.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0022.Generate-Parentheses/22. Generate Parentheses.go:4.12,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0022.Generate-Parentheses/22. Generate Parentheses.go:3.42,4.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0022.Generate-Parentheses/22. Generate Parentheses.go:4.12,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0022.Generate-Parentheses/22. Generate Parentheses.go:7.2,9.12 3 1 github.com/halfrost/LeetCode-Go/leetcode/0022.Generate-Parentheses/22. Generate Parentheses.go:12.77,13.32 1 22 github.com/halfrost/LeetCode-Go/leetcode/0022.Generate-Parentheses/22. Generate Parentheses.go:13.32,16.3 2 5 @@ -395,32 +395,32 @@ github.com/halfrost/LeetCode-Go/leetcode/0025.Reverse-Nodes-in-k-Group/25. Rever github.com/halfrost/LeetCode-Go/leetcode/0025.Reverse-Nodes-in-k-Group/25. Reverse Nodes in k Group.go:30.57,32.20 2 6 github.com/halfrost/LeetCode-Go/leetcode/0025.Reverse-Nodes-in-k-Group/25. Reverse Nodes in k Group.go:32.20,37.3 4 8 github.com/halfrost/LeetCode-Go/leetcode/0025.Reverse-Nodes-in-k-Group/25. Reverse Nodes in k Group.go:38.2,38.13 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:4.39,5.20 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:5.20,7.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:4.39,5.20 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:5.20,7.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:8.2,9.25 2 4 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:9.25,10.34 1 8 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:10.34,12.27 2 18 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:12.27,14.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:16.3,17.9 2 5 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:19.2,19.17 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:23.40,24.20 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:24.20,26.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:23.40,24.20 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:24.20,26.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:27.2,30.31 4 4 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:30.31,31.25 1 8 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:31.25,32.9 1 3 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:34.3,34.27 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:34.27,37.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:34.27,37.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:39.2,39.14 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:42.53,43.20 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:43.20,45.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:46.2,47.37 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:47.37,48.21 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:48.21,49.14 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:49.14,52.5 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:52.10,54.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:57.2,57.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0027.Remove-Element/27. Remove Element.go:3.45,4.20 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0027.Remove-Element/27. Remove Element.go:4.20,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:42.53,43.20 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:43.20,45.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:46.2,47.37 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:47.37,48.21 1 24 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:48.21,49.14 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:49.14,52.5 2 16 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:52.10,54.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array.go:57.2,57.10 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0027.Remove-Element/27. Remove Element.go:3.45,4.20 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0027.Remove-Element/27. Remove Element.go:4.20,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0027.Remove-Element/27. Remove Element.go:7.2,8.33 2 6 github.com/halfrost/LeetCode-Go/leetcode/0027.Remove-Element/27. Remove Element.go:8.33,9.21 1 33 github.com/halfrost/LeetCode-Go/leetcode/0027.Remove-Element/27. Remove Element.go:9.21,10.14 1 13 @@ -436,42 +436,36 @@ github.com/halfrost/LeetCode-Go/leetcode/0028.Find-the-Index-of-the-First-Occurr github.com/halfrost/LeetCode-Go/leetcode/0028.Find-the-Index-of-the-First-Occurrence-in-a-String/28. Find the Index of the First Occurrence in a String.go:15.4,15.34 1 28 github.com/halfrost/LeetCode-Go/leetcode/0028.Find-the-Index-of-the-First-Occurrence-in-a-String/28. Find the Index of the First Occurrence in a String.go:15.34,16.10 1 12 github.com/halfrost/LeetCode-Go/leetcode/0028.Find-the-Index-of-the-First-Occurrence-in-a-String/28. Find the Index of the First Occurrence in a String.go:23.50,25.2 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:8.44,11.19 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:11.19,13.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:14.2,14.18 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:14.18,16.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:17.2,17.48 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:17.48,19.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:20.2,20.64 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:20.64,22.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:23.2,23.30 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:23.30,25.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:44.2,45.25 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:45.25,47.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:48.2,48.25 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:48.25,50.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:51.2,51.19 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:54.61,56.124 2 38 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:56.124,57.35 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:57.35,59.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:60.3,60.18 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:62.2,62.60 1 34 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:62.60,64.3 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:65.2,65.60 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:65.60,67.3 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:68.2,68.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:72.44,73.47 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:73.47,75.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:76.2,78.62 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:78.62,80.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:81.2,82.17 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:82.17,85.22 3 20 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:85.22,88.4 2 227 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:89.3,90.14 2 20 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:92.2,92.22 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:95.21,96.11 1 22 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:96.11,98.3 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:99.2,99.11 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:8.44,11.19 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:11.19,13.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:14.2,14.18 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:14.18,16.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:17.2,17.48 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:17.48,19.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:20.2,20.64 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:20.64,22.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:23.2,23.30 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:23.30,25.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:44.2,45.19 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:48.61,50.124 2 39 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:50.124,51.35 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:51.35,53.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:54.3,54.18 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:56.2,56.60 1 34 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:56.60,58.3 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:59.2,59.62 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:63.44,64.47 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:64.47,66.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:67.2,69.62 3 8 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:69.62,71.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:72.2,73.17 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:73.17,76.22 3 24 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:76.22,79.4 2 263 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:80.3,81.14 2 24 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:83.2,83.22 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:86.21,87.11 1 31 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:87.11,89.3 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go:90.2,90.11 1 6 github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:3.52,4.21 1 11 github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:4.21,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:7.2,9.26 3 10 @@ -484,7 +478,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-Al github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:23.9,27.4 3 97 github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:29.2,29.12 1 10 github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:32.40,34.22 2 45 -github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:34.22,35.12 1 61 +github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:34.22,35.12 1 64 github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:35.12,37.9 2 33 github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:40.2,40.13 1 45 github.com/halfrost/LeetCode-Go/leetcode/0030.Substring-with-Concatenation-of-All-Words/30. Substring with Concatenation of All Words.go:43.47,45.22 2 107 @@ -541,57 +535,57 @@ github.com/halfrost/LeetCode-Go/leetcode/0032.Longest-Valid-Parentheses/32. Long github.com/halfrost/LeetCode-Go/leetcode/0032.Longest-Valid-Parentheses/32. Longest Valid Parentheses.go:53.9,53.26 1 23 github.com/halfrost/LeetCode-Go/leetcode/0032.Longest-Valid-Parentheses/32. Longest Valid Parentheses.go:53.26,55.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0032.Longest-Valid-Parentheses/32. Longest Valid Parentheses.go:57.2,57.18 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:3.43,4.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:4.20,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:7.2,8.18 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:8.18,10.26 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:10.26,12.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:12.9,12.35 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:3.43,4.20 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:4.20,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:7.2,8.18 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:8.18,10.26 2 16 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:10.26,12.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:12.9,12.35 1 12 github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:12.35,13.49 1 4 github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:13.49,15.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:15.10,17.5 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:18.9,18.36 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:18.36,19.50 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:19.50,21.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:21.10,23.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:24.9,25.30 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:25.30,27.5 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:28.4,28.31 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:28.31,30.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:33.2,33.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:3.48,6.2 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:9.58,11.18 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:11.18,13.25 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:13.25,15.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:15.9,15.32 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:15.32,17.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:17.9,18.45 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:18.45,20.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:21.4,21.18 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:24.2,24.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:28.57,30.18 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:30.18,32.25 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:32.25,34.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:34.9,34.32 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:34.32,36.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:36.9,37.55 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:37.55,39.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:40.4,40.17 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:43.2,43.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:47.60,49.18 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:49.18,51.26 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:51.26,52.44 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:52.44,54.5 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:55.4,55.18 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:56.9,58.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:60.2,60.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:64.56,66.18 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:66.18,68.26 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:68.26,69.54 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:69.54,71.5 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:72.4,72.17 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:73.9,75.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:77.2,77.11 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:18.9,18.36 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:18.36,19.50 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:19.50,21.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:21.10,23.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:24.9,25.30 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:25.30,27.5 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:28.4,28.31 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:28.31,30.5 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array.go:33.2,33.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:3.48,6.2 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:9.58,11.18 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:11.18,13.25 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:13.25,15.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:15.9,15.32 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:15.32,17.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:17.9,18.45 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:18.45,20.5 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:21.4,21.18 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:24.2,24.11 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:28.57,30.18 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:30.18,32.25 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:32.25,34.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:34.9,34.32 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:34.32,36.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:36.9,37.55 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:37.55,39.5 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:40.4,40.17 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:43.2,43.11 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:47.60,49.18 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:49.18,51.26 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:51.26,52.44 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:52.44,54.5 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:55.4,55.18 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:56.9,58.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:60.2,60.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:64.56,66.18 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:66.18,68.26 2 11 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:68.26,69.54 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:69.54,71.5 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:72.4,72.17 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:73.9,75.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array.go:77.2,77.11 1 1 github.com/halfrost/LeetCode-Go/leetcode/0035.Search-Insert-Position/35. Search Insert Position.go:3.47,5.18 2 4 github.com/halfrost/LeetCode-Go/leetcode/0035.Search-Insert-Position/35. Search Insert Position.go:5.18,7.26 2 8 github.com/halfrost/LeetCode-Go/leetcode/0035.Search-Insert-Position/35. Search Insert Position.go:7.26,9.4 1 3 @@ -599,47 +593,45 @@ github.com/halfrost/LeetCode-Go/leetcode/0035.Search-Insert-Position/35. Search github.com/halfrost/LeetCode-Go/leetcode/0035.Search-Insert-Position/35. Search Insert Position.go:10.55,12.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/0035.Search-Insert-Position/35. Search Insert Position.go:13.4,13.17 1 2 github.com/halfrost/LeetCode-Go/leetcode/0035.Search-Insert-Position/35. Search Insert Position.go:16.2,16.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:6.41,8.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:8.25,10.26 2 27 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:10.26,12.30 2 243 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:12.30,14.31 2 76 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:14.31,16.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:17.5,17.24 1 76 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:17.24,19.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:20.5,20.19 1 76 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:25.2,25.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:25.25,27.26 2 19 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:27.26,29.30 2 166 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:29.30,31.31 2 49 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:31.31,33.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:34.5,34.24 1 49 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:34.24,36.6 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:37.5,37.19 1 48 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:42.2,42.25 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:42.25,43.26 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:43.26,45.38 2 18 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:45.38,46.39 1 54 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:46.39,48.32 2 162 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:48.32,50.26 2 46 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:50.26,52.8 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:53.7,53.21 1 46 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:59.2,59.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:63.42,65.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:65.25,69.3 3 27 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:71.2,71.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:71.25,72.26 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:72.26,73.26 1 183 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:73.26,75.67 2 55 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:75.67,77.6 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:78.5,80.34 3 54 -github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:84.2,84.13 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:6.41,8.25 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:8.25,10.26 2 38 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:10.26,12.30 2 327 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:12.30,14.31 2 81 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:14.31,16.6 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:17.5,17.24 1 80 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:17.24,19.6 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:20.5,20.19 1 79 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:25.2,25.25 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:25.25,27.26 2 28 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:27.26,29.30 2 247 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:29.30,32.24 2 51 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:32.24,34.6 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:35.5,35.19 1 50 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:40.2,40.25 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:40.25,41.26 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:41.26,43.38 2 19 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:43.38,44.39 1 57 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:44.39,46.32 2 171 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:46.32,48.26 2 48 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:48.26,50.8 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:51.7,51.21 1 47 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:57.2,57.13 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:61.42,63.25 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:63.25,67.3 3 45 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:69.2,69.25 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:69.25,70.26 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:70.26,71.26 1 206 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:71.26,73.67 2 59 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:73.67,75.6 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:76.5,78.34 3 56 +github.com/halfrost/LeetCode-Go/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go:82.2,82.13 1 2 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:8.34,10.34 2 1 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:10.34,11.38 1 9 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:11.38,12.26 1 81 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:12.26,14.5 1 51 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:17.2,17.34 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:20.72,21.19 1 4209 -github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:21.19,23.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:20.72,21.19 1 4210 +github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:21.19,23.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:24.2,24.23 1 4209 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:24.23,27.3 2 1 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:28.2,28.26 1 4208 @@ -658,8 +650,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:56.34,57.63 1 45420 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:57.63,59.5 1 1401 github.com/halfrost/LeetCode-Go/leetcode/0037.Sudoku-Solver/37. Sudoku Solver.go:62.2,62.13 1 4208 -github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:5.59,6.26 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:6.26,8.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:5.59,6.26 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:6.26,8.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:9.2,12.12 4 2 github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:15.79,16.17 1 23 github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:16.17,17.18 1 5 @@ -669,8 +661,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Su github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:24.37,25.23 1 35 github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:25.23,26.9 1 14 github.com/halfrost/LeetCode-Go/leetcode/0039.Combination-Sum/39. Combination Sum.go:28.3,30.19 3 21 -github.com/halfrost/LeetCode-Go/leetcode/0040.Combination-Sum-II/40. Combination Sum II.go:7.60,8.26 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0040.Combination-Sum-II/40. Combination Sum II.go:8.26,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0040.Combination-Sum-II/40. Combination Sum II.go:7.60,8.26 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0040.Combination-Sum-II/40. Combination Sum II.go:8.26,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0040.Combination-Sum-II/40. Combination Sum II.go:11.2,14.12 4 2 github.com/halfrost/LeetCode-Go/leetcode/0040.Combination-Sum-II/40. Combination Sum II.go:17.80,18.17 1 24 github.com/halfrost/LeetCode-Go/leetcode/0040.Combination-Sum-II/40. Combination Sum II.go:18.17,23.3 4 6 @@ -696,8 +688,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0042.Trapping-Rain-Water/42. Trapping R github.com/halfrost/LeetCode-Go/leetcode/0042.Trapping-Rain-Water/42. Trapping Rain Water.go:16.10,18.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0042.Trapping-Rain-Water/42. Trapping Rain Water.go:19.4,19.11 1 4 github.com/halfrost/LeetCode-Go/leetcode/0042.Trapping-Rain-Water/42. Trapping Rain Water.go:22.2,22.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:3.48,4.32 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:4.32,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:3.48,4.32 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:4.32,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:7.2,8.31 2 2 github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:8.31,9.32 1 4 github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:9.32,11.4 1 10 @@ -708,17 +700,17 @@ github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Stri github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:20.2,21.32 2 2 github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:21.32,23.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0043.Multiply-Strings/43. Multiply Strings.go:24.2,24.20 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:3.27,4.20 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:4.20,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:7.2,8.25 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:3.27,4.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:4.20,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:7.2,8.25 2 3 github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:8.25,9.21 1 4 github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:9.21,11.31 2 4 github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:11.31,13.5 1 2 github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:15.3,15.22 1 2 github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:15.22,18.4 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:20.2,20.13 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:3.34,4.20 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:4.20,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0045.Jump-Game-II/45. Jump Game II.go:20.2,20.13 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:3.34,4.20 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:4.20,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:7.2,9.12 3 1 github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:12.86,13.24 1 16 github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:13.24,18.3 4 6 @@ -726,8 +718,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:1 github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:19.33,20.18 1 30 github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:20.18,26.4 5 15 github.com/halfrost/LeetCode-Go/leetcode/0046.Permutations/46. Permutations.go:28.2,28.8 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:5.40,6.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:6.20,8.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:5.40,6.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:6.20,8.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:9.2,12.12 4 3 github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:15.88,16.24 1 22 github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:16.24,21.3 4 7 @@ -737,14 +729,14 @@ github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations I github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:24.54,25.13 1 7 github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:27.4,31.22 5 19 github.com/halfrost/LeetCode-Go/leetcode/0047.Permutations-II/47. Permutations II.go:34.2,34.8 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:4.29,7.30 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:7.30,8.35 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:4.29,7.30 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:7.30,8.35 1 8 github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:8.35,10.4 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:13.2,13.30 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:13.30,14.33 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:13.2,13.30 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:13.30,14.33 1 8 github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:14.33,16.4 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:21.30,23.12 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:23.12,25.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:21.30,23.12 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:23.12,25.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:35.2,35.25 1 2 github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:35.25,38.30 1 7 github.com/halfrost/LeetCode-Go/leetcode/0048.Rotate-Image/48. Rotate Image.go:38.30,40.4 1 9 @@ -761,8 +753,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0049.Group-Anagrams/49. Group Anagrams. github.com/halfrost/LeetCode-Go/leetcode/0049.Group-Anagrams/49. Group Anagrams.go:28.2,28.27 1 1 github.com/halfrost/LeetCode-Go/leetcode/0049.Group-Anagrams/49. Group Anagrams.go:28.27,30.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0049.Group-Anagrams/49. Group Anagrams.go:31.2,31.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0050.Powx-n/50. Pow(x, n).go:4.38,5.12 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0050.Powx-n/50. Pow(x, n).go:5.12,7.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0050.Powx-n/50. Pow(x, n).go:4.38,5.12 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0050.Powx-n/50. Pow(x, n).go:5.12,7.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0050.Powx-n/50. Pow(x, n).go:8.2,8.12 1 8 github.com/halfrost/LeetCode-Go/leetcode/0050.Powx-n/50. Pow(x, n).go:8.12,10.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0050.Powx-n/50. Pow(x, n).go:11.2,11.11 1 5 @@ -810,8 +802,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0052.N-Queens-II/52. N-Queens II.go:22. github.com/halfrost/LeetCode-Go/leetcode/0052.N-Queens-II/52. N-Queens II.go:22.25,24.63 1 441031 github.com/halfrost/LeetCode-Go/leetcode/0052.N-Queens-II/52. N-Queens II.go:24.63,34.4 9 46767 github.com/halfrost/LeetCode-Go/leetcode/0052.N-Queens-II/52. N-Queens II.go:36.2,36.8 1 45552 -github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:4.34,5.20 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:5.20,7.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:4.34,5.20 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:5.20,7.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:8.2,8.20 1 4 github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:8.20,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:11.2,13.33 3 3 @@ -832,54 +824,52 @@ github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subar github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:43.28,44.11 1 13 github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:44.11,46.3 1 5 github.com/halfrost/LeetCode-Go/leetcode/0053.Maximum-Subarray/53. Maximum Subarray.go:47.2,47.10 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:4.40,5.22 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:5.22,7.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:8.2,9.22 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:9.22,10.39 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:4.40,5.22 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:5.22,7.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:8.2,9.22 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:9.22,10.39 1 3 github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:10.39,12.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:13.3,13.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:15.2,15.25 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:13.3,13.13 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:15.2,15.25 1 4 github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:15.25,16.36 1 1 github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:16.36,18.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:19.3,19.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:21.2,27.25 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:27.25,29.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:30.2,32.27 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:32.27,35.77 3 21 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:35.77,37.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:38.3,38.43 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:38.43,40.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:41.3,41.23 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:41.23,44.4 2 19 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:45.3,45.20 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:46.10,47.40 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:47.40,49.13 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:51.10,52.40 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:52.40,54.13 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:56.10,57.38 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:57.38,59.13 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:61.10,62.38 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:62.38,64.13 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:68.2,68.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:72.41,74.12 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:74.12,76.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:78.2,79.12 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:79.12,81.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:84.2,89.18 4 5 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:89.18,91.33 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:91.33,95.4 3 14 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:96.3,97.34 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:97.34,101.4 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:102.3,103.32 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:103.32,107.4 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:108.3,109.30 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:109.30,113.4 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:115.3,115.62 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:117.2,117.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:3.31,5.12 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:5.12,7.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:8.2,8.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:8.12,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:21.2,27.25 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:27.25,29.3 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:30.2,32.27 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:32.27,35.77 3 37 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:35.77,37.4 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:38.3,38.23 1 37 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:38.23,41.4 2 34 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:42.3,42.20 1 37 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:43.10,44.40 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:44.40,46.13 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:48.10,49.40 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:49.40,51.13 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:53.10,54.38 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:54.38,56.13 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:58.10,59.38 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:59.38,61.13 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:65.2,65.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:69.41,71.12 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:71.12,73.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:75.2,76.12 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:76.12,78.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:81.2,86.18 4 6 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:86.18,88.33 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:88.33,92.4 3 20 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:93.3,94.34 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:94.34,98.4 3 9 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:99.3,100.32 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:100.32,104.4 3 9 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:105.3,106.30 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:106.30,110.4 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:112.3,112.62 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go:114.2,114.12 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:3.31,5.12 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:5.12,7.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:8.2,8.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:8.12,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:11.2,12.25 2 2 github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:12.25,13.18 1 10 github.com/halfrost/LeetCode-Go/leetcode/0055.Jump-Game/55. Jump Game.go:13.18,15.4 1 1 @@ -898,8 +888,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Interval github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:37.28,38.11 1 9 github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:38.11,40.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:41.2,41.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:44.28,45.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:45.11,47.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:44.28,45.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:45.11,47.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:48.2,48.10 1 1 github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:51.50,54.27 3 14 github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:54.27,55.88 1 26 @@ -908,6 +898,13 @@ github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Interval github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:63.42,64.14 1 34 github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:64.14,66.3 1 20 github.com/halfrost/LeetCode-Go/leetcode/0056.Merge-Intervals/56. Merge Intervals.go:67.2,69.23 3 14 +github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:3.37,5.34 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:5.34,7.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:8.2,8.14 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:8.14,10.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:11.2,12.36 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:12.36,14.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:15.2,15.21 1 3 github.com/halfrost/LeetCode-Go/leetcode/0057.Insert-Interval/57. Insert Interval.go:18.68,20.25 2 6 github.com/halfrost/LeetCode-Go/leetcode/0057.Insert-Interval/57. Insert Interval.go:20.25,23.3 2 1 github.com/halfrost/LeetCode-Go/leetcode/0057.Insert-Interval/57. Insert Interval.go:24.2,25.79 2 5 @@ -923,38 +920,29 @@ github.com/halfrost/LeetCode-Go/leetcode/0057.Insert-Interval/57. Insert Interva github.com/halfrost/LeetCode-Go/leetcode/0057.Insert-Interval/57. Insert Interval.go:50.28,51.11 1 8 github.com/halfrost/LeetCode-Go/leetcode/0057.Insert-Interval/57. Insert Interval.go:51.11,53.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0057.Insert-Interval/57. Insert Interval.go:54.2,54.10 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:3.37,5.34 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:5.34,7.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:8.2,8.14 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:8.14,10.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:11.2,12.36 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:12.36,14.3 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0058.Length-of-Last-Word/58.Length of Last Word.go:15.2,15.21 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:3.36,4.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:4.12,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:7.2,7.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:7.12,9.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:10.2,16.25 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:16.25,19.3 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:20.2,22.27 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:22.27,25.77 3 25 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:25.77,27.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:28.3,28.43 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:28.43,30.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:31.3,31.23 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:31.23,34.4 2 23 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:35.3,35.20 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:36.10,37.40 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:37.40,39.13 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:41.10,42.40 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:42.40,44.13 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:46.10,47.38 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:47.38,49.13 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:51.10,52.38 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:52.38,54.13 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:58.2,58.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:8.42,9.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:9.12,11.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:3.36,4.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:4.12,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:7.2,7.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:7.12,9.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:10.2,16.25 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:16.25,19.3 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:20.2,22.27 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:22.27,25.77 3 29 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:25.77,27.4 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:28.3,28.23 1 29 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:28.23,31.4 2 26 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:32.3,32.20 1 29 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:33.10,34.40 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:34.40,36.13 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:38.10,39.40 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:39.40,41.13 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:43.10,44.38 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:44.38,46.13 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:48.10,49.38 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:49.38,51.13 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go:55.2,55.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:8.42,9.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:9.12,11.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:12.2,14.12 3 2 github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:17.80,19.16 2 81 github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:19.16,21.14 2 30 @@ -965,12 +953,12 @@ github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutati github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:28.25,29.18 1 194 github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:29.18,35.4 5 79 github.com/halfrost/LeetCode-Go/leetcode/0060.Permutation-Sequence/60. Permutation Sequence.go:37.2,37.8 1 51 -github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:17.51,18.47 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:17.51,18.47 1 7 github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:18.47,20.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:21.2,24.22 4 4 -github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:24.22,27.3 2 17 -github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:28.2,28.20 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:28.20,30.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:21.2,24.22 4 5 +github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:24.22,27.3 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:28.2,28.20 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:28.20,30.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:31.2,33.35 3 4 github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:33.35,35.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/0061.Rotate-List/61. Rotate List.go:36.2,38.17 3 4 @@ -982,8 +970,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0062.Unique-Paths/62. Unique Paths.go:9 github.com/halfrost/LeetCode-Go/leetcode/0062.Unique-Paths/62. Unique Paths.go:10.24,12.13 2 15 github.com/halfrost/LeetCode-Go/leetcode/0062.Unique-Paths/62. Unique Paths.go:14.4,14.38 1 14 github.com/halfrost/LeetCode-Go/leetcode/0062.Unique-Paths/62. Unique Paths.go:17.2,17.21 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0063.Unique-Paths-II/63. Unique Paths II.go:3.57,4.55 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0063.Unique-Paths-II/63. Unique Paths II.go:4.55,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0063.Unique-Paths-II/63. Unique Paths II.go:3.57,4.55 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0063.Unique-Paths-II/63. Unique Paths II.go:4.55,6.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0063.Unique-Paths-II/63. Unique Paths II.go:7.2,9.25 3 3 github.com/halfrost/LeetCode-Go/leetcode/0063.Unique-Paths-II/63. Unique Paths II.go:9.25,11.3 1 9 github.com/halfrost/LeetCode-Go/leetcode/0063.Unique-Paths-II/63. Unique Paths II.go:12.2,13.25 2 3 @@ -1005,10 +993,10 @@ github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:12.25,13.26 1 2 github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:13.26,15.4 1 4 github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:17.2,17.23 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:22.36,23.20 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:23.20,25.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:26.2,27.22 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:27.22,29.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:22.36,23.20 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:23.20,25.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:26.2,27.22 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:27.22,29.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:31.2,32.25 2 1 github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:32.25,34.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:36.2,36.31 1 1 @@ -1026,31 +1014,31 @@ github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:59.28,60.11 1 8 github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:60.11,62.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum.go:63.2,63.10 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:3.30,5.30 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:5.30,6.33 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:6.33,8.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:8.9,8.47 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:3.30,5.30 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:5.30,6.33 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:6.33,8.4 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:8.9,8.47 1 9 github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:8.47,10.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:10.9,10.63 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:10.63,13.4 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:13.9,13.88 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:13.88,14.12 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:10.9,10.63 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:10.63,13.4 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:13.9,13.88 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:13.88,14.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:15.9,17.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:21.2,21.16 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0065.Valid-Number/65. Valid Number.go:21.2,21.16 1 6 github.com/halfrost/LeetCode-Go/leetcode/0066.Plus-One/66. Plus One.go:3.34,4.40 1 4 github.com/halfrost/LeetCode-Go/leetcode/0066.Plus-One/66. Plus One.go:4.40,5.21 1 5 github.com/halfrost/LeetCode-Go/leetcode/0066.Plus-One/66. Plus One.go:5.21,8.4 2 3 github.com/halfrost/LeetCode-Go/leetcode/0066.Plus-One/66. Plus One.go:9.3,9.16 1 2 github.com/halfrost/LeetCode-Go/leetcode/0066.Plus-One/66. Plus One.go:11.2,11.36 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:8.43,9.21 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:9.21,11.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:13.2,15.23 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:15.23,23.3 7 5 -github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:25.2,25.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:25.13,31.3 5 1 -github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:33.2,33.11 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:33.11,35.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:37.2,37.30 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:8.43,9.21 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:9.21,11.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:13.2,15.23 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:15.23,23.3 7 6 +github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:25.2,25.13 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:25.13,31.3 5 3 +github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:33.2,33.11 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:33.11,35.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0067.Add-Binary/67. Add Binary.go:37.2,37.30 1 3 github.com/halfrost/LeetCode-Go/leetcode/0069.Sqrtx/69. Sqrt(x).go:4.24,6.12 2 2 github.com/halfrost/LeetCode-Go/leetcode/0069.Sqrtx/69. Sqrt(x).go:6.12,8.18 2 5 github.com/halfrost/LeetCode-Go/leetcode/0069.Sqrtx/69. Sqrt(x).go:8.18,10.4 1 3 @@ -1072,34 +1060,34 @@ github.com/halfrost/LeetCode-Go/leetcode/0071.Simplify-Path/71. Simplify Path.go github.com/halfrost/LeetCode-Go/leetcode/0071.Simplify-Path/71. Simplify Path.go:24.21,26.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0071.Simplify-Path/71. Simplify Path.go:27.2,28.18 2 7 github.com/halfrost/LeetCode-Go/leetcode/0071.Simplify-Path/71. Simplify Path.go:32.40,34.2 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:3.32,4.45 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:4.45,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:7.2,8.35 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:8.35,9.24 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:3.32,4.45 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:4.45,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:7.2,8.35 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:8.35,9.24 1 4 github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:9.24,11.9 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:14.2,14.38 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:14.38,15.24 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:14.2,14.38 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:14.38,15.24 1 5 github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:15.24,17.9 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:20.2,20.35 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:20.35,21.39 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:21.39,22.25 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:22.25,25.5 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:29.2,29.35 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:29.35,30.24 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:30.24,31.40 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:31.40,33.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:37.2,37.38 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:37.38,38.24 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:38.24,39.37 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:39.37,41.5 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:44.2,44.25 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:20.2,20.35 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:20.35,21.39 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:21.39,22.25 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:22.25,25.5 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:29.2,29.35 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:29.35,30.24 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:30.24,31.40 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:31.40,33.5 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:37.2,37.38 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:37.38,38.24 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:38.24,39.37 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:39.37,41.5 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:44.2,44.25 1 2 github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:44.25,45.39 1 1 github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:45.39,47.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:49.2,49.25 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:49.2,49.25 1 2 github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:49.25,50.36 1 1 github.com/halfrost/LeetCode-Go/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes.go:50.36,52.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix.go:3.52,4.22 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix.go:4.22,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix.go:3.52,4.22 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix.go:4.22,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix.go:7.2,8.18 2 2 github.com/halfrost/LeetCode-Go/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix.go:8.18,10.37 2 7 github.com/halfrost/LeetCode-Go/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix.go:10.37,12.4 1 1 @@ -1112,8 +1100,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0075.Sort-Colors/75. Sort Colors.go:5.2 github.com/halfrost/LeetCode-Go/leetcode/0075.Sort-Colors/75. Sort Colors.go:7.13,10.4 2 17 github.com/halfrost/LeetCode-Go/leetcode/0075.Sort-Colors/75. Sort Colors.go:11.3,11.13 1 26 github.com/halfrost/LeetCode-Go/leetcode/0075.Sort-Colors/75. Sort Colors.go:11.13,14.4 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:3.43,4.24 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:4.24,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:3.43,4.24 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:4.24,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:7.2,10.30 3 3 github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:10.30,12.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:14.2,14.20 1 3 @@ -1129,8 +1117,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minim github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:34.2,34.21 1 3 github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:34.21,36.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring.go:37.2,37.15 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0077.Combinations/77. Combinations.go:3.36,4.31 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0077.Combinations/77. Combinations.go:4.31,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0077.Combinations/77. Combinations.go:3.36,4.31 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0077.Combinations/77. Combinations.go:4.31,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0077.Combinations/77. Combinations.go:7.2,9.12 3 1 github.com/halfrost/LeetCode-Go/leetcode/0077.Combinations/77. Combinations.go:12.67,13.17 1 10 github.com/halfrost/LeetCode-Go/leetcode/0077.Combinations/77. Combinations.go:13.17,18.3 4 6 @@ -1178,24 +1166,24 @@ github.com/halfrost/LeetCode-Go/leetcode/0080.Remove-Duplicates-from-Sorted-Arra github.com/halfrost/LeetCode-Go/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II.go:5.28,6.36 1 35 github.com/halfrost/LeetCode-Go/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II.go:6.36,9.4 2 26 github.com/halfrost/LeetCode-Go/leetcode/0080.Remove-Duplicates-from-Sorted-Array-II/80. Remove Duplicates from Sorted Array II.go:11.2,11.13 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:3.42,4.20 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:4.20,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:7.2,8.18 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:8.18,10.26 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:10.26,12.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:12.9,12.35 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:12.35,13.49 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:13.49,15.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:15.10,17.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:18.9,18.36 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:18.36,19.50 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:19.50,21.5 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:3.42,4.20 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:4.20,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:7.2,8.18 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:8.18,10.26 2 23 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:10.26,12.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:12.9,12.35 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:12.35,13.49 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:13.49,15.5 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:15.10,17.5 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:18.9,18.36 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:18.36,19.50 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:19.50,21.5 1 2 github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:21.10,23.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:24.9,25.30 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:25.30,27.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:28.4,28.31 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:28.31,30.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:33.2,33.14 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:24.9,25.30 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:25.30,27.5 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:28.4,28.31 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:28.31,30.5 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II.go:33.2,33.14 1 2 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:17.50,18.17 1 9 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:18.17,20.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:21.2,21.22 1 8 @@ -1220,15 +1208,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:68.53,70.4 1 10 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:71.3,71.37 1 5 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:73.2,74.13 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:77.49,79.17 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:79.17,81.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:82.2,82.22 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:82.22,84.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:85.2,85.22 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:85.22,86.30 1 24 -github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:86.30,88.4 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:88.9,90.4 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:92.2,92.13 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:77.49,79.17 2 17 +github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:79.17,81.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:82.2,82.22 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:82.22,84.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:85.2,85.22 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:85.22,86.30 1 64 +github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:86.30,88.4 1 30 +github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:88.9,90.4 1 34 +github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:92.2,92.13 1 13 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:96.50,97.17 1 9 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:97.17,99.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:101.2,105.48 4 8 @@ -1248,10 +1236,10 @@ github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:152.2,152.35 1 7 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:152.35,154.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II.go:155.2,155.21 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:18.49,20.17 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:20.17,22.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:23.2,23.22 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:23.22,25.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:18.49,20.17 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:20.17,22.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:23.2,23.22 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:23.22,25.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:26.2,26.22 1 3 github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:26.22,27.30 1 15 github.com/halfrost/LeetCode-Go/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List.go:27.30,29.4 1 12 @@ -1269,14 +1257,14 @@ github.com/halfrost/LeetCode-Go/leetcode/0084.Largest-Rectangle-in-Histogram/84. github.com/halfrost/LeetCode-Go/leetcode/0084.Largest-Rectangle-in-Histogram/84. Largest Rectangle in Histogram.go:27.28,28.11 1 12 github.com/halfrost/LeetCode-Go/leetcode/0084.Largest-Rectangle-in-Histogram/84. Largest Rectangle in Histogram.go:28.11,30.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0084.Largest-Rectangle-in-Histogram/84. Largest Rectangle in Histogram.go:31.2,31.10 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:19.49,25.18 5 7 +github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:19.49,25.18 5 8 github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:25.18,26.19 1 34 github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:26.19,29.4 2 10 github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:29.9,32.4 2 24 github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:33.3,33.19 1 34 -github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:35.2,37.24 3 7 -github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:48.50,49.37 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:49.37,51.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:35.2,37.24 3 8 +github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:48.50,49.37 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:49.37,51.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:52.2,54.17 3 7 github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:54.17,55.18 1 34 github.com/halfrost/LeetCode-Go/leetcode/0086.Partition-List/86. Partition List.go:55.18,58.32 3 10 @@ -1354,8 +1342,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0092.Reverse-Linked-List-II/92. Reverse github.com/halfrost/LeetCode-Go/leetcode/0092.Reverse-Linked-List-II/92. Reverse Linked List II.go:30.2,31.27 2 4 github.com/halfrost/LeetCode-Go/leetcode/0092.Reverse-Linked-List-II/92. Reverse Linked List II.go:31.27,36.3 4 8 github.com/halfrost/LeetCode-Go/leetcode/0092.Reverse-Linked-List-II/92. Reverse Linked List II.go:37.2,37.21 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses.go:7.44,8.13 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses.go:8.13,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses.go:7.44,8.13 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses.go:8.13,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses.go:11.2,13.12 3 3 github.com/halfrost/LeetCode-Go/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses.go:16.56,17.21 1 89 github.com/halfrost/LeetCode-Go/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses.go:17.21,18.19 1 6 @@ -1373,8 +1361,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0093.Restore-IP-Addresses/93. Restore I github.com/halfrost/LeetCode-Go/leetcode/0094.Binary-Tree-Inorder-Traversal/94. Binary Tree Inorder Traversal.go:19.45,23.2 3 3 github.com/halfrost/LeetCode-Go/leetcode/0094.Binary-Tree-Inorder-Traversal/94. Binary Tree Inorder Traversal.go:25.45,26.17 1 11 github.com/halfrost/LeetCode-Go/leetcode/0094.Binary-Tree-Inorder-Traversal/94. Binary Tree Inorder Traversal.go:26.17,30.3 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go:19.39,20.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go:20.12,22.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go:19.39,20.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go:20.12,22.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go:23.2,23.29 1 2 github.com/halfrost/LeetCode-Go/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go:26.49,28.17 2 30 github.com/halfrost/LeetCode-Go/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II.go:28.17,31.3 2 20 @@ -1387,8 +1375,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0096.Unique-Binary-Search-Trees/96. Uni github.com/halfrost/LeetCode-Go/leetcode/0096.Unique-Binary-Search-Trees/96. Unique Binary Search Trees.go:6.26,7.27 1 44 github.com/halfrost/LeetCode-Go/leetcode/0096.Unique-Binary-Search-Trees/96. Unique Binary Search Trees.go:7.27,9.4 1 208 github.com/halfrost/LeetCode-Go/leetcode/0096.Unique-Binary-Search-Trees/96. Unique Binary Search Trees.go:11.2,11.14 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0097.Interleaving-String/97. Interleaving String.go:3.57,4.32 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0097.Interleaving-String/97. Interleaving String.go:4.32,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0097.Interleaving-String/97. Interleaving String.go:3.57,4.32 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0097.Interleaving-String/97. Interleaving String.go:4.32,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0097.Interleaving-String/97. Interleaving String.go:7.2,8.39 2 3 github.com/halfrost/LeetCode-Go/leetcode/0097.Interleaving-String/97. Interleaving String.go:11.68,12.22 1 24 github.com/halfrost/LeetCode-Go/leetcode/0097.Interleaving-String/97. Interleaving String.go:12.22,14.3 1 2 @@ -1511,12 +1499,12 @@ github.com/halfrost/LeetCode-Go/leetcode/0103.Binary-Tree-Zigzag-Level-Order-Tra github.com/halfrost/LeetCode-Go/leetcode/0103.Binary-Tree-Zigzag-Level-Order-Traversal/103. Binary Tree Zigzag Level Order Traversal.go:110.25,112.5 1 4 github.com/halfrost/LeetCode-Go/leetcode/0103.Binary-Tree-Zigzag-Level-Order-Traversal/103. Binary Tree Zigzag Level Order Traversal.go:115.3,117.10 3 7 github.com/halfrost/LeetCode-Go/leetcode/0103.Binary-Tree-Zigzag-Level-Order-Traversal/103. Binary Tree Zigzag Level Order Traversal.go:119.2,119.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:19.35,20.17 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:20.17,22.3 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:23.2,23.59 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:26.28,27.11 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:27.11,29.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:30.2,30.10 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:19.35,20.17 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:20.17,22.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:23.2,23.59 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:26.28,27.11 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:27.11,29.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree.go:30.2,30.10 1 7 github.com/halfrost/LeetCode-Go/leetcode/0105.Construct-Binary-Tree-from-Preorder-and-Inorder-Traversal/105. Construct Binary Tree from Preorder and Inorder Traversal.go:20.57,21.24 1 11 github.com/halfrost/LeetCode-Go/leetcode/0105.Construct-Binary-Tree-from-Preorder-and-Inorder-Traversal/105. Construct Binary Tree from Preorder and Inorder Traversal.go:21.24,23.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0105.Construct-Binary-Tree-from-Preorder-and-Inorder-Traversal/105. Construct Binary Tree from Preorder and Inorder Traversal.go:24.2,25.33 2 5 @@ -1563,18 +1551,16 @@ github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Sear github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:31.17,33.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:34.2,34.37 1 11 github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:34.37,36.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:37.2,38.23 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:38.23,40.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:41.2,41.20 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:41.20,43.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:44.2,44.24 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:44.24,46.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:47.2,47.109 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:50.77,51.37 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:51.37,53.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:54.2,56.44 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:56.44,60.3 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:61.2,61.16 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:37.2,38.20 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:38.20,40.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:41.2,41.24 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:41.24,43.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:44.2,44.109 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:47.77,48.37 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:48.37,50.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:51.2,53.44 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:53.44,57.3 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go:58.2,58.16 1 5 github.com/halfrost/LeetCode-Go/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree.go:19.38,20.17 1 50 github.com/halfrost/LeetCode-Go/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree.go:20.17,22.3 1 27 github.com/halfrost/LeetCode-Go/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree.go:23.2,25.90 3 23 @@ -1587,32 +1573,32 @@ github.com/halfrost/LeetCode-Go/leetcode/0110.Balanced-Binary-Tree/110. Balanced github.com/halfrost/LeetCode-Go/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree.go:42.28,43.11 1 32 github.com/halfrost/LeetCode-Go/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree.go:43.11,45.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0110.Balanced-Binary-Tree/110. Balanced Binary Tree.go:46.2,46.10 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:19.35,20.17 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:20.17,22.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:23.2,23.22 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:23.22,25.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:26.2,26.23 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:26.23,28.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:29.2,29.59 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:32.28,33.11 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:33.11,35.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:19.35,20.17 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:20.17,22.3 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:23.2,23.22 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:23.22,25.3 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:26.2,26.23 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:26.23,28.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:29.2,29.59 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:32.28,33.11 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:33.11,35.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree.go:36.2,36.10 1 2 github.com/halfrost/LeetCode-Go/leetcode/0112.Path-Sum/112. Path Sum.go:19.47,20.17 1 6 github.com/halfrost/LeetCode-Go/leetcode/0112.Path-Sum/112. Path Sum.go:20.17,22.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0112.Path-Sum/112. Path Sum.go:23.2,23.43 1 5 github.com/halfrost/LeetCode-Go/leetcode/0112.Path-Sum/112. Path Sum.go:23.43,25.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0112.Path-Sum/112. Path Sum.go:26.2,26.84 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:20.47,24.2 3 7 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:26.73,27.14 1 103 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:27.14,29.3 1 55 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:30.2,32.49 3 48 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:32.49,35.3 2 12 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:36.2,38.14 3 48 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:42.48,43.17 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:20.47,24.2 3 11 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:26.73,27.14 1 161 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:27.14,29.3 1 86 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:30.2,32.49 3 75 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:32.49,35.3 2 20 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:36.2,38.14 3 75 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:42.48,43.17 1 4 github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:43.17,45.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:46.2,46.43 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:46.43,47.22 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:47.22,49.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:46.2,46.43 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:46.43,47.22 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:47.22,49.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:51.2,54.22 4 2 github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:54.22,55.37 1 2 github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:55.37,57.4 1 3 @@ -1622,35 +1608,35 @@ github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:64 github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:65.38,67.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:68.3,68.33 1 2 github.com/halfrost/LeetCode-Go/leetcode/0113.Path-Sum-II/113. Path Sum II.go:70.2,70.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:20.30,22.33 2 10 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:22.33,25.3 2 26 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:26.2,26.8 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:29.49,30.17 1 76 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:20.30,22.33 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:22.33,25.3 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:26.2,26.8 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:29.49,30.17 1 79 github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:30.17,34.3 3 33 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:35.2,35.8 1 76 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:39.31,40.60 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:40.60,42.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:35.2,35.8 1 79 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:39.31,40.60 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:40.60,42.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:43.2,48.24 6 2 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:48.24,50.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:48.24,50.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:51.2,51.24 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:55.31,56.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:56.17,58.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:55.31,56.17 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:56.17,58.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:59.2,60.22 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:60.22,62.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:63.2,65.21 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:65.21,67.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:68.2,70.17 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:4.42,6.25 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:6.25,8.26 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:8.26,9.14 1 63 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:9.14,11.5 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:12.4,13.20 2 63 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:13.20,15.5 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:15.10,17.5 1 46 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:18.4,18.15 1 63 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:21.2,21.19 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:25.36,27.11 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:27.11,29.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:60.22,62.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:63.2,65.21 3 2 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:65.21,67.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List.go:68.2,70.17 3 2 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:4.42,6.25 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:6.25,8.26 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:8.26,9.14 1 69 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:9.14,11.5 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:12.4,13.20 2 69 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:13.20,15.5 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:15.10,17.5 1 50 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:18.4,18.15 1 69 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:21.2,21.19 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:25.36,27.11 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:27.11,29.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:30.2,31.20 2 2 github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:31.20,34.3 2 16 github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:35.2,35.30 1 2 @@ -1659,8 +1645,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinc github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:37.20,39.5 1 17 github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:39.10,41.5 1 46 github.com/halfrost/LeetCode-Go/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences.go:44.2,44.17 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:11.32,12.17 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:12.17,14.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:11.32,12.17 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:12.17,14.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:15.2,16.17 2 1 github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:16.17,19.26 2 3 github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:19.26,20.20 1 7 @@ -1671,8 +1657,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in- github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:26.25,28.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:30.3,30.8 1 3 github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:32.2,32.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:36.33,37.17 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:37.17,39.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:36.33,37.17 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:37.17,39.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:40.2,41.13 2 1 github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:44.41,45.34 1 13 github.com/halfrost/LeetCode-Go/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node.go:45.34,47.3 1 9 @@ -1688,30 +1674,30 @@ github.com/halfrost/LeetCode-Go/leetcode/0118.Pascals-Triangle/118. Pascals Tria github.com/halfrost/LeetCode-Go/leetcode/0119.Pascals-Triangle-II/119. Pascals Triangle II.go:3.33,6.33 3 2 github.com/halfrost/LeetCode-Go/leetcode/0119.Pascals-Triangle-II/119. Pascals Triangle II.go:6.33,8.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0119.Pascals-Triangle-II/119. Pascals Triangle II.go:9.2,9.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:8.41,9.21 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:9.21,11.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:12.2,12.48 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:8.41,9.21 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:9.21,11.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:12.2,12.48 1 2 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:12.48,13.49 1 3 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:13.49,15.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:17.2,17.23 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:17.2,17.23 1 2 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:20.28,21.11 1 9 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:21.11,23.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:24.2,24.10 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:28.42,29.24 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:29.24,31.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:32.2,33.42 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:33.42,35.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:36.2,36.37 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:28.42,29.24 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:29.24,31.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:32.2,33.42 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:33.42,35.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:36.2,36.37 1 2 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:36.37,37.46 1 3 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:37.46,38.14 1 9 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:38.14,41.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:41.10,41.38 1 6 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:41.38,44.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:44.10,47.5 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:50.2,50.31 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:50.31,51.21 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:51.21,53.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:55.2,55.15 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:50.2,50.31 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:50.31,51.21 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:51.21,53.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0120.Triangle/120. Triangle.go:55.2,55.15 1 2 github.com/halfrost/LeetCode-Go/leetcode/0121.Best-Time-to-Buy-and-Sell-Stock/121. Best Time to Buy and Sell Stock.go:4.34,5.21 1 4 github.com/halfrost/LeetCode-Go/leetcode/0121.Best-Time-to-Buy-and-Sell-Stock/121. Best Time to Buy and Sell Stock.go:5.21,7.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0121.Best-Time-to-Buy-and-Sell-Stock/121. Best Time to Buy and Sell Stock.go:8.2,9.35 2 3 @@ -1759,24 +1745,24 @@ github.com/halfrost/LeetCode-Go/leetcode/0125.Valid-Palindrome/125. Valid Palind github.com/halfrost/LeetCode-Go/leetcode/0125.Valid-Palindrome/125. Valid Palindrome.go:27.26,28.54 1 40 github.com/halfrost/LeetCode-Go/leetcode/0125.Valid-Palindrome/125. Valid Palindrome.go:28.54,30.3 1 30 github.com/halfrost/LeetCode-Go/leetcode/0125.Valid-Palindrome/125. Valid Palindrome.go:31.2,31.14 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:3.82,5.29 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:5.29,7.3 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:8.2,8.23 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:3.82,5.29 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:5.29,7.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:8.2,8.23 1 3 github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:8.23,10.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:12.2,20.21 5 1 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:20.21,24.38 4 6 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:24.38,25.32 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:25.32,27.28 2 468 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:12.2,20.21 5 2 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:20.21,24.38 4 7 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:24.38,25.32 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:25.32,27.28 2 546 github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:27.28,30.14 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:32.5,32.26 1 466 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:32.5,32.26 1 544 github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:32.26,41.6 5 5 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:44.3,46.20 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:46.20,47.23 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:44.3,46.20 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:46.20,47.23 1 5 github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:47.23,49.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:50.4,50.28 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:50.4,50.28 1 4 github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:50.28,52.5 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:54.4,55.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:58.2,58.15 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:54.4,55.25 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0126.Word-Ladder-II/126. Word Ladder II.go:58.2,58.15 1 1 github.com/halfrost/LeetCode-Go/leetcode/0127.Word-Ladder/127. Word Ladder.go:3.76,5.19 2 2 github.com/halfrost/LeetCode-Go/leetcode/0127.Word-Ladder/127. Word Ladder.go:5.19,8.29 3 8 github.com/halfrost/LeetCode-Go/leetcode/0127.Word-Ladder/127. Word Ladder.go:8.29,12.41 4 11 @@ -1847,43 +1833,43 @@ github.com/halfrost/LeetCode-Go/leetcode/0129.Sum-Root-to-Leaf-Numbers/129. Sum github.com/halfrost/LeetCode-Go/leetcode/0129.Sum-Root-to-Leaf-Numbers/129. Sum Root to Leaf Numbers.go:29.2,30.43 2 8 github.com/halfrost/LeetCode-Go/leetcode/0129.Sum-Root-to-Leaf-Numbers/129. Sum Root to Leaf Numbers.go:30.43,33.3 2 5 github.com/halfrost/LeetCode-Go/leetcode/0129.Sum-Root-to-Leaf-Numbers/129. Sum Root to Leaf Numbers.go:34.2,35.27 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:15.28,16.21 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:15.28,16.21 1 3 github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:16.21,18.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:19.2,23.25 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:23.25,24.26 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:24.26,25.72 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:25.72,27.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:27.10,27.33 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:27.33,28.29 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:28.29,30.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:31.5,31.29 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:31.29,33.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:34.5,34.29 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:34.29,36.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:37.5,37.29 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:37.29,39.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:44.2,44.25 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:44.25,45.26 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:45.26,46.38 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:19.2,23.25 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:23.25,24.26 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:24.26,25.72 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:25.72,27.5 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:27.10,27.33 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:27.33,28.29 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:28.29,30.6 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:31.5,31.29 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:31.29,33.6 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:34.5,34.29 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:34.29,36.6 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:37.5,37.29 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:37.29,39.6 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:44.2,44.25 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:44.25,45.26 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:45.26,46.38 1 25 github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:46.38,48.5 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:54.29,55.23 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:55.23,56.27 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:56.27,57.69 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:57.69,58.27 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:58.27,60.6 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:65.2,65.23 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:65.23,66.27 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:66.27,67.26 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:67.26,69.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:54.29,55.23 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:55.23,56.27 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:56.27,57.69 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:57.69,58.27 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:58.27,60.6 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:65.2,65.23 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:65.23,66.27 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:66.27,67.26 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:67.26,69.5 1 10 github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:69.10,69.33 1 15 github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:69.33,71.5 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:76.39,77.63 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:77.63,79.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:80.2,80.24 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:80.24,82.26 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:82.26,84.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:4.40,5.13 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:5.13,7.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:76.39,77.63 1 42 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:77.63,79.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:80.2,80.24 1 29 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:80.24,82.26 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0130.Surrounded-Regions/130. Surrounded Regions.go:82.26,84.4 1 40 +github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:4.40,5.13 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:5.13,7.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:8.2,10.12 3 4 github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:13.97,14.23 1 39 github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:14.23,15.12 1 17 @@ -1898,8 +1884,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palin github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:44.48,45.19 1 33 github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:45.19,47.4 1 17 github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:49.2,49.13 1 36 -github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:53.42,56.15 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:56.15,58.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:53.42,56.15 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:56.15,58.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:59.2,61.15 3 4 github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:64.66,66.18 2 27 github.com/halfrost/LeetCode-Go/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning.go:66.18,71.3 4 10 @@ -1951,21 +1937,21 @@ github.com/halfrost/LeetCode-Go/leetcode/0138.Copy-List-With-Random-Pointer/138. github.com/halfrost/LeetCode-Go/leetcode/0138.Copy-List-With-Random-Pointer/138. Copy List With Random Pointer.go:38.24,40.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0138.Copy-List-With-Random-Pointer/138. Copy List With Random Pointer.go:41.3,41.22 1 10 github.com/halfrost/LeetCode-Go/leetcode/0138.Copy-List-With-Random-Pointer/138. Copy List With Random Pointer.go:43.2,43.13 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle.go:18.36,21.38 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle.go:21.38,24.19 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle.go:24.19,26.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle.go:18.36,21.38 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle.go:21.38,24.19 3 8 +github.com/halfrost/LeetCode-Go/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle.go:24.19,26.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle.go:28.2,28.14 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:17.44,18.37 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:18.37,20.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:21.2,22.14 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:22.14,24.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:25.2,26.19 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:26.19,29.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:30.2,30.13 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:33.52,36.53 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:36.53,39.19 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:39.19,41.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:43.2,43.19 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:17.44,18.37 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:18.37,20.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:21.2,22.14 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:22.14,24.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:25.2,26.19 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:26.19,29.3 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:30.2,30.13 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:33.52,36.53 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:36.53,39.19 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:39.19,41.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II.go:43.2,43.19 1 1 github.com/halfrost/LeetCode-Go/leetcode/0143.Reorder-List/143. Reorder List.go:19.44,20.37 1 4 github.com/halfrost/LeetCode-Go/leetcode/0143.Reorder-List/143. Reorder List.go:20.37,22.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0143.Reorder-List/143. Reorder List.go:25.2,27.44 3 2 @@ -2010,24 +1996,24 @@ github.com/halfrost/LeetCode-Go/leetcode/0144.Binary-Tree-Preorder-Traversal/144 github.com/halfrost/LeetCode-Go/leetcode/0145.Binary-Tree-Postorder-Traversal/145. Binary Tree Postorder Traversal.go:19.47,23.2 3 3 github.com/halfrost/LeetCode-Go/leetcode/0145.Binary-Tree-Postorder-Traversal/145. Binary Tree Postorder Traversal.go:25.47,26.17 1 11 github.com/halfrost/LeetCode-Go/leetcode/0145.Binary-Tree-Postorder-Traversal/145. Binary Tree Postorder Traversal.go:26.17,30.3 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:14.41,16.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:18.40,19.36 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:19.36,23.3 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:14.41,16.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:18.40,19.36 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:19.36,23.3 3 5 github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:24.2,24.11 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:27.47,28.36 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:28.36,33.3 4 0 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:33.8,37.3 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:38.2,38.31 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:27.47,28.36 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:28.36,33.3 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:33.8,37.3 3 7 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:38.2,38.31 1 7 github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:38.31,41.3 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:44.39,47.22 3 7 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:47.22,49.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:50.2,51.22 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:51.22,54.3 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:57.42,58.23 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:58.23,62.3 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:63.2,63.23 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:44.39,47.22 3 14 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:47.22,49.3 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:50.2,51.22 2 14 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:51.22,54.3 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:57.42,58.23 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:58.23,62.3 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:63.2,63.23 1 6 github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:63.23,68.3 4 5 -github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:69.2,70.28 2 0 +github.com/halfrost/LeetCode-Go/leetcode/0146.LRU-Cache/146. LRU Cache.go:69.2,70.28 2 1 github.com/halfrost/LeetCode-Go/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List.go:17.50,18.17 1 4 github.com/halfrost/LeetCode-Go/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List.go:18.17,20.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0147.Insertion-Sort-List/147. Insertion Sort List.go:21.2,23.17 3 3 @@ -2040,8 +2026,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:20.17, github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:24.2,24.17 1 26 github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:24.17,26.3 1 15 github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:28.2,35.35 7 11 -github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:38.43,39.37 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:39.37,41.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:38.43,39.37 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:39.37,41.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:42.2,44.44 3 11 github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:44.44,47.3 2 8 github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:48.2,48.11 1 11 @@ -2052,15 +2038,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:55.15, github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:58.2,58.21 1 23 github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:58.21,61.3 2 16 github.com/halfrost/LeetCode-Go/leetcode/0148.Sort-List/148. Sort List.go:62.2,63.11 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:7.35,9.31 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:9.31,11.17 2 24 -github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:11.17,13.4 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:13.9,16.17 3 10 +github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:7.35,9.31 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:9.31,11.17 2 27 +github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:11.17,13.4 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:13.9,16.17 3 11 github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:17.13,18.37 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:19.13,20.37 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:19.13,20.37 1 1 github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:21.13,22.37 1 3 github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:23.13,24.37 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:28.2,28.17 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation.go:28.2,28.17 1 5 github.com/halfrost/LeetCode-Go/leetcode/0151.Reverse-Words-in-a-String/151. Reverse Words in a String.go:5.39,9.2 3 3 github.com/halfrost/LeetCode-Go/leetcode/0151.Reverse-Words-in-a-String/151. Reverse Words in a String.go:11.44,12.13 1 3 github.com/halfrost/LeetCode-Go/leetcode/0151.Reverse-Words-in-a-String/151. Reverse Words in a String.go:12.13,16.3 3 5 @@ -2075,37 +2061,37 @@ github.com/halfrost/LeetCode-Go/leetcode/0152.Maximum-Product-Subarray/152. Maxi github.com/halfrost/LeetCode-Go/leetcode/0152.Maximum-Product-Subarray/152. Maximum Product Subarray.go:23.28,24.11 1 7 github.com/halfrost/LeetCode-Go/leetcode/0152.Maximum-Product-Subarray/152. Maximum Product Subarray.go:24.11,26.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0152.Maximum-Product-Subarray/152. Maximum Product Subarray.go:27.2,27.10 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:4.30,6.17 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:6.17,7.29 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:7.29,9.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:10.3,11.29 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:11.29,13.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:4.30,6.17 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:6.17,7.29 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:7.29,9.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:10.3,11.29 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:11.29,13.4 1 6 github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:13.9,15.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:17.2,17.18 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:21.31,22.20 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:22.20,24.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:25.2,25.20 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:21.31,22.20 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:22.20,24.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:25.2,25.20 1 10 github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:25.20,27.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:28.2,28.33 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:28.2,28.33 1 9 github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:28.33,30.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:31.2,32.18 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:32.18,34.29 2 11 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:31.2,32.18 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:32.18,34.29 2 16 github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:34.29,36.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:37.3,37.142 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:37.142,39.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:40.3,40.54 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:37.3,37.142 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:37.142,39.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:40.3,40.54 1 10 github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:40.54,42.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:42.9,42.61 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:42.9,42.61 1 7 github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:42.61,44.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:44.9,45.30 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:45.30,47.5 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:48.4,48.31 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:48.31,50.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:53.2,53.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:57.31,59.31 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:59.31,60.16 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:60.16,62.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:64.2,64.12 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:44.9,45.30 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:45.30,47.5 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:48.4,48.31 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:48.31,50.5 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:53.2,53.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:57.31,59.31 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:59.31,60.16 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:60.16,62.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array.go:64.2,64.12 1 9 github.com/halfrost/LeetCode-Go/leetcode/0154.Find-Minimum-in-Rotated-Sorted-Array-II/154. Find Minimum in Rotated Sorted Array II.go:3.33,5.17 2 11 github.com/halfrost/LeetCode-Go/leetcode/0154.Find-Minimum-in-Rotated-Sorted-Array-II/154. Find Minimum in Rotated Sorted Array II.go:5.17,6.29 1 18 github.com/halfrost/LeetCode-Go/leetcode/0154.Find-Minimum-in-Rotated-Sorted-Array-II/154. Find Minimum in Rotated Sorted Array II.go:6.29,8.4 1 5 @@ -2136,25 +2122,25 @@ github.com/halfrost/LeetCode-Go/leetcode/0160.Intersection-of-Two-Linked-Lists/1 github.com/halfrost/LeetCode-Go/leetcode/0160.Intersection-of-Two-Linked-Lists/160. Intersection of Two Linked Lists.go:39.9,41.4 1 33 github.com/halfrost/LeetCode-Go/leetcode/0160.Intersection-of-Two-Linked-Lists/160. Intersection of Two Linked Lists.go:42.3,42.38 1 37 github.com/halfrost/LeetCode-Go/leetcode/0160.Intersection-of-Two-Linked-Lists/160. Intersection of Two Linked Lists.go:44.2,44.10 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:4.38,5.38 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:4.38,5.38 1 8 github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:5.38,7.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:8.2,9.18 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:9.18,11.180 2 11 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:8.2,9.18 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:9.18,11.180 2 13 github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:11.180,13.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:14.3,14.41 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:14.3,14.41 1 7 github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:14.41,16.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:17.3,17.41 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:17.3,17.41 1 7 github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:17.41,19.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:20.3,20.17 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:20.17,22.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:23.3,23.18 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:23.18,25.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:27.2,27.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:31.39,33.17 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:33.17,36.30 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:20.3,20.17 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:20.17,22.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:23.3,23.18 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:23.18,25.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:27.2,27.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:31.39,33.17 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:33.17,36.30 2 11 github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:36.30,38.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:38.9,40.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:42.2,42.12 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:38.9,40.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0162.Find-Peak-Element/162. Find Peak Element.go:42.2,42.12 1 8 github.com/halfrost/LeetCode-Go/leetcode/0164.Maximum-Gap/164. Maximum Gap.go:4.33,5.19 1 6 github.com/halfrost/LeetCode-Go/leetcode/0164.Maximum-Gap/164. Maximum Gap.go:5.19,7.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0164.Maximum-Gap/164. Maximum Gap.go:8.2,10.35 3 4 @@ -2188,18 +2174,18 @@ github.com/halfrost/LeetCode-Go/leetcode/0164.Maximum-Gap/164. Maximum Gap.go:75 github.com/halfrost/LeetCode-Go/leetcode/0164.Maximum-Gap/164. Maximum Gap.go:78.28,79.11 1 28 github.com/halfrost/LeetCode-Go/leetcode/0164.Maximum-Gap/164. Maximum Gap.go:79.11,81.3 1 10 github.com/halfrost/LeetCode-Go/leetcode/0164.Maximum-Gap/164. Maximum Gap.go:82.2,82.10 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:4.49,6.12 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:6.12,7.38 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:7.38,9.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:10.3,10.37 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:10.37,12.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:4.49,6.12 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:6.12,7.38 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:7.38,9.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:10.3,10.37 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:10.37,12.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:12.9,14.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:16.2,16.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:20.51,22.36 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:22.36,24.32 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:24.32,26.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:27.3,27.20 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:29.2,29.12 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:16.2,16.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:20.51,22.36 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:22.36,24.32 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:24.32,26.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:27.3,27.20 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted.go:29.2,29.12 1 1 github.com/halfrost/LeetCode-Go/leetcode/0168.Excel-Sheet-Column-Title/168. Excel Sheet Column Title.go:3.35,5.12 2 6 github.com/halfrost/LeetCode-Go/leetcode/0168.Excel-Sheet-Column-Title/168. Excel Sheet Column Title.go:5.12,8.3 2 13 github.com/halfrost/LeetCode-Go/leetcode/0168.Excel-Sheet-Column-Title/168. Excel Sheet Column Title.go:9.2,9.55 1 6 @@ -2212,10 +2198,10 @@ github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Ele github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Element.go:10.22,12.5 1 2 github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Element.go:12.10,14.5 1 5 github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Element.go:17.2,17.12 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Element.go:21.39,23.25 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Element.go:21.39,23.25 2 5 github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Element.go:23.25,25.25 2 13 github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Element.go:25.25,27.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Element.go:29.2,29.10 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0169.Majority-Element/169. Majority Element.go:29.2,29.10 1 1 github.com/halfrost/LeetCode-Go/leetcode/0171.Excel-Sheet-Column-Number/171. Excel Sheet Column Number.go:3.34,5.30 2 4 github.com/halfrost/LeetCode-Go/leetcode/0171.Excel-Sheet-Column-Number/171. Excel Sheet Column Number.go:5.30,8.3 2 8 github.com/halfrost/LeetCode-Go/leetcode/0171.Excel-Sheet-Column-Number/171. Excel Sheet Column Number.go:9.2,9.12 1 4 @@ -2234,8 +2220,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0173.Binary-Search-Tree-Iterator/173. B github.com/halfrost/LeetCode-Go/leetcode/0173.Binary-Search-Tree-Iterator/173. Binary Search Tree Iterator.go:73.45,75.2 1 8 github.com/halfrost/LeetCode-Go/leetcode/0173.Binary-Search-Tree-Iterator/173. Binary Search Tree Iterator.go:77.51,80.2 2 5 github.com/halfrost/LeetCode-Go/leetcode/0173.Binary-Search-Tree-Iterator/173. Binary Search Tree Iterator.go:82.49,87.2 4 5 -github.com/halfrost/LeetCode-Go/leetcode/0174.Dungeon-Game/174. Dungeon Game.go:6.46,7.23 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0174.Dungeon-Game/174. Dungeon Game.go:7.23,9.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0174.Dungeon-Game/174. Dungeon Game.go:6.46,7.23 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0174.Dungeon-Game/174. Dungeon Game.go:7.23,9.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0174.Dungeon-Game/174. Dungeon Game.go:10.2,12.25 3 4 github.com/halfrost/LeetCode-Go/leetcode/0174.Dungeon-Game/174. Dungeon Game.go:12.25,14.3 1 7 github.com/halfrost/LeetCode-Go/leetcode/0174.Dungeon-Game/174. Dungeon Game.go:15.2,16.30 2 4 @@ -2286,8 +2272,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0179.Largest-Number/179. Largest Number github.com/halfrost/LeetCode-Go/leetcode/0179.Largest-Number/179. Largest Number.go:44.46,45.14 1 40 github.com/halfrost/LeetCode-Go/leetcode/0179.Largest-Number/179. Largest Number.go:45.14,47.3 1 24 github.com/halfrost/LeetCode-Go/leetcode/0179.Largest-Number/179. Largest Number.go:48.2,50.29 3 16 -github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:4.50,5.17 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:5.17,7.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:4.50,5.17 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:5.17,7.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:8.2,10.25 3 1 github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:10.25,12.3 1 9 github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:13.2,13.30 1 1 @@ -2296,8 +2282,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeat github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:17.9,17.26 1 2 github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:17.26,20.4 2 2 github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:22.2,22.15 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:26.51,27.17 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:27.17,29.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:26.51,27.17 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:27.17,29.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:30.2,31.34 2 1 github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:31.34,33.23 2 23 github.com/halfrost/LeetCode-Go/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences.go:33.23,35.4 1 2 @@ -2316,26 +2302,26 @@ github.com/halfrost/LeetCode-Go/leetcode/0191.Number-of-1-Bits/191. Number of 1 github.com/halfrost/LeetCode-Go/leetcode/0191.Number-of-1-Bits/191. Number of 1 Bits.go:11.37,13.15 2 2 github.com/halfrost/LeetCode-Go/leetcode/0191.Number-of-1-Bits/191. Number of 1 Bits.go:13.15,16.3 2 5 github.com/halfrost/LeetCode-Go/leetcode/0191.Number-of-1-Bits/191. Number of 1 Bits.go:17.2,17.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:4.29,6.12 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:6.12,8.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:9.2,9.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:9.12,11.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:13.2,15.25 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:15.25,17.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:18.2,18.16 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:21.28,22.11 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:22.11,24.3 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:25.2,25.10 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:29.31,31.12 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:31.12,33.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:34.2,35.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:35.25,39.3 3 11 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:40.2,40.15 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:44.26,48.33 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:48.33,49.15 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:49.15,51.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:4.29,6.12 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:6.12,8.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:9.2,9.12 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:9.12,11.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:13.2,15.25 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:15.25,17.3 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:18.2,18.16 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:21.28,22.11 1 45 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:22.11,24.3 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:25.2,25.10 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:29.31,31.12 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:31.12,33.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:34.2,35.25 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:35.25,39.3 3 12 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:40.2,40.15 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:44.26,48.33 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:48.33,49.15 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:49.15,51.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:51.9,53.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:55.2,55.18 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0198.House-Robber/198. House Robber.go:55.2,55.18 1 5 github.com/halfrost/LeetCode-Go/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View.go:19.42,21.17 2 4 github.com/halfrost/LeetCode-Go/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View.go:21.17,23.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View.go:24.2,25.21 2 3 @@ -2346,10 +2332,10 @@ github.com/halfrost/LeetCode-Go/leetcode/0199.Binary-Tree-Right-Side-View/199. B github.com/halfrost/LeetCode-Go/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View.go:31.29,33.5 1 4 github.com/halfrost/LeetCode-Go/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View.go:35.3,36.20 2 7 github.com/halfrost/LeetCode-Go/leetcode/0199.Binary-Tree-Right-Side-View/199. Binary Tree Right Side View.go:38.2,38.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:10.36,12.12 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:12.12,14.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:15.2,16.12 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:16.12,18.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:10.36,12.12 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:12.12,14.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:15.2,16.12 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:16.12,18.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:19.2,20.25 2 2 github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:20.25,22.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/0200.Number-of-Islands/200. Number of Islands.go:23.2,23.25 1 2 @@ -2371,7 +2357,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0201.Bitwise-AND-of-Numbers-Range/201. github.com/halfrost/LeetCode-Go/leetcode/0201.Bitwise-AND-of-Numbers-Range/201. Bitwise AND of Numbers Range.go:22.2,22.10 1 2 github.com/halfrost/LeetCode-Go/leetcode/0202.Happy-Number/202. Happy Number.go:3.26,5.13 2 4 github.com/halfrost/LeetCode-Go/leetcode/0202.Happy-Number/202. Happy Number.go:5.13,8.35 3 40 -github.com/halfrost/LeetCode-Go/leetcode/0202.Happy-Number/202. Happy Number.go:8.35,9.21 1 241 +github.com/halfrost/LeetCode-Go/leetcode/0202.Happy-Number/202. Happy Number.go:8.35,9.21 1 227 github.com/halfrost/LeetCode-Go/leetcode/0202.Happy-Number/202. Happy Number.go:9.21,11.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/0202.Happy-Number/202. Happy Number.go:14.2,14.13 1 1 github.com/halfrost/LeetCode-Go/leetcode/0202.Happy-Number/202. Happy Number.go:17.35,20.21 3 40 @@ -2394,14 +2380,14 @@ github.com/halfrost/LeetCode-Go/leetcode/0204.Count-Primes/204. Count Primes.go: github.com/halfrost/LeetCode-Go/leetcode/0204.Count-Primes/204. Count Primes.go:14.25,15.21 1 1104 github.com/halfrost/LeetCode-Go/leetcode/0204.Count-Primes/204. Count Primes.go:15.21,17.4 1 197 github.com/halfrost/LeetCode-Go/leetcode/0204.Count-Primes/204. Count Primes.go:19.2,19.14 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:3.44,6.64 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:6.64,8.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:10.2,12.36 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:12.36,13.28 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:13.28,14.41 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:14.41,17.5 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:17.10,18.34 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:18.34,20.6 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:3.44,6.64 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:6.64,8.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:10.2,12.36 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:12.36,13.28 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:13.28,14.41 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:14.41,17.5 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:17.10,18.34 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:18.34,20.6 1 1 github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:22.9,23.33 1 3 github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:23.33,25.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings.go:28.2,28.13 1 3 @@ -2424,21 +2410,21 @@ github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Im github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:17.43,19.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:19.9,23.4 3 5 github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:25.2,25.22 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:29.44,31.26 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:31.26,32.43 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:29.44,31.26 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:31.26,32.43 1 12 github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:32.43,34.12 2 11 -github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:36.3,36.15 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:36.3,36.15 1 1 github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:38.2,38.22 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:42.50,44.28 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:44.28,45.43 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:42.50,44.28 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:44.28,45.43 1 4 github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:45.43,47.12 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:49.3,49.15 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:49.3,49.15 1 1 github.com/halfrost/LeetCode-Go/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree).go:51.2,51.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:3.49,5.29 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:5.29,7.21 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:3.49,5.29 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:5.29,7.21 2 10 github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:7.21,11.4 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:13.2,13.24 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:13.24,15.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:13.2,13.24 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:13.24,15.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:16.2,16.12 1 1 github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:19.28,20.11 1 5 github.com/halfrost/LeetCode-Go/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum.go:20.11,22.3 1 3 @@ -2456,21 +2442,21 @@ github.com/halfrost/LeetCode-Go/leetcode/0210.Course-Schedule-II/210. Course Sch github.com/halfrost/LeetCode-Go/leetcode/0210.Course-Schedule-II/210. Course Schedule II.go:26.29,28.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0210.Course-Schedule-II/210. Course Schedule II.go:29.2,29.16 1 2 github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:9.38,11.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:14.50,16.26 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:16.26,17.43 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:17.43,19.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:19.9,23.4 3 9 -github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:25.2,25.22 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:29.54,31.26 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:14.50,16.26 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:16.26,17.43 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:17.43,19.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:19.9,23.4 3 10 +github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:25.2,25.22 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:29.54,31.26 2 10 github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:31.26,32.22 1 14 github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:32.22,34.38 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:34.38,35.29 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:35.29,37.6 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:34.38,35.29 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:35.29,37.6 1 6 github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:39.4,39.20 1 3 github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:40.9,40.53 1 11 github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:40.53,42.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:43.3,43.37 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:45.2,45.51 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure.go:45.2,45.51 1 6 github.com/halfrost/LeetCode-Go/leetcode/0212.Word-Search-II/212. Word Search II.go:3.57,5.26 2 2 github.com/halfrost/LeetCode-Go/leetcode/0212.Word-Search-II/212. Word Search II.go:5.26,6.22 1 7 github.com/halfrost/LeetCode-Go/leetcode/0212.Word-Search-II/212. Word Search II.go:6.22,8.4 1 4 @@ -2491,10 +2477,10 @@ github.com/halfrost/LeetCode-Go/leetcode/0212.Word-Search-II/212. Word Search II github.com/halfrost/LeetCode-Go/leetcode/0212.Word-Search-II/212. Word Search II.go:49.105,51.5 1 12 github.com/halfrost/LeetCode-Go/leetcode/0212.Word-Search-II/212. Word Search II.go:53.3,53.24 1 8 github.com/halfrost/LeetCode-Go/leetcode/0212.Word-Search-II/212. Word Search II.go:55.2,55.14 1 79 -github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:3.29,5.12 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:5.12,7.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:8.2,8.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:8.12,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:3.29,5.12 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:5.12,7.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:8.2,8.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:8.12,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:11.2,11.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:11.12,13.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:15.2,15.60 1 2 @@ -2506,27 +2492,27 @@ github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber github.com/halfrost/LeetCode-Go/leetcode/0213.House-Robber-II/213. House Robber II.go:33.2,33.10 1 7 github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:9.45,12.2 2 6 github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:16.44,19.2 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:21.50,22.12 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:22.12,24.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:25.2,27.12 3 11 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:27.12,29.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:30.2,30.11 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:30.11,32.3 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:32.8,34.3 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:37.42,43.25 4 26 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:43.25,44.25 1 207 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:44.25,47.4 2 113 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:49.2,50.14 2 26 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:21.50,22.12 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:22.12,24.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:25.2,27.12 3 15 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:27.12,29.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:30.2,30.11 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:30.11,32.3 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:32.8,34.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:37.42,43.25 4 32 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:43.25,44.25 1 218 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:44.25,47.4 2 138 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:49.2,50.14 2 32 github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:54.46,56.2 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:59.53,60.12 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:60.12,62.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:63.2,65.12 3 15 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:65.12,67.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:68.2,68.11 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:68.11,70.3 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:70.8,72.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0216.Combination-Sum-III/216. Combination Sum III.go:3.44,4.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0216.Combination-Sum-III/216. Combination Sum III.go:4.12,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:59.53,60.12 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:60.12,62.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:63.2,65.12 3 17 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:65.12,67.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:68.2,68.11 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:68.11,70.3 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0215.Kth-Largest-Element-in-an-Array/215. Kth Largest Element in an Array.go:70.8,72.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0216.Combination-Sum-III/216. Combination Sum III.go:3.44,4.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0216.Combination-Sum-III/216. Combination Sum III.go:4.12,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0216.Combination-Sum-III/216. Combination Sum III.go:7.2,9.12 3 2 github.com/halfrost/LeetCode-Go/leetcode/0216.Combination-Sum-III/216. Combination Sum III.go:12.71,13.17 1 52 github.com/halfrost/LeetCode-Go/leetcode/0216.Combination-Sum-III/216. Combination Sum III.go:13.17,14.18 1 13 @@ -2540,128 +2526,128 @@ github.com/halfrost/LeetCode-Go/leetcode/0217.Contains-Duplicate/217. Contains D github.com/halfrost/LeetCode-Go/leetcode/0217.Contains-Duplicate/217. Contains Duplicate.go:6.35,8.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0217.Contains-Duplicate/217. Contains Duplicate.go:9.3,9.19 1 8 github.com/halfrost/LeetCode-Go/leetcode/0217.Contains-Duplicate/217. Contains Duplicate.go:11.2,11.14 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:19.44,21.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:21.25,23.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:24.2,26.30 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:26.30,29.3 2 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:30.2,30.44 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:30.44,31.47 1 53 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:31.47,33.4 1 23 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:34.3,34.49 1 30 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:36.2,38.38 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:38.38,40.3 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:41.2,41.38 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:41.38,43.26 2 32 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:43.26,45.4 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:46.3,47.56 2 32 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:47.56,48.54 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:48.54,50.5 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:50.10,52.5 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:55.2,55.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:64.50,66.2 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:69.55,70.43 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:70.43,72.3 1 29 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:76.52,78.55 2 32 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:78.55,80.3 1 74 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:81.2,81.12 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:85.45,89.34 4 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:89.34,91.3 1 150 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:92.2,92.30 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:92.30,94.3 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:95.2,95.32 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:95.32,97.31 2 23 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:97.31,100.4 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:100.9,100.38 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:100.38,102.4 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:103.3,103.17 1 23 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:105.2,105.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:108.64,110.32 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:110.32,114.3 3 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:115.2,115.24 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:115.24,117.3 1 23 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:118.2,119.31 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:119.31,121.3 1 23 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:122.2,122.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:125.28,126.11 1 253 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:126.11,128.3 1 77 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:129.2,129.10 1 176 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:133.45,136.30 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:136.30,146.3 7 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:147.2,148.37 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:148.37,149.25 1 60 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:149.25,150.26 1 27 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:150.26,151.21 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:19.44,21.25 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:21.25,23.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:24.2,26.30 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:26.30,29.3 2 23 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:30.2,30.44 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:30.44,31.47 1 89 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:31.47,33.4 1 35 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:34.3,34.49 1 54 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:36.2,38.38 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:38.38,40.3 1 46 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:41.2,41.38 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:41.38,43.26 2 46 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:43.26,45.4 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:46.3,47.56 2 46 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:47.56,48.54 1 27 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:48.54,50.5 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:50.10,52.5 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:55.2,55.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:64.50,66.2 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:69.55,70.43 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:70.43,72.3 1 45 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:76.52,78.55 2 46 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:78.55,80.3 1 105 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:81.2,81.12 1 46 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:85.45,89.34 4 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:89.34,91.3 1 263 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:92.2,92.30 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:92.30,94.3 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:95.2,95.32 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:95.32,97.31 2 32 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:97.31,100.4 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:100.9,100.38 1 28 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:100.38,102.4 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:103.3,103.17 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:105.2,105.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:108.64,110.32 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:110.32,114.3 3 23 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:115.2,115.24 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:115.24,117.3 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:118.2,119.31 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:119.31,121.3 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:122.2,122.25 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:125.28,126.11 1 413 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:126.11,128.3 1 100 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:129.2,129.10 1 313 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:133.45,136.30 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:136.30,146.3 7 23 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:147.2,148.37 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:148.37,149.25 1 104 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:149.25,150.26 1 40 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:150.26,151.21 1 31 github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:151.21,153.6 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:154.5,154.29 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:154.5,154.29 1 21 github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:156.4,156.28 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:158.3,158.27 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:160.2,161.23 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:161.23,163.15 2 32 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:163.15,164.18 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:164.18,166.5 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:167.4,167.22 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:168.9,171.16 3 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:171.16,173.5 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:176.2,176.16 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:202.29,209.2 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:220.38,222.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:222.25,224.3 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:225.2,229.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:233.42,239.2 5 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:242.34,243.17 1 48 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:243.17,245.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:246.2,246.25 1 38 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:250.38,256.2 5 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:258.34,259.21 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:259.21,261.36 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:261.36,263.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:264.3,264.19 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:158.3,158.27 1 64 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:160.2,161.23 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:161.23,163.15 2 46 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:163.15,164.18 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:164.18,166.5 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:167.4,167.22 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:168.9,171.16 3 23 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:171.16,173.5 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:176.2,176.16 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:202.29,209.2 1 46 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:220.38,222.25 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:222.25,224.3 1 31 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:225.2,229.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:233.42,239.2 5 31 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:242.34,243.17 1 72 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:243.17,245.3 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:246.2,246.25 1 60 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:250.38,256.2 5 25 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:258.34,259.21 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:259.21,261.36 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:261.36,263.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:264.3,264.19 1 5 github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:264.19,265.9 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:267.3,268.8 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:272.34,273.12 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:273.12,275.19 2 13 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:275.19,276.9 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:278.3,279.8 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:283.37,287.2 3 20 -github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:289.42,291.2 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:3.54,4.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:4.20,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:7.2,7.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:7.12,9.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:267.3,268.8 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:272.34,273.12 1 31 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:273.12,275.19 2 30 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:275.19,276.9 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:278.3,279.8 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:283.37,287.2 3 42 +github.com/halfrost/LeetCode-Go/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem.go:289.42,291.2 1 39 +github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:3.54,4.20 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:4.20,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:7.2,7.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:7.12,9.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:10.2,11.25 2 3 github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:11.25,12.35 1 13 github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:12.35,14.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:15.3,16.25 2 11 github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:16.25,18.4 1 5 github.com/halfrost/LeetCode-Go/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II.go:20.2,20.14 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:4.67,5.38 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:5.38,7.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:8.2,9.33 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:9.33,13.18 2 19 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:13.18,15.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:16.3,16.32 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:4.67,5.38 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:5.38,7.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:8.2,9.33 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:9.33,13.18 2 27 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:13.18,15.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:16.3,16.32 1 27 github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:16.32,18.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:20.3,20.52 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:20.52,22.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:24.3,24.52 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:24.52,26.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:28.3,28.24 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:20.3,20.52 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:20.52,22.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:24.3,24.52 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:24.52,26.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:28.3,28.24 1 21 github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:28.24,30.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:31.3,31.25 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:33.2,33.14 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:37.68,38.20 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:38.20,40.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:41.2,41.12 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:41.12,43.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:44.2,45.25 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:45.25,47.43 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:47.43,48.33 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:48.33,50.5 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:51.4,51.11 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:54.2,54.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:57.21,58.11 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:58.11,60.3 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:61.2,61.11 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:31.3,31.25 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:33.2,33.14 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:37.68,38.20 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:38.20,40.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:41.2,41.12 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:41.12,43.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:44.2,45.25 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:45.25,47.43 2 21 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:47.43,48.33 1 24 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:48.33,50.5 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:51.4,51.11 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:54.2,54.14 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:57.21,58.11 1 24 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:58.11,60.3 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III.go:61.2,61.11 1 15 github.com/halfrost/LeetCode-Go/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes.go:19.37,20.17 1 4 github.com/halfrost/LeetCode-Go/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes.go:20.17,22.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes.go:23.2,26.22 4 3 @@ -2674,67 +2660,67 @@ github.com/halfrost/LeetCode-Go/leetcode/0222.Count-Complete-Tree-Nodes/222. Cou github.com/halfrost/LeetCode-Go/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes.go:40.3,40.18 1 10 github.com/halfrost/LeetCode-Go/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes.go:40.18,44.4 3 6 github.com/halfrost/LeetCode-Go/leetcode/0222.Count-Complete-Tree-Nodes/222. Count Complete Tree Nodes.go:46.2,46.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:3.78,6.2 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:8.35,10.22 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:10.22,12.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:13.2,13.14 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:16.28,17.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:3.78,6.2 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:8.35,10.22 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:10.22,12.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:13.2,13.14 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:16.28,17.11 1 4 github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:17.11,19.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:20.2,20.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:23.28,24.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:20.2,20.10 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:23.28,24.11 1 4 github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:24.11,26.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:27.2,27.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:10.30,12.17 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:12.17,13.18 1 40 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:13.18,15.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:15.9,15.40 1 34 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:15.40,17.55 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:17.55,20.5 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:21.4,22.7 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:23.9,23.25 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:23.25,26.4 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:26.9,26.25 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:26.25,29.4 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:29.9,29.25 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:29.25,35.4 5 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:35.9,35.25 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:35.25,38.4 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:40.2,40.15 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:44.31,46.30 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:46.30,47.18 1 40 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:47.18,48.12 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:49.9,49.25 1 34 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:49.25,51.30 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:51.30,52.28 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:52.28,53.11 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:56.4,59.34 4 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:59.34,61.5 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:62.9,64.4 1 30 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:66.2,67.36 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:70.35,73.32 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:73.32,74.56 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:74.56,75.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:76.9,76.63 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:76.63,78.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:78.9,78.63 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:78.63,79.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:80.9,80.63 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:80.63,82.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:82.9,84.4 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:86.2,88.32 3 8 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:88.32,89.24 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:89.24,91.4 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:91.9,96.4 4 11 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:98.2,98.18 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:98.18,101.3 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:102.2,103.30 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:103.30,104.18 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:104.18,106.4 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:106.9,108.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:110.2,111.12 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:114.29,115.26 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:115.26,117.3 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:118.2,118.14 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0223.Rectangle-Area/223. Rectangle Area.go:27.2,27.10 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:10.30,12.17 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:12.17,13.18 1 60 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:13.18,15.4 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:15.9,15.40 1 50 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:15.40,17.55 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:17.55,20.5 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:21.4,22.7 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:23.9,23.25 1 28 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:23.25,26.4 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:26.9,26.25 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:26.25,29.4 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:29.9,29.25 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:29.25,35.4 5 6 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:35.9,35.25 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:35.25,38.4 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:40.2,40.15 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:44.31,46.30 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:46.30,47.18 1 86 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:47.18,48.12 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:49.9,49.25 1 76 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:49.25,51.30 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:51.30,52.28 1 37 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:52.28,53.11 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:56.4,59.34 4 8 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:59.34,61.5 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:62.9,64.4 1 68 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:66.2,67.36 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:70.35,73.32 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:73.32,74.56 1 73 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:74.56,75.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:76.9,76.63 1 72 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:76.63,78.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:78.9,78.63 1 71 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:78.63,79.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:80.9,80.63 1 70 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:80.63,82.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:82.9,84.4 1 68 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:86.2,88.32 3 18 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:88.32,89.24 1 68 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:89.24,91.4 1 46 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:91.9,96.4 4 22 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:98.2,98.18 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:98.18,101.3 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:102.2,103.30 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:103.30,104.18 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:104.18,106.4 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:106.9,108.4 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:110.2,111.12 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:114.29,115.26 1 68 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:115.26,117.3 1 46 +github.com/halfrost/LeetCode-Go/leetcode/0224.Basic-Calculator/224. Basic Calculator.go:118.2,118.14 1 22 github.com/halfrost/LeetCode-Go/leetcode/0225.Implement-Stack-using-Queues/225. Implement Stack using Queues.go:9.31,11.2 1 1 github.com/halfrost/LeetCode-Go/leetcode/0225.Implement-Stack-using-Queues/225. Implement Stack using Queues.go:14.34,16.2 1 2 github.com/halfrost/LeetCode-Go/leetcode/0225.Implement-Stack-using-Queues/225. Implement Stack using Queues.go:19.32,21.32 2 2 @@ -2767,36 +2753,36 @@ github.com/halfrost/LeetCode-Go/leetcode/0228.Summary-Ranges/228. Summary Ranges github.com/halfrost/LeetCode-Go/leetcode/0228.Summary-Ranges/228. Summary Ranges.go:13.18,15.4 1 4 github.com/halfrost/LeetCode-Go/leetcode/0228.Summary-Ranges/228. Summary Ranges.go:16.3,16.23 1 9 github.com/halfrost/LeetCode-Go/leetcode/0228.Summary-Ranges/228. Summary Ranges.go:18.2,18.8 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:4.43,9.27 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:9.27,10.24 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:4.43,9.27 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:9.27,10.24 1 20 github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:10.24,12.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:12.9,12.31 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:12.31,14.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:14.9,14.25 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:14.25,17.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:17.9,17.25 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:12.9,12.31 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:12.31,14.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:14.9,14.25 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:14.25,17.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:17.9,17.25 1 5 github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:17.25,20.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:20.9,24.4 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:27.2,28.27 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:28.27,29.24 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:29.24,31.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:31.9,31.31 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:31.31,33.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:35.2,36.44 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:20.9,24.4 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:27.2,28.27 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:28.27,29.24 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:29.24,31.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:31.9,31.31 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:31.31,33.4 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:35.2,36.44 2 4 github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:36.44,38.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:39.2,39.23 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:39.2,39.23 1 3 github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:39.23,41.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:42.2,42.23 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:42.23,44.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:45.2,45.16 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:49.45,51.27 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:51.27,52.26 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:52.26,54.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:54.9,56.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:58.2,58.22 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:58.22,59.22 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:59.22,61.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:63.2,63.15 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:42.2,42.23 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:42.23,44.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:45.2,45.16 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:49.45,51.27 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:51.27,52.26 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:52.26,54.4 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:54.9,56.4 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:58.2,58.22 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:58.22,59.22 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:59.22,61.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0229.Majority-Element-II/229. Majority Element II.go:63.2,63.15 1 4 github.com/halfrost/LeetCode-Go/leetcode/0230.Kth-Smallest-Element-in-a-BST/230. Kth Smallest Element in a BST.go:19.45,23.2 3 3 github.com/halfrost/LeetCode-Go/leetcode/0230.Kth-Smallest-Element-in-a-BST/230. Kth Smallest Element in a BST.go:25.62,26.17 1 17 github.com/halfrost/LeetCode-Go/leetcode/0230.Kth-Smallest-Element-in-a-BST/230. Kth Smallest Element in a BST.go:26.17,29.18 3 8 @@ -2810,17 +2796,17 @@ github.com/halfrost/LeetCode-Go/leetcode/0231.Power-of-Two/231. Power of Two.go: github.com/halfrost/LeetCode-Go/leetcode/0231.Power-of-Two/231. Power of Two.go:23.17,25.4 1 5 github.com/halfrost/LeetCode-Go/leetcode/0231.Power-of-Two/231. Power of Two.go:25.9,27.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0231.Power-of-Two/231. Power of Two.go:29.2,29.17 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:9.31,12.2 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:15.34,17.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:9.31,12.2 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:15.34,17.2 1 4 github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:20.32,21.27 1 1 github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:21.27,23.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:25.2,27.15 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:31.33,32.27 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:32.27,34.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:36.2,36.42 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:31.33,32.27 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:32.27,34.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:36.2,36.42 1 2 github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:40.35,42.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:44.52,45.18 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:45.18,50.3 3 2 +github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:44.52,45.18 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks.go:45.18,50.3 3 4 github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:19.40,21.18 2 10 github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:21.18,24.3 2 45 github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:25.2,25.38 1 10 @@ -2842,34 +2828,34 @@ github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palind github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:73.21,74.36 1 6 github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:74.36,76.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:78.2,78.12 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:82.33,84.18 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:84.18,87.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:88.2,88.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:19.59,20.41 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:82.33,84.18 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:84.18,87.3 2 45 +github.com/halfrost/LeetCode-Go/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List.go:88.2,88.12 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:19.59,20.41 1 6 github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:20.41,22.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:23.2,23.42 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:23.2,23.42 1 5 github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:23.42,25.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:26.2,26.42 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:26.42,28.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:29.2,29.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:19.62,20.43 1 77 -github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:20.43,22.3 1 41 -github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:23.2,25.17 3 36 -github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:25.17,26.19 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:26.19,28.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:29.3,29.14 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:31.2,31.14 1 36 +github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:26.2,26.42 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:26.42,28.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree.go:29.2,29.13 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:19.62,20.43 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:20.43,22.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:23.2,25.17 3 10 +github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:25.17,26.19 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:26.19,28.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:29.3,29.14 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree.go:31.2,31.14 1 6 github.com/halfrost/LeetCode-Go/leetcode/0237.Delete-Node-in-a-Linked-List/237. Delete Node in a Linked List.go:17.33,20.2 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:4.46,7.12 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:7.12,9.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:10.2,10.28 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:4.46,7.12 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:7.12,9.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:10.2,10.28 1 2 github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:10.28,12.26 2 6 github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:12.26,13.20 1 12 github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:13.20,15.5 1 6 github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:17.3,17.25 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:20.2,20.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:24.48,25.37 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:25.37,27.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:20.2,20.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:24.48,25.37 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:25.37,27.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:28.2,30.25 3 1 github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:30.25,31.33 1 8 github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:31.33,33.4 1 1 @@ -2878,8 +2864,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Slidin github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:37.3,38.15 2 8 github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:38.15,40.4 1 6 github.com/halfrost/LeetCode-Go/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum.go:42.2,42.15 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:4.55,5.22 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:5.22,7.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:4.55,5.22 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:5.22,7.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:8.2,9.39 2 2 github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:9.39,10.33 1 14 github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:10.33,12.4 1 1 @@ -2887,8 +2873,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:12.39,14.4 1 6 github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:14.9,16.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:18.2,18.14 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:22.56,23.22 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:23.22,25.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:22.56,23.22 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:23.22,25.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:26.2,26.29 1 2 github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:26.29,28.19 2 7 github.com/halfrost/LeetCode-Go/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II.go:28.19,30.25 2 21 @@ -2912,7 +2898,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0242.Valid-Anagram/242. Valid Anagram.g github.com/halfrost/LeetCode-Go/leetcode/0242.Valid-Anagram/242. Valid Anagram.go:31.2,31.26 1 7 github.com/halfrost/LeetCode-Go/leetcode/0242.Valid-Anagram/242. Valid Anagram.go:31.26,33.3 1 16 github.com/halfrost/LeetCode-Go/leetcode/0242.Valid-Anagram/242. Valid Anagram.go:34.2,34.29 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0242.Valid-Anagram/242. Valid Anagram.go:34.29,35.17 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0242.Valid-Anagram/242. Valid Anagram.go:34.29,35.17 1 14 github.com/halfrost/LeetCode-Go/leetcode/0242.Valid-Anagram/242. Valid Anagram.go:35.17,37.4 1 5 github.com/halfrost/LeetCode-Go/leetcode/0242.Valid-Anagram/242. Valid Anagram.go:39.2,39.13 1 2 github.com/halfrost/LeetCode-Go/leetcode/0257.Binary-Tree-Paths/257. Binary Tree Paths.go:21.47,22.17 1 13 @@ -2961,20 +2947,20 @@ github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:8.13,10.4 github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:10.9,12.4 1 5 github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:14.2,15.26 2 4 github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:15.26,17.17 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:17.17,19.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:21.2,21.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:25.35,28.43 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:28.43,29.39 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:29.39,31.4 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:31.9,32.9 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:35.2,35.15 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:38.40,39.14 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:39.14,41.3 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:42.2,44.26 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:47.44,50.27 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:50.27,51.19 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:51.19,54.4 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:56.2,57.14 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:17.17,19.9 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:22.2,22.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:26.35,29.43 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:29.43,30.39 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:30.39,32.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:32.9,33.9 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:36.2,36.15 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:39.40,40.14 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:40.14,42.3 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:43.2,45.26 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:48.44,51.27 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:51.27,52.19 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:52.19,55.4 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0274.H-Index/274. H-Index.go:57.2,58.14 2 5 github.com/halfrost/LeetCode-Go/leetcode/0275.H-Index-II/275. H-Index II.go:3.37,5.18 2 5 github.com/halfrost/LeetCode-Go/leetcode/0275.H-Index-II/275. H-Index II.go:5.18,7.42 2 9 github.com/halfrost/LeetCode-Go/leetcode/0275.H-Index-II/275. H-Index II.go:7.42,9.4 1 5 @@ -2983,37 +2969,37 @@ github.com/halfrost/LeetCode-Go/leetcode/0275.H-Index-II/275. H-Index II.go:13.2 github.com/halfrost/LeetCode-Go/leetcode/0278.First-Bad-Version/278. First Bad Version.go:13.33,14.47 1 2 github.com/halfrost/LeetCode-Go/leetcode/0278.First-Bad-Version/278. First Bad Version.go:14.47,14.79 1 4 github.com/halfrost/LeetCode-Go/leetcode/0278.First-Bad-Version/278. First Bad Version.go:17.37,19.2 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:5.28,6.24 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:6.24,8.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:9.2,9.21 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:9.21,11.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:5.28,6.24 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:6.24,8.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:9.2,9.21 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:9.21,11.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:12.2,12.28 1 2 github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:12.28,14.25 2 5 github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:14.25,16.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:18.2,18.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:22.34,25.2 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:28.31,29.15 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:22.34,25.2 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:28.31,29.15 1 3 github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:29.15,31.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:32.2,32.17 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0283.Move-Zeroes/283. Move Zeroes.go:3.29,4.20 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0283.Move-Zeroes/283. Move Zeroes.go:4.20,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0279.Perfect-Squares/279. Perfect Squares.go:32.2,32.17 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0283.Move-Zeroes/283. Move Zeroes.go:3.29,4.20 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0283.Move-Zeroes/283. Move Zeroes.go:4.20,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0283.Move-Zeroes/283. Move Zeroes.go:7.2,8.33 2 6 github.com/halfrost/LeetCode-Go/leetcode/0283.Move-Zeroes/283. Move Zeroes.go:8.33,9.19 1 35 github.com/halfrost/LeetCode-Go/leetcode/0283.Move-Zeroes/283. Move Zeroes.go:9.19,10.14 1 12 github.com/halfrost/LeetCode-Go/leetcode/0283.Move-Zeroes/283. Move Zeroes.go:10.14,12.5 1 10 github.com/halfrost/LeetCode-Go/leetcode/0283.Move-Zeroes/283. Move Zeroes.go:13.4,13.7 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:8.38,11.2 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:13.34,16.2 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:24.51,28.2 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:30.45,31.16 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:31.16,33.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:34.2,34.28 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:37.41,38.16 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:38.16,41.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:41.8,43.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:46.41,47.16 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:47.16,49.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:50.2,52.20 3 0 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:8.38,11.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:13.34,16.2 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:24.51,28.2 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:30.45,31.16 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:31.16,33.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:34.2,34.28 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:37.41,38.16 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:38.16,41.3 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:41.8,43.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:46.41,47.16 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:47.16,49.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0284.Peeking-Iterator/284. Peeking Iterator.go:50.2,52.20 3 1 github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:6.36,9.19 3 3 github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:9.19,12.3 2 5 github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:13.2,14.21 2 3 @@ -3027,15 +3013,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Fin github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:31.18,33.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:33.9,35.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:37.2,37.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:41.37,42.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:42.20,44.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:45.2,47.33 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:47.33,48.26 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:48.26,50.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:41.37,42.20 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:42.20,44.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:45.2,47.33 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:47.33,48.26 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:48.26,50.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:50.9,52.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:54.2,54.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0290.Word-Pattern/290. Word Pattern.go:5.51,8.55 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0290.Word-Pattern/290. Word Pattern.go:8.55,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number.go:54.2,54.10 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0290.Word-Pattern/290. Word Pattern.go:5.51,8.55 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0290.Word-Pattern/290. Word Pattern.go:8.55,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0290.Word-Pattern/290. Word Pattern.go:12.2,14.36 3 4 github.com/halfrost/LeetCode-Go/leetcode/0290.Word-Pattern/290. Word Pattern.go:14.36,15.28 1 12 github.com/halfrost/LeetCode-Go/leetcode/0290.Word-Pattern/290. Word Pattern.go:15.28,16.41 1 7 @@ -3055,31 +3041,31 @@ github.com/halfrost/LeetCode-Go/leetcode/0297.Serialize-and-Deserialize-Binary-T github.com/halfrost/LeetCode-Go/leetcode/0297.Serialize-and-Deserialize-Binary-Tree/297.Serialize and Deserialize Binary Tree.go:42.50,43.26 1 20 github.com/halfrost/LeetCode-Go/leetcode/0297.Serialize-and-Deserialize-Binary-Tree/297.Serialize and Deserialize Binary Tree.go:43.26,46.3 2 11 github.com/halfrost/LeetCode-Go/leetcode/0297.Serialize-and-Deserialize-Binary-Tree/297.Serialize and Deserialize Binary Tree.go:47.2,53.3 3 9 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:5.50,11.25 6 4 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:11.25,12.28 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:5.50,11.25 6 5 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:11.25,12.28 1 14 github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:12.28,14.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:14.9,17.4 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:19.2,19.25 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:19.25,20.26 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:20.26,21.18 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:21.18,23.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:23.10,25.5 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:26.4,26.10 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:29.2,30.12 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:6.34,9.34 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:9.34,10.26 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:10.26,11.29 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:11.29,13.5 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:15.3,16.24 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:18.2,18.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:21.28,22.11 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:22.11,24.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:25.2,25.10 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:29.35,31.27 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:31.27,33.19 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:33.19,35.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:35.9,37.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:39.2,39.16 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:14.9,17.4 2 11 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:19.2,19.25 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:19.25,20.26 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:20.26,21.18 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:21.18,23.5 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:23.10,25.5 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:26.4,26.10 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows.go:29.2,30.12 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:6.34,9.34 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:9.34,10.26 1 24 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:10.26,11.29 1 68 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:11.29,13.5 1 40 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:15.3,16.24 2 24 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:18.2,18.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:21.28,22.11 1 64 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:22.11,24.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:25.2,25.10 1 62 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:29.35,31.27 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:31.27,33.19 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:33.19,35.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:35.9,37.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence.go:39.2,39.16 1 2 github.com/halfrost/LeetCode-Go/leetcode/0301.Remove-Invalid-Parentheses/301.Remove Invalid Parentheses.go:12.50,14.22 2 3 github.com/halfrost/LeetCode-Go/leetcode/0301.Remove-Invalid-Parentheses/301.Remove Invalid Parentheses.go:14.22,15.15 1 17 github.com/halfrost/LeetCode-Go/leetcode/0301.Remove-Invalid-Parentheses/301.Remove Invalid Parentheses.go:15.15,18.4 2 7 @@ -3110,32 +3096,32 @@ github.com/halfrost/LeetCode-Go/leetcode/0303.Range-Sum-Query-Immutable/303. Ran github.com/halfrost/LeetCode-Go/leetcode/0303.Range-Sum-Query-Immutable/303. Range Sum Query - Immutable.go:17.35,19.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0303.Range-Sum-Query-Immutable/303. Range Sum Query - Immutable.go:20.2,20.26 1 1 github.com/halfrost/LeetCode-Go/leetcode/0303.Range-Sum-Query-Immutable/303. Range Sum Query - Immutable.go:24.48,26.2 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable.go:7.44,8.22 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable.go:8.22,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable.go:7.44,8.22 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable.go:8.22,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable.go:11.2,13.24 3 1 github.com/halfrost/LeetCode-Go/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable.go:13.24,15.28 2 5 github.com/halfrost/LeetCode-Go/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable.go:15.28,17.4 1 25 github.com/halfrost/LeetCode-Go/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable.go:19.2,19.26 1 1 github.com/halfrost/LeetCode-Go/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable.go:22.78,25.2 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:9.40,10.18 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:10.18,12.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:13.2,13.55 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:13.55,14.36 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:14.36,15.9 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:17.3,18.103 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:18.103,19.56 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:19.56,20.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:22.4,23.55 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:9.40,10.18 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:10.18,12.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:13.2,13.55 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:13.55,14.36 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:14.36,15.9 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:17.3,18.103 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:18.103,19.56 1 31 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:19.56,20.10 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:22.4,23.55 2 26 github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:23.55,25.5 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:28.2,28.14 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:31.28,32.11 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:32.11,34.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:35.2,35.10 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:39.64,40.22 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:28.2,28.14 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:31.28,32.11 1 37 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:32.11,34.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:35.2,35.10 1 31 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:39.64,40.22 1 34 github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:40.22,42.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:43.2,43.56 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:43.56,45.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:46.2,46.14 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:43.2,43.56 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:43.56,45.3 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0306.Additive-Number/306. Additive Number.go:46.2,46.14 1 24 github.com/halfrost/LeetCode-Go/leetcode/0307.Range-Sum-Query-Mutable/307. Range Sum Query - Mutable.go:11.42,13.35 2 3 github.com/halfrost/LeetCode-Go/leetcode/0307.Range-Sum-Query-Mutable/307. Range Sum Query - Mutable.go:13.35,15.3 1 24 github.com/halfrost/LeetCode-Go/leetcode/0307.Range-Sum-Query-Mutable/307. Range Sum Query - Mutable.go:16.2,16.26 1 3 @@ -3156,29 +3142,29 @@ github.com/halfrost/LeetCode-Go/leetcode/0309.Best-Time-to-Buy-and-Sell-Stock-wi github.com/halfrost/LeetCode-Go/leetcode/0309.Best-Time-to-Buy-and-Sell-Stock-with-Cooldown/309. Best Time to Buy and Sell Stock with Cooldown.go:38.2,41.35 3 5 github.com/halfrost/LeetCode-Go/leetcode/0309.Best-Time-to-Buy-and-Sell-Stock-with-Cooldown/309. Best Time to Buy and Sell Stock with Cooldown.go:41.35,44.3 2 19 github.com/halfrost/LeetCode-Go/leetcode/0309.Best-Time-to-Buy-and-Sell-Stock-with-Cooldown/309. Best Time to Buy and Sell Stock with Cooldown.go:45.2,45.32 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:10.37,11.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:11.20,13.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:10.37,11.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:11.20,13.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:14.2,15.33 2 3 github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:15.33,17.3 1 46 github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:18.2,18.28 1 3 github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:18.28,20.3 1 40 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:22.2,25.40 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:25.40,27.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:28.2,28.38 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:28.38,29.24 1 46 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:29.24,32.12 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:34.3,35.39 2 42 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:37.2,37.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:41.38,49.36 6 3 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:49.36,50.33 1 43 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:50.33,53.4 2 37 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:56.2,58.38 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:58.38,61.3 2 46 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:62.2,62.34 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:62.34,64.3 1 23 -github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:65.2,65.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths.go:3.40,4.37 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths.go:4.37,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:22.2,25.30 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:25.30,27.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:28.2,31.38 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:31.38,32.24 1 46 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:32.24,35.12 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:37.3,38.39 2 42 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:40.2,40.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:44.38,52.36 6 3 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:52.36,53.33 1 43 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:53.33,56.4 2 37 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:59.2,61.38 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:61.38,64.3 2 46 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:65.2,65.34 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:65.34,67.3 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go:68.2,68.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths.go:3.40,4.37 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths.go:4.37,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths.go:7.2,8.30 2 3 github.com/halfrost/LeetCode-Go/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths.go:8.30,11.33 3 17 github.com/halfrost/LeetCode-Go/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths.go:11.33,13.4 1 49 @@ -3209,8 +3195,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:20.43,23.4 2 5 github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:23.9,25.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:29.33,31.2 1 79 -github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:33.47,34.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:34.20,36.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:33.47,34.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:34.20,36.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:37.2,37.56 1 3 github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:40.47,41.12 1 11 github.com/halfrost/LeetCode-Go/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II.go:41.12,43.3 1 2 @@ -3236,35 +3222,34 @@ github.com/halfrost/LeetCode-Go/leetcode/0326.Power-of-Three/326. Power of Three github.com/halfrost/LeetCode-Go/leetcode/0326.Power-of-Three/326. Power of Three.go:20.17,22.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0326.Power-of-Three/326. Power of Three.go:22.9,24.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0326.Power-of-Three/326. Power of Three.go:26.2,26.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:10.58,11.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:11.20,13.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:14.2,16.33 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:16.33,19.3 2 12 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:21.2,21.27 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:21.27,23.3 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:25.2,27.39 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:27.39,29.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:31.2,31.38 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:31.38,34.12 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:34.12,36.4 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:36.9,38.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:40.2,40.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:44.59,48.25 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:48.25,51.3 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:53.2,56.28 4 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:56.28,57.33 1 45 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:57.33,60.4 2 23 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:63.2,66.33 4 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:66.33,70.3 3 15 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:71.2,71.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:75.59,77.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:77.25,79.26 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:79.26,80.14 1 48 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:80.14,82.5 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:82.10,84.5 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:85.4,85.36 1 48 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:85.36,87.5 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:90.2,90.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:10.31,12.2 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:15.58,16.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:16.20,18.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:19.2,21.33 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:21.33,24.3 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:26.2,26.27 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:26.27,28.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:30.2,34.38 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:34.38,37.12 2 15 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:37.12,39.4 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:39.9,41.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:43.2,43.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:47.59,51.25 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:51.25,54.3 2 15 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:56.2,59.28 4 4 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:59.28,60.33 1 45 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:60.33,63.4 2 23 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:66.2,69.33 4 4 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:69.33,73.3 3 15 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:74.2,74.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:78.59,80.25 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:80.25,82.26 2 15 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:82.26,83.14 1 48 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:83.14,85.5 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:85.10,87.5 1 33 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:88.4,88.36 1 48 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:88.36,90.5 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go:93.2,93.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0328.Odd-Even-Linked-List/328. Odd Even Linked List.go:18.44,25.18 6 7 github.com/halfrost/LeetCode-Go/leetcode/0328.Odd-Even-Linked-List/328. Odd Even Linked List.go:25.18,26.19 1 31 github.com/halfrost/LeetCode-Go/leetcode/0328.Odd-Even-Linked-List/328. Odd Even Linked List.go:26.19,29.4 2 17 @@ -3305,22 +3290,22 @@ github.com/halfrost/LeetCode-Go/leetcode/0337.House-Robber-III/337. House Robber github.com/halfrost/LeetCode-Go/leetcode/0338.Counting-Bits/338. Counting Bits.go:3.31,5.28 2 2 github.com/halfrost/LeetCode-Go/leetcode/0338.Counting-Bits/338. Counting Bits.go:5.28,7.3 1 7 github.com/halfrost/LeetCode-Go/leetcode/0338.Counting-Bits/338. Counting Bits.go:8.2,8.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:11.44,11.59 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:16.44,16.56 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:19.48,19.49 0 0 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:22.53,22.54 0 0 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:27.54,27.68 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:38.63,42.2 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:44.40,45.21 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:45.21,47.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:48.2,52.12 5 0 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:55.44,57.22 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:57.22,60.27 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:60.27,62.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:62.9,64.23 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:64.23,66.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:67.4,68.48 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:71.2,71.14 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:13.44,13.71 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:18.44,18.67 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:21.47,21.68 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:24.52,26.2 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:31.54,31.74 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:42.63,46.2 3 2 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:48.40,49.21 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:49.21,51.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:52.2,56.12 5 5 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:59.44,61.22 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:61.22,64.27 3 16 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:64.27,66.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:66.9,68.23 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:68.23,70.5 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:71.4,72.48 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go:75.2,75.14 1 3 github.com/halfrost/LeetCode-Go/leetcode/0342.Power-of-Four/342. Power of Four.go:4.34,6.2 1 2 github.com/halfrost/LeetCode-Go/leetcode/0342.Power-of-Four/342. Power of Four.go:9.35,10.15 1 2 github.com/halfrost/LeetCode-Go/leetcode/0342.Power-of-Four/342. Power of Four.go:10.15,11.17 1 3 @@ -3372,8 +3357,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/ github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:17.44,18.32 1 5 github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:18.32,21.3 2 5 github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:22.2,22.22 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:25.51,28.12 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:28.12,30.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:25.51,28.12 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:28.12,30.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:31.2,31.12 1 5 github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:31.12,34.3 2 1 github.com/halfrost/LeetCode-Go/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals.go:35.2,38.25 4 4 @@ -3395,14 +3380,14 @@ github.com/halfrost/LeetCode-Go/leetcode/0354.Russian-Doll-Envelopes/354. Russia github.com/halfrost/LeetCode-Go/leetcode/0354.Russian-Doll-Envelopes/354. Russian Doll Envelopes.go:35.21,37.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0354.Russian-Doll-Envelopes/354. Russian Doll Envelopes.go:37.9,39.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0354.Russian-Doll-Envelopes/354. Russian Doll Envelopes.go:41.2,41.16 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:4.47,6.13 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:6.13,8.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:9.2,9.15 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:13.46,14.12 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:14.12,16.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:17.2,18.35 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:18.35,23.3 4 15 -github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:24.2,24.12 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:4.47,6.13 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:6.13,8.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:9.2,9.15 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:13.46,14.12 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:14.12,16.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:17.2,18.35 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:18.35,23.3 4 24 +github.com/halfrost/LeetCode-Go/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits.go:24.2,24.12 1 7 github.com/halfrost/LeetCode-Go/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square.go:3.36,5.18 2 7 github.com/halfrost/LeetCode-Go/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square.go:5.18,7.21 2 29 github.com/halfrost/LeetCode-Go/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square.go:7.21,9.4 1 3 @@ -3410,24 +3395,24 @@ github.com/halfrost/LeetCode-Go/leetcode/0367.Valid-Perfect-Square/367. Valid Pe github.com/halfrost/LeetCode-Go/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square.go:9.27,11.4 1 11 github.com/halfrost/LeetCode-Go/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square.go:11.9,13.4 1 15 github.com/halfrost/LeetCode-Go/leetcode/0367.Valid-Perfect-Square/367. Valid Perfect Square.go:15.2,15.14 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:5.47,8.20 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:8.20,10.3 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:11.2,12.33 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:12.33,13.30 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:13.30,14.41 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:5.47,8.20 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:8.20,10.3 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:11.2,12.33 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:12.33,13.30 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:13.30,14.41 1 15 github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:14.41,16.5 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:18.3,18.22 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:18.3,18.22 1 8 github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:18.22,20.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:22.2,22.18 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:22.18,24.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:22.2,22.18 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:22.18,24.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:25.2,25.53 1 2 github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:25.53,26.46 1 7 github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:26.46,30.4 3 6 github.com/halfrost/LeetCode-Go/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset.go:32.2,32.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers.go:3.31,4.12 1 66 -github.com/halfrost/LeetCode-Go/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers.go:4.12,6.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers.go:7.2,7.12 1 64 -github.com/halfrost/LeetCode-Go/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers.go:7.12,9.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers.go:3.31,4.12 1 68 +github.com/halfrost/LeetCode-Go/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers.go:4.12,6.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers.go:7.2,7.12 1 65 +github.com/halfrost/LeetCode-Go/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers.go:7.12,9.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers.go:12.2,12.30 1 64 github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:16.35,18.30 2 2 github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:18.30,20.3 1 3 @@ -3437,15 +3422,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:28.12, github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:29.19,31.4 1 9 github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:32.3,33.10 2 15 github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:35.2,35.12 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:40.36,41.17 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:41.17,43.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:44.2,47.29 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:47.29,49.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:51.2,54.27 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:54.27,56.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:57.2,57.21 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:9.62,11.50 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:11.50,13.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:40.36,41.17 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:41.17,43.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:44.2,47.29 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:47.29,49.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:51.2,54.27 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:54.27,56.3 1 30 +github.com/halfrost/LeetCode-Go/leetcode/0372.Super-Pow/372. Super Pow.go:57.2,57.21 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:9.62,11.50 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:11.50,13.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:14.2,14.31 1 7 github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:14.31,16.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:17.2,18.28 2 7 @@ -3459,8 +3444,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/37 github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:35.38,35.65 1 106 github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:37.39,39.2 1 69 github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:41.37,47.2 5 51 -github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:50.63,52.39 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:52.39,54.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:50.63,52.39 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:52.39,54.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:55.2,55.29 1 7 github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:55.29,56.30 1 26 github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums.go:56.30,58.4 1 104 @@ -3472,48 +3457,62 @@ github.com/halfrost/LeetCode-Go/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/37 github.com/halfrost/LeetCode-Go/leetcode/0374.Guess-Number-Higher-or-Lower/374. Guess Number Higher or Lower.go:14.29,15.41 1 4 github.com/halfrost/LeetCode-Go/leetcode/0374.Guess-Number-Higher-or-Lower/374. Guess Number Higher or Lower.go:15.41,15.65 1 9 github.com/halfrost/LeetCode-Go/leetcode/0374.Guess-Number-Higher-or-Lower/374. Guess Number Higher or Lower.go:18.25,20.2 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:3.38,4.19 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:4.19,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:3.38,4.19 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:4.19,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:7.2,9.19 3 3 github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:9.19,11.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:12.2,12.33 1 3 github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:12.33,14.61 2 19 github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:14.61,17.4 2 9 github.com/halfrost/LeetCode-Go/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence.go:19.2,19.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:8.48,11.17 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:11.17,14.46 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:14.46,16.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:16.9,18.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:20.2,20.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:23.57,26.25 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:26.25,28.36 1 24 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:28.36,30.4 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:31.3,31.17 1 24 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:33.2,33.14 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:37.49,38.45 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:38.45,40.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:41.2,43.35 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:43.35,44.39 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:44.39,45.20 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:45.20,47.5 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:47.10,47.45 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:47.45,50.5 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:50.10,51.10 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:55.2,55.27 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:63.24,65.2 1 29 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:67.34,69.2 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:71.29,73.2 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:75.34,78.2 2 11 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:80.33,82.2 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:84.32,87.2 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:3.50,6.31 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:6.31,7.28 1 80 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:7.28,8.18 1 216 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:8.18,10.5 1 204 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:13.2,13.19 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:17.51,18.20 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:18.20,20.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:21.2,23.12 3 1 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:26.76,27.17 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:27.17,28.18 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:28.18,30.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:31.3,31.9 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:33.2,33.33 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:33.33,37.3 3 24 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:8.48,11.17 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:11.17,14.46 2 11 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:14.46,16.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:16.9,18.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:20.2,20.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:23.57,26.25 2 11 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:26.25,28.36 1 30 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:28.36,30.4 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:31.3,31.17 1 30 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:33.2,33.14 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:37.49,38.45 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:38.45,40.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:41.2,43.35 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:43.35,44.39 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:44.39,45.20 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:45.20,47.5 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:47.10,47.45 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:47.45,50.5 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:50.10,51.10 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:55.2,55.27 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:63.24,65.2 1 40 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:67.34,69.2 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:71.29,73.2 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:75.34,78.2 2 14 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:80.33,82.2 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix.go:84.32,87.2 2 4 github.com/halfrost/LeetCode-Go/leetcode/0382.Linked-List-Random-Node/382. Linked List Random Node.go:27.43,29.2 1 1 github.com/halfrost/LeetCode-Go/leetcode/0382.Linked-List-Random-Node/382. Linked List Random Node.go:32.39,34.18 2 6 github.com/halfrost/LeetCode-Go/leetcode/0382.Linked-List-Random-Node/382. Linked List Random Node.go:34.18,35.42 1 60 -github.com/halfrost/LeetCode-Go/leetcode/0382.Linked-List-Random-Node/382. Linked List Random Node.go:35.42,37.4 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0382.Linked-List-Random-Node/382. Linked List Random Node.go:35.42,37.4 1 17 github.com/halfrost/LeetCode-Go/leetcode/0382.Linked-List-Random-Node/382. Linked List Random Node.go:38.3,39.19 2 60 github.com/halfrost/LeetCode-Go/leetcode/0382.Linked-List-Random-Node/382. Linked List Random Node.go:41.2,41.20 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0383.Ransom-Note/383.Ransom Note.go:3.60,4.37 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0383.Ransom-Note/383.Ransom Note.go:4.37,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0383.Ransom-Note/383.Ransom Note.go:3.60,4.37 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0383.Ransom-Note/383.Ransom Note.go:4.37,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0383.Ransom-Note/383.Ransom Note.go:7.2,8.29 2 3 github.com/halfrost/LeetCode-Go/leetcode/0383.Ransom-Note/383.Ransom Note.go:8.29,10.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0383.Ransom-Note/383.Ransom Note.go:11.2,11.31 1 3 @@ -3525,13 +3524,13 @@ github.com/halfrost/LeetCode-Go/leetcode/0384.Shuffle-an-Array/384.Shuffle an Ar github.com/halfrost/LeetCode-Go/leetcode/0384.Shuffle-an-Array/384.Shuffle an Array.go:21.39,24.40 3 2 github.com/halfrost/LeetCode-Go/leetcode/0384.Shuffle-an-Array/384.Shuffle an Array.go:24.40,26.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0384.Shuffle-an-Array/384.Shuffle an Array.go:27.2,27.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:41.41,42.19 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:42.19,44.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:45.2,45.14 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:49.41,51.2 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:54.47,56.2 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:59.49,61.2 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:64.51,66.2 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:41.41,42.19 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:42.19,44.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:45.2,45.14 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:49.41,51.2 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:54.47,56.2 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:59.49,61.2 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:64.51,66.2 1 8 github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:69.32,70.22 1 7 github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:70.22,71.28 1 5 github.com/halfrost/LeetCode-Go/leetcode/0385.Mini-Parser/385. Mini Parser.go:71.28,72.24 1 7 @@ -3561,49 +3560,49 @@ github.com/halfrost/LeetCode-Go/leetcode/0386.Lexicographical-Numbers/386. Lexic github.com/halfrost/LeetCode-Go/leetcode/0386.Lexicographical-Numbers/386. Lexicographical Numbers.go:11.26,13.16 2 13 github.com/halfrost/LeetCode-Go/leetcode/0386.Lexicographical-Numbers/386. Lexicographical Numbers.go:13.16,15.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0386.Lexicographical-Numbers/386. Lexicographical Numbers.go:16.3,16.6 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:4.34,6.30 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:6.30,8.3 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:9.2,9.30 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:9.30,10.28 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:10.28,12.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:14.2,14.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:20.35,22.26 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:22.26,25.3 2 52 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:26.2,26.30 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:26.30,27.33 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:27.33,29.4 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:29.9,31.4 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:33.2,34.26 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:34.26,36.48 1 52 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:4.34,6.30 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:6.30,8.3 1 48 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:9.2,9.30 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:9.30,10.28 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:10.28,12.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:14.2,14.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:20.35,22.26 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:22.26,25.3 2 78 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:26.2,26.30 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:26.30,27.33 1 24 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:27.33,29.4 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:29.9,31.4 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:33.2,34.26 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:34.26,36.48 1 78 github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:36.48,37.27 1 9 github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:37.27,39.5 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:42.2,42.19 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:42.19,44.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:42.2,42.19 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:42.19,44.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String.go:45.2,45.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/0389.Find-the-Difference/389. Find the Difference.go:3.49,5.27 2 1 github.com/halfrost/LeetCode-Go/leetcode/0389.Find-the-Difference/389. Find the Difference.go:5.27,8.3 2 4 github.com/halfrost/LeetCode-Go/leetcode/0389.Find-the-Difference/389. Find the Difference.go:9.2,9.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:3.31,5.12 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:5.12,6.10 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:6.10,8.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:8.9,9.16 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:9.16,11.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:13.3,15.13 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:17.2,17.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:8.48,12.31 4 4 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:12.31,23.3 10 17 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:24.2,26.62 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:3.31,5.12 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:5.12,6.10 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:6.10,8.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:8.9,9.16 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:9.16,11.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:13.3,15.13 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0390.Elimination-Game/390. Elimination Game.go:17.2,17.14 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:8.48,12.31 4 5 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:12.31,23.3 10 24 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:24.2,26.62 1 5 github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:26.62,28.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:29.2,33.24 5 1 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:33.24,34.23 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:34.23,36.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:29.2,33.24 5 2 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:33.24,34.23 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:34.23,36.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:38.2,38.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:41.24,42.11 1 34 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:42.11,44.3 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:45.2,45.10 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:48.24,49.11 1 34 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:49.11,51.3 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:52.2,52.10 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:41.24,42.11 1 48 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:42.11,44.3 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:45.2,45.10 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:48.24,49.11 1 48 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:49.11,51.3 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle.go:52.2,52.10 1 37 github.com/halfrost/LeetCode-Go/leetcode/0392.Is-Subsequence/392. Is Subsequence.go:4.45,6.30 2 4 github.com/halfrost/LeetCode-Go/leetcode/0392.Is-Subsequence/392. Is Subsequence.go:6.30,8.33 2 14 github.com/halfrost/LeetCode-Go/leetcode/0392.Is-Subsequence/392. Is Subsequence.go:8.33,9.24 1 10018 @@ -3617,22 +3616,22 @@ github.com/halfrost/LeetCode-Go/leetcode/0392.Is-Subsequence/392. Is Subsequence github.com/halfrost/LeetCode-Go/leetcode/0392.Is-Subsequence/392. Is Subsequence.go:27.19,29.4 1 11 github.com/halfrost/LeetCode-Go/leetcode/0392.Is-Subsequence/392. Is Subsequence.go:30.3,30.12 1 10018 github.com/halfrost/LeetCode-Go/leetcode/0392.Is-Subsequence/392. Is Subsequence.go:32.2,32.20 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:3.33,5.25 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:5.25,6.17 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:6.17,7.16 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:7.16,9.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:9.10,9.23 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:9.23,11.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:11.10,11.23 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:3.33,5.25 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:5.25,6.17 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:6.17,7.16 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:7.16,9.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:9.10,9.23 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:9.23,11.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:11.10,11.23 1 4 github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:11.23,13.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:13.10,13.23 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:13.10,13.23 1 3 github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:13.23,15.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:15.10,15.22 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:15.22,17.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:18.9,19.28 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:15.10,15.22 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:15.22,17.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:18.9,19.28 1 6 github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:19.28,21.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:22.4,22.11 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:25.2,25.19 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:22.4,22.11 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation.go:25.2,25.19 1 2 github.com/halfrost/LeetCode-Go/leetcode/0394.Decode-String/394. Decode String.go:7.36,9.24 2 4 github.com/halfrost/LeetCode-Go/leetcode/0394.Decode-String/394. Decode String.go:9.24,10.56 1 35 github.com/halfrost/LeetCode-Go/leetcode/0394.Decode-String/394. Decode String.go:10.56,12.4 1 28 @@ -3666,58 +3665,53 @@ github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K- github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:32.4,32.18 1 572 github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:32.18,34.5 1 129 github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:38.2,38.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:41.24,42.11 1 129 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:42.11,44.3 1 76 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:45.2,45.10 1 53 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:49.45,50.13 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:50.13,52.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:53.2,54.23 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:54.23,56.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:57.2,57.28 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:57.28,58.21 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:58.21,60.9 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:63.2,63.16 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:63.16,65.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:66.2,66.57 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:66.57,68.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:69.2,69.12 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:41.24,42.11 1 134 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:42.11,44.3 1 79 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:45.2,45.10 1 55 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:49.45,50.13 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:50.13,52.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:53.2,54.23 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:54.23,56.3 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:57.2,57.28 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:57.28,58.21 1 57 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:58.21,60.9 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:63.2,63.16 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:63.16,65.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:66.2,66.57 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:66.57,68.3 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters.go:69.2,69.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/0396.Rotate-Function/396. Rotate Function.go:3.40,6.27 3 2 github.com/halfrost/LeetCode-Go/leetcode/0396.Rotate-Function/396. Rotate Function.go:6.27,9.3 2 5 github.com/halfrost/LeetCode-Go/leetcode/0396.Rotate-Function/396. Rotate Function.go:10.2,11.25 2 2 github.com/halfrost/LeetCode-Go/leetcode/0396.Rotate-Function/396. Rotate Function.go:11.25,13.14 2 3 github.com/halfrost/LeetCode-Go/leetcode/0396.Rotate-Function/396. Rotate Function.go:13.14,15.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0396.Rotate-Function/396. Rotate Function.go:17.2,17.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:3.36,5.12 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:5.12,6.19 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:6.19,8.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:8.9,8.36 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:3.36,5.12 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:5.12,6.19 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:6.19,8.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:8.9,8.36 1 2 github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:8.36,10.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:10.9,12.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:13.3,13.8 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:15.2,15.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:8.42,9.33 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:10.9,12.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:13.3,13.8 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0397.Integer-Replacement/397. Integer Replacement.go:15.2,15.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:8.42,9.33 1 8 github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:9.33,11.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:12.2,13.19 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:16.50,18.33 2 16 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:18.33,20.3 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:20.8,22.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:23.2,23.12 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:23.12,27.3 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:28.2,28.33 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:28.33,30.3 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:31.2,31.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:34.58,43.2 5 2 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:45.89,47.35 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:47.35,49.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:50.2,50.36 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:50.36,52.34 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:52.34,53.35 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:53.35,54.35 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:54.35,56.6 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:56.11,58.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:59.10,61.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:62.9,64.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:66.2,66.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:12.2,13.19 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:16.50,18.12 2 26 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:18.12,22.3 3 8 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:23.2,23.23 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:26.58,35.2 5 4 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:37.89,39.35 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:39.35,41.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:42.2,42.36 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:42.36,44.34 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:44.34,45.35 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:45.35,46.35 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:46.35,48.6 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:48.11,50.6 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:51.10,53.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:54.9,56.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0399.Evaluate-Division/399. Evaluate Division.go:58.2,58.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/0400.Nth-Digit/400.Nth Digit.go:5.30,6.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/0400.Nth-Digit/400.Nth Digit.go:6.12,8.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0400.Nth-Digit/400.Nth Digit.go:9.2,10.41 2 1 @@ -3738,28 +3732,28 @@ github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go: github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:35.27,36.32 1 720 github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:36.32,38.5 1 10 github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:41.2,41.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:64.41,66.13 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:66.13,68.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:64.41,66.13 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:66.13,68.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:69.2,69.28 1 1 github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:69.28,70.40 1 2 github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:70.40,71.47 1 5 github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:71.47,73.5 1 10 github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:76.2,76.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:86.75,87.17 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:87.17,89.31 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:89.31,92.4 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:93.3,93.15 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:93.15,95.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:95.9,97.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:99.3,100.9 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:102.2,102.29 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:102.29,106.3 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:110.73,111.17 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:111.17,113.31 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:113.31,116.4 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:117.3,120.9 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:122.2,122.29 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:122.29,126.3 3 0 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:86.75,87.17 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:87.17,89.31 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:89.31,92.4 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:93.3,93.15 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:93.15,95.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:95.9,97.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:99.3,100.9 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:102.2,102.29 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:102.29,106.3 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:110.73,111.17 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:111.17,113.31 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:113.31,116.4 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:117.3,120.9 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:122.2,122.29 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0401.Binary-Watch/401. Binary Watch.go:122.29,126.3 3 4 github.com/halfrost/LeetCode-Go/leetcode/0402.Remove-K-Digits/402. Remove K Digits.go:3.46,4.19 1 8 github.com/halfrost/LeetCode-Go/leetcode/0402.Remove-K-Digits/402. Remove K Digits.go:4.19,6.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0402.Remove-K-Digits/402. Remove K Digits.go:7.2,8.32 2 6 @@ -3774,26 +3768,26 @@ github.com/halfrost/LeetCode-Go/leetcode/0404.Sum-of-Left-Leaves/404. Sum of Lef github.com/halfrost/LeetCode-Go/leetcode/0404.Sum-of-Left-Leaves/404. Sum of Left Leaves.go:23.2,23.73 1 3 github.com/halfrost/LeetCode-Go/leetcode/0404.Sum-of-Left-Leaves/404. Sum of Left Leaves.go:23.73,25.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0404.Sum-of-Left-Leaves/404. Sum of Left Leaves.go:26.2,26.65 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:3.28,4.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:4.14,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:7.2,7.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:7.13,9.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:10.2,15.14 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:15.14,18.3 2 10 -github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:19.2,20.40 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:20.40,22.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:23.2,23.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:3.28,4.14 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:4.14,6.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:7.2,7.13 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:7.13,9.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:10.2,15.14 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:15.14,18.3 2 20 +github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:19.2,20.40 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:20.40,22.3 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal.go:23.2,23.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0409.Longest-Palindrome/409. Longest Palindrome.go:3.38,5.22 2 1 github.com/halfrost/LeetCode-Go/leetcode/0409.Longest-Palindrome/409. Longest Palindrome.go:5.22,7.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/0409.Longest-Palindrome/409. Longest Palindrome.go:8.2,9.28 2 1 github.com/halfrost/LeetCode-Go/leetcode/0409.Longest-Palindrome/409. Longest Palindrome.go:9.28,11.32 2 4 github.com/halfrost/LeetCode-Go/leetcode/0409.Longest-Palindrome/409. Longest Palindrome.go:11.32,13.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0409.Longest-Palindrome/409. Longest Palindrome.go:15.2,15.15 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:3.40,5.27 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:5.27,7.19 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:7.19,9.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:11.2,11.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:11.12,13.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:3.40,5.27 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:5.27,7.19 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:7.19,9.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:11.2,11.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:11.12,13.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:14.2,15.17 2 1 github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:15.17,17.27 2 4 github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:17.27,19.4 1 2 @@ -3804,16 +3798,16 @@ github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:30.16,34.19 3 6 github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:34.19,36.5 1 2 github.com/halfrost/LeetCode-Go/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum.go:39.2,39.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:5.31,7.26 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:7.26,9.15 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:9.15,11.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:12.3,12.15 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:12.15,14.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:15.3,15.26 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:15.26,17.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:19.2,19.17 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices.go:3.44,4.16 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices.go:4.16,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:5.31,7.26 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:7.26,9.15 2 15 +github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:9.15,11.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:12.3,12.15 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:12.15,14.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:15.3,15.26 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:15.26,17.4 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0412.Fizz-Buzz/412. Fizz Buzz.go:19.2,19.17 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices.go:3.44,4.16 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices.go:4.16,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices.go:7.2,8.32 2 3 github.com/halfrost/LeetCode-Go/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices.go:8.32,9.33 1 10 github.com/halfrost/LeetCode-Go/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices.go:9.33,12.4 2 9 @@ -3839,8 +3833,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0416.Partition-Equal-Subset-Sum/416. Pa github.com/halfrost/LeetCode-Go/leetcode/0416.Partition-Equal-Subset-Sum/416. Partition Equal Subset Sum.go:16.25,17.33 1 5 github.com/halfrost/LeetCode-Go/leetcode/0416.Partition-Equal-Subset-Sum/416. Partition Equal Subset Sum.go:17.33,19.4 1 18 github.com/halfrost/LeetCode-Go/leetcode/0416.Partition-Equal-Subset-Sum/416. Partition Equal Subset Sum.go:21.2,21.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:5.46,6.45 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:6.45,8.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:5.46,6.45 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:6.45,8.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:9.2,11.27 3 1 github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:11.27,14.3 2 5 github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:15.2,15.27 1 1 @@ -3857,26 +3851,26 @@ github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. P github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:37.2,37.55 1 122 github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:37.55,39.3 1 90 github.com/halfrost/LeetCode-Go/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow.go:40.2,44.52 5 32 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:3.49,4.43 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:4.43,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:7.2,7.23 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:7.23,8.27 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:8.27,9.26 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:9.26,10.38 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:3.49,4.43 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:4.43,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:7.2,7.23 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:7.23,8.27 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:8.27,9.26 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:9.26,10.38 1 8 github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:10.38,11.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:13.5,13.38 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:13.38,14.14 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:16.5,16.10 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:20.2,20.8 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:13.5,13.38 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:13.38,14.14 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:16.5,16.10 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board.go:20.2,20.8 1 3 github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:4.37,12.27 2 1 github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:12.27,17.28 3 32 github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:17.28,21.4 1 192 github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:25.3,26.29 2 32 -github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:26.29,31.39 1 41 +github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:26.29,31.39 1 43 github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:31.39,33.10 2 3 github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:39.2,39.18 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:44.38,45.24 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:45.24,47.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:44.38,45.24 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:45.24,47.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:48.2,49.33 2 1 github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:49.33,50.38 1 6 github.com/halfrost/LeetCode-Go/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array.go:50.38,52.17 2 15 @@ -3896,28 +3890,14 @@ github.com/halfrost/LeetCode-Go/leetcode/0424.Longest-Repeating-Character-Replac github.com/halfrost/LeetCode-Go/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement.go:17.28,18.11 1 50 github.com/halfrost/LeetCode-Go/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement.go:18.11,20.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0424.Longest-Repeating-Character-Replacement/424. Longest Repeating Character Replacement.go:21.2,21.10 1 46 -github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:16.37,19.17 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:19.17,21.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:22.2,23.21 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:23.21,26.18 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:26.18,30.4 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:30.9,32.30 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:32.30,34.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:37.2,38.12 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:3.50,6.31 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:6.31,7.28 1 36 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:7.28,8.18 1 108 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:8.18,10.5 1 102 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:13.2,13.19 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:17.51,18.20 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:18.20,20.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:21.2,23.12 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:26.76,27.17 1 650543834 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:27.17,28.18 1 433695890 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:28.18,30.4 1 181997608 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:31.3,31.9 1 433695890 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:33.2,33.33 1 216847944 -github.com/halfrost/LeetCode-Go/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV.go:33.33,37.3 3 650543832 +github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:16.37,19.17 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:19.17,21.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:22.2,23.21 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:23.21,26.18 3 9 +github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:26.18,30.4 3 2 +github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:30.9,32.30 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:32.30,34.5 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal.go:37.2,38.12 2 2 github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:4.63,6.19 2 4 github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:6.19,9.29 3 7 github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:9.29,13.41 4 7 @@ -3955,19 +3935,19 @@ github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Mini github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:92.14,94.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:95.2,95.22 1 17 github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:95.22,97.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:98.2,98.14 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:98.14,99.15 1 31 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:99.15,101.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:102.3,102.17 1 27 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:102.17,104.4 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:105.3,105.12 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:107.2,107.14 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:110.34,112.25 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:112.25,114.12 2 120 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:115.12,116.10 1 43 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:117.12,118.10 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:119.12,120.10 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:123.2,123.10 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:98.2,99.14 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:99.14,100.15 1 31 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:100.15,102.9 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:104.3,104.17 1 27 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:104.17,106.9 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:108.3,108.12 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:110.2,110.12 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:113.34,115.25 2 15 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:115.25,117.12 2 120 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:118.12,119.10 1 43 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:120.12,121.10 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:122.12,123.10 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go:126.2,126.10 1 15 github.com/halfrost/LeetCode-Go/leetcode/0434.Number-of-Segments-in-a-String/434.Number of Segments in a String.go:3.34,6.22 3 4 github.com/halfrost/LeetCode-Go/leetcode/0434.Number-of-Segments-in-a-String/434.Number of Segments in a String.go:6.22,7.27 1 52 github.com/halfrost/LeetCode-Go/leetcode/0434.Number-of-Segments-in-a-String/434.Number of Segments in a String.go:7.27,10.4 2 7 @@ -3976,64 +3956,64 @@ github.com/halfrost/LeetCode-Go/leetcode/0434.Number-of-Segments-in-a-String/434 github.com/halfrost/LeetCode-Go/leetcode/0434.Number-of-Segments-in-a-String/434.Number of Segments in a String.go:14.2,14.14 1 4 github.com/halfrost/LeetCode-Go/leetcode/0434.Number-of-Segments-in-a-String/434.Number of Segments in a String.go:14.14,16.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0434.Number-of-Segments-in-a-String/434.Number of Segments in a String.go:17.2,17.12 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:8.51,9.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:9.25,11.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:12.2,14.20 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:14.20,16.3 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:17.2,17.38 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:17.38,18.26 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:18.26,19.42 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:19.42,21.5 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:24.2,24.23 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:24.23,26.3 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:27.2,27.29 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:30.28,31.11 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:31.11,33.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:34.2,34.10 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:40.30,42.2 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:43.35,45.2 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:46.40,47.33 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:47.33,48.24 1 24 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:48.24,50.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:50.9,50.32 1 22 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:50.32,51.12 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:52.9,54.4 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:8.51,9.25 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:9.25,11.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:12.2,14.20 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:14.20,16.3 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:17.2,17.38 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:17.38,18.26 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:18.26,19.42 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:19.42,21.5 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:24.2,24.23 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:24.23,26.3 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:27.2,27.29 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:30.28,31.11 1 30 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:31.11,33.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:34.2,34.10 1 29 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:40.30,42.2 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:43.35,45.2 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:46.40,47.33 1 40 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:47.33,48.24 1 52 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:48.24,50.4 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:50.9,50.32 1 38 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:50.32,51.12 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:52.9,54.4 1 20 github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:56.2,56.13 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:60.52,61.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:61.25,63.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:64.2,67.38 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:67.38,68.43 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:68.43,71.4 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:71.9,71.49 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:71.49,73.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:75.2,75.29 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:13.49,16.30 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:16.30,18.3 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:19.2,21.41 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:21.41,22.60 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:22.60,22.129 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:23.3,23.33 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:60.52,61.25 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:61.25,63.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:64.2,67.38 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:67.38,68.43 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:68.43,71.4 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:71.9,71.49 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:71.49,73.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals.go:75.2,75.29 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:13.49,16.30 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:16.30,18.3 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:19.2,21.41 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:21.41,22.60 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:22.60,22.129 1 27 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:23.3,23.33 1 12 github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:23.33,25.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:25.9,27.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:29.2,29.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:39.34,39.52 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:40.44,42.2 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:25.9,27.4 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:29.2,29.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:39.34,39.52 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:40.44,42.2 1 9 github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:43.39,43.70 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:46.50,47.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:47.25,49.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:50.2,51.30 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:51.30,54.3 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:55.2,56.30 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:56.30,58.14 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:58.14,60.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:61.3,61.25 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:63.2,63.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:66.66,68.18 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:68.18,70.32 2 12 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:70.32,71.50 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:71.50,73.5 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:74.4,74.18 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:75.9,77.4 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:46.50,47.25 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:47.25,49.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:50.2,51.30 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:51.30,54.3 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:55.2,56.30 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:56.30,58.14 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:58.14,60.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:61.3,61.25 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:63.2,63.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:66.66,68.18 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:68.18,70.32 2 23 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:70.32,71.50 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:71.50,73.5 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:74.4,74.18 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:75.9,77.4 1 13 github.com/halfrost/LeetCode-Go/leetcode/0436.Find-Right-Interval/436. Find Right Interval.go:79.2,79.11 1 4 github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:20.49,24.2 3 2 github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:26.67,27.17 1 20 @@ -4041,14 +4021,14 @@ github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go: github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:30.2,32.37 3 9 github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:32.37,34.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:35.2,39.12 5 9 -github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:43.46,44.17 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:44.17,46.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:47.2,50.12 4 0 -github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:54.47,55.17 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:55.17,57.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:58.2,59.21 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:59.21,61.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:62.2,64.12 3 0 +github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:43.46,44.17 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:44.17,46.3 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:47.2,50.12 4 9 +github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:54.47,55.17 1 61 +github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:55.17,57.3 1 35 +github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:58.2,59.21 2 26 +github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:59.21,61.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0437.Path-Sum-III/437. Path Sum III.go:62.2,64.12 3 26 github.com/halfrost/LeetCode-Go/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String.go:3.45,6.36 3 4 github.com/halfrost/LeetCode-Go/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String.go:6.36,8.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String.go:9.2,9.30 1 3 @@ -4063,16 +4043,16 @@ github.com/halfrost/LeetCode-Go/leetcode/0438.Find-All-Anagrams-in-a-String/438. github.com/halfrost/LeetCode-Go/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String.go:24.30,26.5 1 12 github.com/halfrost/LeetCode-Go/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String.go:27.4,28.10 2 17 github.com/halfrost/LeetCode-Go/leetcode/0438.Find-All-Anagrams-in-a-String/438. Find All Anagrams in a String.go:32.2,32.15 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:6.30,7.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:7.12,9.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:10.2,11.15 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:15.31,17.13 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:6.30,7.12 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:7.12,9.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:10.2,11.15 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:15.31,17.13 2 3 github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:17.13,20.3 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:21.2,21.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:17.61,18.15 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0441.Arranging-Coins/441. Arranging Coins.go:21.2,21.14 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:17.61,18.15 1 9 github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:18.15,20.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:21.2,21.15 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:21.15,23.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:21.2,21.15 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:21.15,23.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:24.2,27.25 4 7 github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:27.25,29.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:29.8,31.3 1 6 @@ -4090,26 +4070,26 @@ github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Nu github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:61.33,64.17 3 14 github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:64.17,67.3 2 43 github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:68.2,68.14 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:71.59,78.58 6 8 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:78.58,80.24 2 28 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:80.24,83.4 2 22 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:84.3,84.24 1 28 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:71.59,78.58 6 9 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:78.58,80.24 2 31 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:80.24,83.4 2 25 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:84.3,84.24 1 31 github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:84.24,87.4 2 21 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:88.3,90.19 3 28 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:92.2,92.36 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:95.44,97.18 2 24 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:97.18,103.3 4 71 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:104.2,104.13 1 24 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:107.58,114.54 6 8 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:114.54,116.22 2 28 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:116.22,119.4 2 22 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:120.3,120.22 1 28 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:88.3,90.19 3 31 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:92.2,92.36 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:95.44,97.18 2 27 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:97.18,103.3 4 77 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:104.2,104.13 1 27 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:107.58,114.54 6 9 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:114.54,116.22 2 31 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:116.22,119.4 2 25 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:120.3,120.22 1 31 github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:120.22,123.4 2 21 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:124.3,126.50 3 28 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:128.2,128.23 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:131.35,133.15 2 16 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:133.15,136.3 2 43 -github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:137.2,137.14 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:124.3,126.50 3 31 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:128.2,128.23 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:131.35,133.15 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:133.15,136.3 2 46 +github.com/halfrost/LeetCode-Go/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II.go:137.2,137.14 1 18 github.com/halfrost/LeetCode-Go/leetcode/0447.Number-of-Boomerangs/447. Number of Boomerangs.go:3.45,5.35 2 1 github.com/halfrost/LeetCode-Go/leetcode/0447.Number-of-Boomerangs/447. Number of Boomerangs.go:5.35,7.36 2 3 github.com/halfrost/LeetCode-Go/leetcode/0447.Number-of-Boomerangs/447. Number of Boomerangs.go:7.36,8.14 1 9 @@ -4127,8 +4107,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0448.Find-All-Numbers-Disappeared-in-an github.com/halfrost/LeetCode-Go/leetcode/0448.Find-All-Numbers-Disappeared-in-an-Array/448. Find All Numbers Disappeared in an Array.go:13.25,14.12 1 19 github.com/halfrost/LeetCode-Go/leetcode/0448.Find-All-Numbers-Disappeared-in-an-Array/448. Find All Numbers Disappeared in an Array.go:14.12,16.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0448.Find-All-Numbers-Disappeared-in-an-Array/448. Find All Numbers Disappeared in an Array.go:18.2,18.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency.go:7.37,8.13 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency.go:8.13,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency.go:7.37,8.13 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency.go:8.13,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency.go:11.2,14.23 4 3 github.com/halfrost/LeetCode-Go/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency.go:14.23,16.3 1 14 github.com/halfrost/LeetCode-Go/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency.go:17.2,17.31 1 3 @@ -4192,23 +4172,23 @@ github.com/halfrost/LeetCode-Go/leetcode/0457.Circular-Array-Loop/457. Circular github.com/halfrost/LeetCode-Go/leetcode/0457.Circular-Array-Loop/457. Circular Array Loop.go:32.2,32.14 1 5 github.com/halfrost/LeetCode-Go/leetcode/0457.Circular-Array-Loop/457. Circular Array Loop.go:35.46,37.2 1 67 github.com/halfrost/LeetCode-Go/leetcode/0458.Poor-Pigs/458.Poor Pigs.go:5.69,8.2 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:18.41,24.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:26.40,28.9 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:28.9,30.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:31.2,34.53 4 6 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:34.53,36.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:37.2,40.91 4 6 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:40.91,42.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:43.2,43.26 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:46.47,47.24 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:47.24,49.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:50.2,50.45 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:50.45,55.3 4 0 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:56.2,56.38 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:18.41,24.2 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:26.40,28.9 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:28.9,30.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:31.2,34.53 4 10 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:34.53,36.3 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:37.2,40.91 4 10 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:40.91,42.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:43.2,43.26 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:46.47,47.24 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:47.24,49.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:50.2,50.45 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:50.45,55.3 4 1 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:56.2,56.38 1 10 github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:56.38,61.3 4 3 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:62.2,68.33 3 8 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:68.33,70.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:71.2,73.27 3 8 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:62.2,68.33 3 10 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:68.33,70.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0460.LFU-Cache/460. LFU Cache.go:71.2,73.27 3 10 github.com/halfrost/LeetCode-Go/leetcode/0461.Hamming-Distance/461. Hamming Distance.go:3.40,5.47 2 3 github.com/halfrost/LeetCode-Go/leetcode/0461.Hamming-Distance/461. Hamming Distance.go:5.47,7.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0461.Hamming-Distance/461. Hamming Distance.go:8.2,8.17 1 3 @@ -4238,12 +4218,12 @@ github.com/halfrost/LeetCode-Go/leetcode/0470.Implement-Rand10-Using-Rand7/470. github.com/halfrost/LeetCode-Go/leetcode/0470.Implement-Rand10-Using-Rand7/470. Implement Rand10() Using Rand7().go:17.20,19.19 2 3 github.com/halfrost/LeetCode-Go/leetcode/0470.Implement-Rand10-Using-Rand7/470. Implement Rand10() Using Rand7().go:19.19,21.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0470.Implement-Rand10-Using-Rand7/470. Implement Rand10() Using Rand7().go:22.2,22.22 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:5.41,6.26 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:6.26,8.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:9.2,10.32 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:10.32,12.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:13.2,13.18 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:13.18,15.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:5.41,6.26 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:6.26,8.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:9.2,10.32 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:10.32,12.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:13.2,13.18 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:13.18,15.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:16.2,16.46 1 2 github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:16.46,18.3 1 16 github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:19.2,20.51 2 2 @@ -4262,18 +4242,18 @@ github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchst github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:43.71,45.4 1 5 github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:46.3,46.24 1 5 github.com/halfrost/LeetCode-Go/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square.go:48.2,48.14 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:5.51,7.27 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:7.27,9.3 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:10.2,10.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:10.25,13.26 3 8 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:5.51,7.27 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:7.27,9.3 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:10.2,10.25 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:10.25,13.26 3 13 github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:13.26,14.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:16.3,16.30 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:16.30,17.30 1 23 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:17.30,19.5 1 67 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:22.2,22.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:25.28,26.11 1 67 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:26.11,28.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:29.2,29.10 1 67 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:16.3,16.30 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:16.30,17.30 1 42 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:17.30,19.5 1 109 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:22.2,22.17 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:25.28,26.11 1 109 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:26.11,28.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes.go:29.2,29.10 1 106 github.com/halfrost/LeetCode-Go/leetcode/0475.Heaters/475. Heaters.go:8.50,11.31 3 2 github.com/halfrost/LeetCode-Go/leetcode/0475.Heaters/475. Heaters.go:11.31,15.14 3 7 github.com/halfrost/LeetCode-Go/leetcode/0475.Heaters/475. Heaters.go:15.14,17.4 1 2 @@ -4329,68 +4309,64 @@ github.com/halfrost/LeetCode-Go/leetcode/0478.Generate-Random-Point-in-a-Circle/ github.com/halfrost/LeetCode-Go/leetcode/0478.Generate-Random-Point-in-a-Circle/478. Generate Random Point in a Circle.go:20.45,27.6 1 6 github.com/halfrost/LeetCode-Go/leetcode/0478.Generate-Random-Point-in-a-Circle/478. Generate Random Point in a Circle.go:27.6,32.31 5 7 github.com/halfrost/LeetCode-Go/leetcode/0478.Generate-Random-Point-in-a-Circle/478. Generate Random Point in a Circle.go:32.31,34.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0478.Generate-Random-Point-in-a-Circle/478. Generate Random Point in a Circle.go:38.22,40.2 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:10.55,15.36 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:15.36,19.3 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:20.2,20.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:23.50,28.22 5 1 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:28.22,30.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:31.2,31.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:34.55,35.45 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:35.45,36.25 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:36.25,39.4 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:41.2,41.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:44.53,45.45 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:45.45,46.25 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:46.25,49.4 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:51.2,52.10 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:55.45,57.44 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:57.45,58.3 0 6 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:59.2,59.14 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:59.14,61.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:62.2,63.62 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:72.56,76.31 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:76.31,78.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:78.8,78.36 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:78.36,80.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:81.2,81.22 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:81.22,82.47 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:82.47,84.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:84.9,86.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:87.3,87.13 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:87.13,88.31 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:88.31,90.5 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:90.10,92.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:94.3,94.32 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:94.32,96.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:96.9,96.37 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:96.37,98.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:99.3,99.33 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:99.33,100.16 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:100.16,102.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:102.10,104.5 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:108.2,108.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:117.28,117.50 1 191 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:120.33,120.80 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:123.39,123.75 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:126.37,130.2 3 12 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:133.28,135.2 1 42 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:143.38,143.70 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:151.38,151.70 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:159.29,159.66 1 32 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:162.30,163.55 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:163.55,166.3 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:167.2,167.19 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:171.30,175.2 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:178.32,178.55 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:181.34,181.60 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:189.29,189.66 1 24 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:192.30,193.55 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:193.55,196.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:197.2,197.19 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:201.30,205.2 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:208.32,208.55 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:211.34,211.60 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0478.Generate-Random-Point-in-a-Circle/478. Generate Random Point in a Circle.go:38.22,40.2 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:10.55,15.36 4 3 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:15.36,19.3 3 16 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:20.2,20.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:23.50,28.22 5 4 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:28.22,30.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:31.2,31.10 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:34.55,35.45 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:35.45,36.25 1 35 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:36.25,39.4 2 16 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:41.2,41.10 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:44.53,45.45 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:45.45,46.25 1 34 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:46.25,49.4 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:51.2,52.10 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:55.45,57.44 2 19 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:57.45,58.3 0 24 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:59.2,59.14 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:59.14,61.3 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:62.2,63.62 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:72.56,76.22 4 3 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:76.22,77.47 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:77.47,79.4 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:79.9,81.4 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:82.3,82.13 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:82.13,83.31 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:83.31,85.5 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:85.10,87.5 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:89.3,89.32 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:89.32,91.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:91.9,91.37 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:91.37,93.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:94.3,94.33 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:94.33,95.16 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:95.16,97.5 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:97.10,99.5 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:103.2,103.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:112.28,112.50 1 577 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:115.33,115.80 1 59 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:118.39,118.75 1 53 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:121.37,125.2 3 33 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:128.28,130.2 1 134 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:138.38,138.70 1 44 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:146.38,146.70 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:154.29,154.66 1 98 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:157.30,158.55 1 64 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:158.55,161.3 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:162.2,162.19 1 64 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:166.30,170.2 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:173.32,173.55 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:176.34,176.60 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:184.29,184.66 1 72 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:187.30,188.55 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:188.55,191.3 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:192.2,192.19 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:196.30,200.2 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:203.32,203.55 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go:206.34,206.60 1 5 github.com/halfrost/LeetCode-Go/leetcode/0483.Smallest-Good-Base/483. Smallest Good Base.go:9.40,12.28 3 4 github.com/halfrost/LeetCode-Go/leetcode/0483.Smallest-Good-Base/483. Smallest Good Base.go:12.28,15.26 3 127 github.com/halfrost/LeetCode-Go/leetcode/0483.Smallest-Good-Base/483. Smallest Good Base.go:15.26,18.4 2 3615 @@ -4423,27 +4399,27 @@ github.com/halfrost/LeetCode-Go/leetcode/0488.Zuma-Game/488.Zuma Game.go:43.4,43 github.com/halfrost/LeetCode-Go/leetcode/0488.Zuma-Game/488.Zuma Game.go:46.2,46.14 1 3678 github.com/halfrost/LeetCode-Go/leetcode/0488.Zuma-Game/488.Zuma Game.go:46.14,48.3 1 148 github.com/halfrost/LeetCode-Go/leetcode/0488.Zuma-Game/488.Zuma Game.go:49.2,49.12 1 3530 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:3.43,5.35 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:5.35,6.36 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:6.36,7.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:8.9,11.4 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:13.2,13.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:16.73,18.17 2 14 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:18.17,22.3 3 8 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:23.2,24.43 2 14 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:24.43,25.31 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:25.31,26.37 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:3.43,5.35 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:5.35,6.36 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:6.36,7.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:8.9,11.4 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:13.2,13.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:16.73,18.17 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:18.17,22.3 3 11 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:23.2,24.43 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:24.43,25.31 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:25.31,26.37 1 14 github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:26.37,27.13 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:28.10,31.5 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:34.2,35.8 2 14 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:28.10,31.5 2 11 +github.com/halfrost/LeetCode-Go/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences.go:34.2,35.8 2 18 github.com/halfrost/LeetCode-Go/leetcode/0492.Construct-the-Rectangle/492.Construct the Rectangle.go:5.41,8.13 3 3 github.com/halfrost/LeetCode-Go/leetcode/0492.Construct-the-Rectangle/492.Construct the Rectangle.go:8.13,9.18 1 71 github.com/halfrost/LeetCode-Go/leetcode/0492.Construct-the-Rectangle/492.Construct the Rectangle.go:9.18,11.9 2 3 github.com/halfrost/LeetCode-Go/leetcode/0492.Construct-the-Rectangle/492.Construct the Rectangle.go:13.3,13.9 1 68 github.com/halfrost/LeetCode-Go/leetcode/0492.Construct-the-Rectangle/492.Construct the Rectangle.go:15.2,15.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:10.35,13.2 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:15.42,16.20 1 51 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:16.20,18.3 1 28 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:10.35,13.2 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:15.42,16.20 1 53 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:16.20,18.3 1 30 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:19.2,22.39 4 23 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:22.39,23.52 1 43 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:23.53,24.4 0 23 @@ -4454,8 +4430,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.g github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:32.9,35.4 2 33 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:36.3,36.6 1 76 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:38.2,38.12 1 23 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:42.42,44.12 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:44.12,46.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:42.42,44.12 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:44.12,46.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:48.2,49.25 2 5 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:49.25,51.3 1 28 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:52.2,55.27 4 5 @@ -4464,8 +4440,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.g github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:61.2,63.25 3 5 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:63.25,66.3 2 28 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:67.2,67.8 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:71.36,72.19 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:72.19,74.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:71.36,72.19 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:72.19,74.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:75.2,77.27 3 5 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:77.27,80.3 2 28 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:82.2,82.28 1 5 @@ -4474,36 +4450,36 @@ github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.g github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:88.30,90.3 1 31 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:91.2,93.37 2 5 github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:93.37,95.3 1 31 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:97.2,97.40 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:97.40,99.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:100.2,100.27 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:100.27,103.3 2 28 -github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:104.2,104.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:4.47,6.25 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:6.25,8.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:9.2,9.52 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:9.52,11.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:97.2,97.30 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:97.30,99.3 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:100.2,102.27 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:102.27,105.3 2 28 +github.com/halfrost/LeetCode-Go/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go:106.2,106.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:4.47,6.25 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:6.25,8.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:9.2,9.50 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:9.50,11.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:12.2,15.25 4 1 github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:15.25,16.32 1 5 github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:16.32,18.4 1 20 github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:20.2,20.19 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:24.48,28.38 3 1 +github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:24.48,28.38 3 2 github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:28.38,30.3 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:31.2,33.12 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:36.91,37.24 1 31 +github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:31.2,33.12 3 2 +github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:36.91,37.24 1 32 github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:37.24,38.18 1 10 github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:38.18,40.4 1 5 github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:41.3,41.9 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:44.2,44.28 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:44.28,46.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:44.2,44.28 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:44.28,46.3 1 7 github.com/halfrost/LeetCode-Go/leetcode/0494.Target-Sum/494. Target Sum.go:47.2,48.71 2 15 github.com/halfrost/LeetCode-Go/leetcode/0495.Teemo-Attacking/495.Teemo Attacking.go:3.63,5.39 2 2 github.com/halfrost/LeetCode-Go/leetcode/0495.Teemo-Attacking/495.Teemo Attacking.go:5.39,8.26 3 2 github.com/halfrost/LeetCode-Go/leetcode/0495.Teemo-Attacking/495.Teemo Attacking.go:8.26,10.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0495.Teemo-Attacking/495.Teemo Attacking.go:10.9,12.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0495.Teemo-Attacking/495.Teemo Attacking.go:14.2,15.12 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:3.57,4.40 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:4.40,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:3.57,4.40 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:4.40,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:7.2,8.26 2 2 github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:8.26,10.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:11.2,11.34 1 2 @@ -4513,85 +4489,83 @@ github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next G github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:20.3,20.20 1 5 github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:20.20,22.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I.go:24.2,24.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:12.48,18.34 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:18.34,20.15 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:20.15,22.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:23.3,23.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:23.13,25.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:25.9,27.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:29.2,29.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:33.37,37.18 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:37.18,39.22 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:39.22,40.38 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:40.38,42.10 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:44.4,44.18 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:45.9,47.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:49.2,49.17 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:49.17,51.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:52.2,52.15 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:52.15,54.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:55.2,56.84 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:4.47,5.62 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:5.62,7.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:8.2,14.16 4 5 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:14.16,15.46 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:15.46,20.4 4 18 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:21.3,22.15 2 14 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:22.15,25.4 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:26.3,26.15 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:26.15,29.4 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:30.3,30.12 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:30.12,32.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:33.3,33.12 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:33.12,35.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:37.2,37.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:41.46,42.22 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:42.22,44.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:45.2,45.22 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:12.48,18.34 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:18.34,20.15 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:20.15,22.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:23.3,23.13 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:23.13,25.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:25.9,27.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:29.2,29.10 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:33.37,38.18 3 206 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:38.18,40.22 2 572 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:40.22,41.38 1 211 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:41.38,43.10 2 206 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:45.4,45.18 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:46.9,48.4 1 361 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:50.2,50.15 1 206 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:50.15,52.3 1 195 +github.com/halfrost/LeetCode-Go/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go:53.2,54.84 2 206 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:4.47,5.62 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:5.62,7.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:8.2,14.16 4 7 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:14.16,15.46 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:15.46,20.4 4 42 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:21.3,22.15 2 26 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:22.15,25.4 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:26.3,26.15 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:26.15,29.4 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:30.3,30.12 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:30.12,32.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:33.3,33.12 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:33.12,35.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:37.2,37.12 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:41.46,42.22 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:42.22,44.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:45.2,45.22 1 8 github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:45.22,47.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:49.2,50.39 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:50.39,51.16 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:51.16,52.41 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:52.41,54.14 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:54.14,56.6 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:57.5,59.13 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:61.4,61.41 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:61.41,62.14 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:62.14,64.6 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:65.5,68.13 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:71.3,71.23 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:71.23,73.15 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:73.15,77.13 4 1 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:49.2,50.39 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:50.39,51.16 1 38 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:51.16,52.41 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:52.41,54.14 2 11 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:54.14,56.6 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:57.5,59.13 3 11 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:61.4,61.41 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:61.41,62.14 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:62.14,64.6 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:65.5,68.13 4 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:71.3,71.23 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:71.23,73.15 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:73.15,77.13 4 3 github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:78.10,79.16 1 2 github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:79.16,83.14 4 2 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:87.3,87.24 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:87.24,88.15 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:88.15,92.13 4 0 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:95.3,95.24 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:95.24,96.15 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:96.15,100.13 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:103.3,103.15 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:103.15,104.15 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:104.15,108.13 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:111.3,111.15 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:111.15,115.12 4 2 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:117.3,117.15 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:117.15,121.12 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:123.3,123.15 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:123.15,127.12 4 0 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:130.2,130.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:133.56,134.69 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:134.69,136.3 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:5.44,8.26 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:8.26,9.18 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:9.18,10.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:12.3,14.26 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:14.26,15.38 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:15.38,17.16 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:87.3,87.24 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:87.24,88.15 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:88.15,92.13 4 1 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:95.3,95.24 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:95.24,96.15 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:96.15,100.13 4 3 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:103.3,103.15 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:103.15,104.15 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:104.15,108.13 4 4 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:111.3,111.15 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:111.15,115.12 4 4 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:117.3,117.15 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:117.15,121.12 4 3 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:123.3,123.15 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:123.15,127.12 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:130.2,130.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:133.56,134.69 1 38 +github.com/halfrost/LeetCode-Go/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse.go:134.69,136.3 1 33 +github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:5.44,8.26 3 2 +github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:8.26,9.18 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:9.18,10.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:12.3,14.26 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:14.26,15.38 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:15.38,17.16 2 8 github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:17.16,18.11 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:22.3,22.13 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:22.13,24.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:26.2,26.15 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:22.3,22.13 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:22.13,24.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0500.Keyboard-Row/500. Keyboard Row.go:26.2,26.15 1 2 github.com/halfrost/LeetCode-Go/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II.go:4.44,7.33 3 3 github.com/halfrost/LeetCode-Go/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II.go:7.33,9.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II.go:10.2,10.35 1 3 @@ -4609,8 +4583,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0503.Next-Greater-Element-II/503. Next github.com/halfrost/LeetCode-Go/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II.go:38.3,38.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II.go:38.12,40.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0503.Next-Greater-Element-II/503. Next Greater Element II.go:42.2,42.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0504.Base-7/504.Base 7.go:5.37,6.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0504.Base-7/504.Base 7.go:6.14,8.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0504.Base-7/504.Base 7.go:5.37,6.14 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0504.Base-7/504.Base 7.go:6.14,8.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0504.Base-7/504.Base 7.go:9.2,10.13 2 2 github.com/halfrost/LeetCode-Go/leetcode/0504.Base-7/504.Base 7.go:10.13,13.3 2 1 github.com/halfrost/LeetCode-Go/leetcode/0504.Base-7/504.Base 7.go:14.2,16.15 3 2 @@ -4633,14 +4607,14 @@ github.com/halfrost/LeetCode-Go/leetcode/0506.Relative-Ranks/506.Relative Ranks. github.com/halfrost/LeetCode-Go/leetcode/0506.Relative-Ranks/506.Relative Ranks.go:22.20,24.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0506.Relative-Ranks/506.Relative Ranks.go:24.9,26.4 1 4 github.com/halfrost/LeetCode-Go/leetcode/0506.Relative-Ranks/506.Relative Ranks.go:28.2,28.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:6.39,7.14 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:7.14,9.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:6.39,7.14 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:7.14,9.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:10.2,11.29 2 3 github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:11.29,12.17 1 46 github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:12.17,13.12 1 35 github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:15.3,16.21 2 11 github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:18.2,18.19 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:22.40,24.2 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0507.Perfect-Number/507. Perfect Number.go:22.40,24.2 1 4 github.com/halfrost/LeetCode-Go/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum.go:22.48,27.29 5 5 github.com/halfrost/LeetCode-Go/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum.go:27.29,28.18 1 8 github.com/halfrost/LeetCode-Go/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum.go:28.18,30.4 1 3 @@ -4665,43 +4639,43 @@ github.com/halfrost/LeetCode-Go/leetcode/0508.Most-Frequent-Subtree-Sum/508. Mos github.com/halfrost/LeetCode-Go/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum.go:74.2,74.58 1 9 github.com/halfrost/LeetCode-Go/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum.go:74.58,77.3 2 6 github.com/halfrost/LeetCode-Go/leetcode/0508.Most-Frequent-Subtree-Sum/508. Most Frequent Subtree Sum.go:78.2,80.12 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:6.21,7.12 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:7.12,9.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:10.2,10.28 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:14.22,15.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:6.21,7.12 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:7.12,9.3 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:10.2,10.28 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:14.22,15.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:15.12,17.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:18.2,19.26 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:19.26,21.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:22.2,22.17 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:26.22,27.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:18.2,19.26 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:19.26,21.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:22.2,22.17 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:26.22,27.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:27.12,29.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:30.2,30.44 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:33.44,34.27 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:34.27,36.3 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:37.2,38.26 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:42.22,43.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:30.2,30.44 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:33.44,34.27 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:34.27,36.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:37.2,38.26 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:42.22,43.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:43.12,45.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:46.2,46.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:46.2,46.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:46.12,48.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:49.2,50.26 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:50.26,54.3 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:55.2,55.16 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:61.22,62.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:49.2,50.26 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:50.26,54.3 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:55.2,55.16 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:61.22,62.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:62.12,64.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:65.2,70.16 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:73.48,74.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:74.12,76.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:77.2,84.14 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:84.14,86.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:88.2,88.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:91.51,101.2 9 1 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:107.22,110.2 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:113.22,115.2 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:117.29,119.12 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:119.12,122.13 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:122.13,125.4 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:126.3,126.38 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:128.2,128.15 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:65.2,70.16 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:73.48,74.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:74.12,76.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:77.2,84.14 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:84.14,86.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:88.2,88.10 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:91.51,101.2 9 3 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:107.22,110.2 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:113.22,115.2 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:117.29,119.12 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:119.12,122.13 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:122.13,125.4 2 11 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:126.3,126.38 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0509.Fibonacci-Number/509. Fibonacci Number.go:128.2,128.15 1 18 github.com/halfrost/LeetCode-Go/leetcode/0513.Find-Bottom-Left-Tree-Value/513. Find Bottom Left Tree Value.go:20.46,21.17 1 4 github.com/halfrost/LeetCode-Go/leetcode/0513.Find-Bottom-Left-Tree-Value/513. Find Bottom Left Tree Value.go:21.17,23.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0513.Find-Bottom-Left-Tree-Value/513. Find Bottom Left Tree Value.go:24.2,26.12 3 3 @@ -4763,7 +4737,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0518.Coin-Change-II/518. Coin Change II github.com/halfrost/LeetCode-Go/leetcode/0518.Coin-Change-II/518. Coin Change II.go:11.2,11.19 1 3 github.com/halfrost/LeetCode-Go/leetcode/0519.Random-Flip-Matrix/519.Random Flip Matrix.go:14.41,21.2 1 2 github.com/halfrost/LeetCode-Go/leetcode/0519.Random-Flip-Matrix/519.Random Flip Matrix.go:23.36,26.29 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0519.Random-Flip-Matrix/519.Random Flip Matrix.go:26.29,28.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0519.Random-Flip-Matrix/519.Random Flip Matrix.go:26.29,28.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0519.Random-Flip-Matrix/519.Random Flip Matrix.go:29.2,29.40 1 4 github.com/halfrost/LeetCode-Go/leetcode/0519.Random-Flip-Matrix/519.Random Flip Matrix.go:29.40,31.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0519.Random-Flip-Matrix/519.Random Flip Matrix.go:31.8,33.3 1 3 @@ -4786,29 +4760,29 @@ github.com/halfrost/LeetCode-Go/leetcode/0524.Longest-Word-in-Dictionary-through github.com/halfrost/LeetCode-Go/leetcode/0524.Longest-Word-in-Dictionary-through-Deleting/524. Longest Word in Dictionary through Deleting.go:14.3,14.93 1 20 github.com/halfrost/LeetCode-Go/leetcode/0524.Longest-Word-in-Dictionary-through-Deleting/524. Longest Word in Dictionary through Deleting.go:14.93,16.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0524.Longest-Word-in-Dictionary-through-Deleting/524. Longest Word in Dictionary through Deleting.go:18.2,18.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:3.36,7.33 4 2 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:7.33,8.19 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:8.19,10.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:10.9,12.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:13.3,13.33 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:13.33,15.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:15.9,17.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:19.2,19.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:22.24,23.11 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:23.11,25.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:26.2,26.10 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:13.42,15.22 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:15.22,16.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:16.13,18.12 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:20.3,20.36 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:22.2,22.42 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:26.40,29.17 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:29.17,31.29 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:31.29,33.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:33.9,33.35 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:33.35,35.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:35.9,37.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:39.2,39.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:3.36,7.33 4 3 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:7.33,8.19 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:8.19,10.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:10.9,12.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:13.3,13.33 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:13.33,15.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:15.9,17.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:19.2,19.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:22.24,23.11 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:23.11,25.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0525.Contiguous-Array/525. Contiguous Array.go:26.2,26.10 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:13.42,15.22 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:15.22,16.13 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:16.13,18.12 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:20.3,20.36 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:22.2,22.42 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:26.40,29.17 3 2006 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:29.17,31.29 2 4346 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:31.29,33.4 1 640 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:33.9,33.35 1 3706 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:33.35,35.4 1 1503 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:35.9,37.4 1 2203 +github.com/halfrost/LeetCode-Go/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight.go:39.2,39.12 1 1366 github.com/halfrost/LeetCode-Go/leetcode/0529.Minesweeper/529. Minesweeper.go:14.56,15.38 1 2 github.com/halfrost/LeetCode-Go/leetcode/0529.Minesweeper/529. Minesweeper.go:15.38,18.3 2 1 github.com/halfrost/LeetCode-Go/leetcode/0529.Minesweeper/529. Minesweeper.go:19.2,20.14 2 1 @@ -4821,18 +4795,18 @@ github.com/halfrost/LeetCode-Go/leetcode/0529.Minesweeper/529. Minesweeper.go:35 github.com/halfrost/LeetCode-Go/leetcode/0529.Minesweeper/529. Minesweeper.go:36.25,38.55 2 88 github.com/halfrost/LeetCode-Go/leetcode/0529.Minesweeper/529. Minesweeper.go:38.55,40.4 1 33 github.com/halfrost/LeetCode-Go/leetcode/0529.Minesweeper/529. Minesweeper.go:44.47,46.2 1 360 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:21.47,25.2 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:27.44,28.17 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:28.17,30.3 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:31.2,32.16 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:32.16,34.3 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:35.2,36.30 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:39.24,40.11 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:40.11,42.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:21.47,25.2 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:27.44,28.17 1 38 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:28.17,30.3 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:31.2,32.16 2 17 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:32.16,34.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:35.2,36.30 2 17 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:39.24,40.11 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:40.11,42.3 1 5 github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:43.2,43.10 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:46.21,47.11 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:46.21,47.11 1 13 github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:47.11,49.3 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:50.2,50.11 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST.go:50.2,50.11 1 1 github.com/halfrost/LeetCode-Go/leetcode/0532.K-diff-Pairs-in-an-Array/532. K-diff Pairs in an Array.go:3.39,4.29 1 4 github.com/halfrost/LeetCode-Go/leetcode/0532.K-diff-Pairs-in-an-Array/532. K-diff Pairs in an Array.go:4.29,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0532.K-diff-Pairs-in-an-Array/532. K-diff Pairs in an Array.go:7.2,9.29 3 3 @@ -4854,27 +4828,27 @@ github.com/halfrost/LeetCode-Go/leetcode/0538.Convert-BST-to-Greater-Tree/538. C github.com/halfrost/LeetCode-Go/leetcode/0538.Convert-BST-to-Greater-Tree/538. Convert BST to Greater Tree.go:28.39,29.17 1 56 github.com/halfrost/LeetCode-Go/leetcode/0538.Convert-BST-to-Greater-Tree/538. Convert BST to Greater Tree.go:29.17,31.3 1 31 github.com/halfrost/LeetCode-Go/leetcode/0538.Convert-BST-to-Greater-Tree/538. Convert BST to Greater Tree.go:32.2,35.24 4 25 -github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:3.41,5.19 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:5.19,7.17 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:7.17,8.32 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:8.32,10.5 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:3.41,5.19 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:5.19,7.17 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:7.17,8.32 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:8.32,10.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:10.10,12.5 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:13.9,14.32 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:14.32,16.5 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:13.9,14.32 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:14.32,16.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:16.10,18.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:21.2,21.19 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:3.41,4.16 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array.go:21.2,21.19 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:3.41,4.16 1 5 github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:4.16,6.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:7.2,7.38 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:7.38,8.20 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:8.20,11.4 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:11.9,14.4 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:16.2,16.10 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:19.30,22.12 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:22.12,26.3 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:27.2,27.22 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:8.46,10.45 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:10.45,12.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:7.2,7.38 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:7.38,8.20 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:8.20,11.4 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:11.9,14.4 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:16.2,16.10 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:19.30,22.12 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:22.12,26.3 3 7 +github.com/halfrost/LeetCode-Go/leetcode/0541.Reverse-String-II/541. Reverse String II.go:27.2,27.22 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:8.46,10.45 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:10.45,12.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:13.2,14.24 2 3 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:14.24,16.25 2 12 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:16.25,17.25 1 54 @@ -4891,32 +4865,32 @@ github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:43.26, github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:44.28,45.18 1 54 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:45.18,47.5 1 17 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:50.2,50.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:54.46,56.45 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:56.45,58.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:54.46,56.45 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:56.45,58.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:59.2,60.30 2 3 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:60.30,61.31 1 12 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:61.31,62.59 1 54 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:62.59,65.5 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:62.59,65.5 1 25 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:68.2,68.30 1 3 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:68.30,69.31 1 12 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:69.31,70.25 1 54 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:70.25,72.5 1 12 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:75.2,75.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:79.49,80.40 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:79.49,80.40 1 37 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:80.40,82.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:83.2,83.40 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:83.2,83.40 1 31 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:83.40,85.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:86.2,86.52 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:86.2,86.52 1 29 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:86.52,88.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:89.2,89.55 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:89.2,89.55 1 27 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:89.55,91.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:92.2,92.14 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:95.51,97.100 1 60 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:97.100,99.3 1 48 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:100.2,100.13 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:100.13,102.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:103.2,106.51 4 12 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:110.45,111.29 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:92.2,92.14 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:95.51,97.100 1 484 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:97.100,99.3 1 366 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:100.2,100.13 1 118 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:100.13,102.3 1 106 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:103.2,106.51 4 118 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:110.45,111.29 1 4 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:111.29,112.27 1 12 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:112.27,113.16 1 54 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:113.16,114.13 1 17 @@ -4925,7 +4899,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:117.13 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:120.4,120.13 1 37 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:120.13,122.5 1 30 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:123.4,123.33 1 37 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:126.2,126.40 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:126.2,126.40 1 4 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:126.40,127.44 1 12 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:127.44,128.25 1 54 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:128.25,129.13 1 17 @@ -4934,7 +4908,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:132.25 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:135.4,135.28 1 37 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:135.28,137.5 1 30 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:138.4,138.56 1 37 -github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:141.2,141.15 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:141.2,141.15 1 4 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:144.28,145.11 1 111 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:145.11,147.3 1 48 github.com/halfrost/LeetCode-Go/leetcode/0542.01-Matrix/542. 01 Matrix.go:148.2,148.10 1 63 @@ -4945,15 +4919,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0543.Diameter-of-Binary-Tree/543. Diame github.com/halfrost/LeetCode-Go/leetcode/0543.Diameter-of-Binary-Tree/543. Diameter of Binary Tree.go:35.28,36.11 1 50 github.com/halfrost/LeetCode-Go/leetcode/0543.Diameter-of-Binary-Tree/543. Diameter of Binary Tree.go:36.11,38.3 1 21 github.com/halfrost/LeetCode-Go/leetcode/0543.Diameter-of-Binary-Tree/543. Diameter of Binary Tree.go:39.2,39.10 1 29 -github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:9.35,11.12 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:11.12,13.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:9.35,11.12 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:11.12,13.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:14.2,16.25 3 3 github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:16.25,17.27 1 9 github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:17.27,18.20 1 18 github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:18.20,20.5 1 10 github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:23.2,23.24 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:27.36,28.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:28.17,30.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:27.36,28.17 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:28.17,30.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:31.2,33.19 3 3 github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:33.19,34.18 1 9 github.com/halfrost/LeetCode-Go/leetcode/0547.Number-of-Provinces/547. Number of Provinces.go:34.18,37.4 2 6 @@ -4976,7 +4950,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0554.Brick-Wall/554. Brick Wall.go:5.27 github.com/halfrost/LeetCode-Go/leetcode/0554.Brick-Wall/554. Brick Wall.go:7.35,10.4 2 25 github.com/halfrost/LeetCode-Go/leetcode/0554.Brick-Wall/554. Brick Wall.go:12.2,13.22 2 4 github.com/halfrost/LeetCode-Go/leetcode/0554.Brick-Wall/554. Brick Wall.go:13.22,14.14 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0554.Brick-Wall/554. Brick Wall.go:14.14,16.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0554.Brick-Wall/554. Brick Wall.go:14.14,16.4 1 5 github.com/halfrost/LeetCode-Go/leetcode/0554.Brick-Wall/554. Brick Wall.go:18.2,18.24 1 4 github.com/halfrost/LeetCode-Go/leetcode/0557.Reverse-Words-in-a-String-III/557. Reverse Words in a String III.go:7.36,9.23 2 2 github.com/halfrost/LeetCode-Go/leetcode/0557.Reverse-Words-in-a-String-III/557. Reverse Words in a String III.go:9.23,11.3 1 5 @@ -4984,9 +4958,22 @@ github.com/halfrost/LeetCode-Go/leetcode/0557.Reverse-Words-in-a-String-III/557. github.com/halfrost/LeetCode-Go/leetcode/0557.Reverse-Words-in-a-String-III/557. Reverse Words in a String III.go:15.30,18.12 3 5 github.com/halfrost/LeetCode-Go/leetcode/0557.Reverse-Words-in-a-String-III/557. Reverse Words in a String III.go:18.12,22.3 3 11 github.com/halfrost/LeetCode-Go/leetcode/0557.Reverse-Words-in-a-String-III/557. Reverse Words in a String III.go:23.2,23.22 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:4.35,7.2 2 18 -github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:10.34,11.12 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:11.12,13.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:8.31,9.17 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:9.17,11.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:12.2,12.22 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:15.26,19.18 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:19.18,22.19 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:22.19,26.44 4 18 +github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:26.44,28.5 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:31.2,31.14 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:3.41,7.33 4 5 +github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:7.33,9.28 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:9.28,11.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:12.3,12.14 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:14.2,14.14 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:4.35,7.2 2 19 +github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:10.34,11.12 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:11.12,13.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:14.2,15.22 2 18 github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:15.22,17.3 1 171 github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:18.2,19.17 2 18 @@ -5001,19 +4988,6 @@ github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautif github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:44.38,46.28 2 206628345 github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:46.28,48.3 1 23034305 github.com/halfrost/LeetCode-Go/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement.go:49.2,49.14 1 183594040 -github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:8.31,9.17 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:9.17,11.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:12.2,12.22 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:15.26,19.18 4 2 -github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:19.18,22.19 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:22.19,26.44 4 18 -github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:26.44,28.5 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree.go:31.2,31.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:3.41,7.33 4 5 -github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:7.33,9.28 2 13 -github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:9.28,11.4 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:12.3,12.14 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0560.Subarray-Sum-Equals-K/560. Subarray Sum Equals K.go:14.2,14.14 1 5 github.com/halfrost/LeetCode-Go/leetcode/0561.Array-Partition/561. Array Partition.go:3.35,5.33 2 2 github.com/halfrost/LeetCode-Go/leetcode/0561.Array-Partition/561. Array Partition.go:5.33,7.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0561.Array-Partition/561. Array Partition.go:8.2,9.34 2 2 @@ -5028,20 +5002,20 @@ github.com/halfrost/LeetCode-Go/leetcode/0563.Binary-Tree-Tilt/563. Binary Tree github.com/halfrost/LeetCode-Go/leetcode/0563.Binary-Tree-Tilt/563. Binary Tree Tilt.go:30.48,31.17 1 36 github.com/halfrost/LeetCode-Go/leetcode/0563.Binary-Tree-Tilt/563. Binary Tree Tilt.go:31.17,33.3 1 20 github.com/halfrost/LeetCode-Go/leetcode/0563.Binary-Tree-Tilt/563. Binary Tree Tilt.go:34.2,37.32 4 16 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:3.56,4.28 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:4.28,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:3.56,4.28 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:4.28,6.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:7.2,7.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:10.46,13.23 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:13.23,15.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:10.46,13.23 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:13.23,15.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:16.2,16.14 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:19.46,21.30 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:21.30,23.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:24.2,25.27 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:25.27,26.27 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:26.27,27.21 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:27.21,30.5 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:31.4,32.14 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:35.2,35.17 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:19.46,21.30 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:21.30,23.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:24.2,25.27 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:25.27,26.27 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:26.27,27.21 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:27.21,30.5 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:31.4,32.14 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix.go:35.2,35.17 1 2 github.com/halfrost/LeetCode-Go/leetcode/0567.Permutation-in-String/567. Permutation in String.go:3.48,5.39 2 5 github.com/halfrost/LeetCode-Go/leetcode/0567.Permutation-in-String/567. Permutation in String.go:5.39,7.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0567.Permutation-in-String/567. Permutation in String.go:8.2,8.31 1 4 @@ -5056,20 +5030,20 @@ github.com/halfrost/LeetCode-Go/leetcode/0567.Permutation-in-String/567. Permuta github.com/halfrost/LeetCode-Go/leetcode/0567.Permutation-in-String/567. Permutation in String.go:23.31,25.5 1 2 github.com/halfrost/LeetCode-Go/leetcode/0567.Permutation-in-String/567. Permutation in String.go:26.4,27.10 2 8 github.com/halfrost/LeetCode-Go/leetcode/0567.Permutation-in-String/567. Permutation in String.go:30.2,30.14 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:19.47,20.22 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:19.47,20.22 1 27 github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:20.22,22.3 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:23.2,23.14 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:23.14,25.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:26.2,26.51 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:23.2,23.14 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:23.14,25.3 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:26.2,26.51 1 12 github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:26.51,28.3 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:29.2,29.14 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:33.48,34.26 1 94 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:29.2,29.14 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:33.48,34.26 1 106 github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:34.26,36.3 1 40 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:36.8,36.33 1 54 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:36.33,37.21 1 43 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:37.21,39.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:40.3,40.68 1 42 -github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:41.8,43.3 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:36.8,36.33 1 66 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:36.33,37.21 1 49 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:37.21,39.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:40.3,40.68 1 43 +github.com/halfrost/LeetCode-Go/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree.go:41.8,43.3 1 17 github.com/halfrost/LeetCode-Go/leetcode/0575.Distribute-Candies/575. Distribute Candies.go:3.43,5.32 2 2 github.com/halfrost/LeetCode-Go/leetcode/0575.Distribute-Candies/575. Distribute Candies.go:5.32,7.3 1 10 github.com/halfrost/LeetCode-Go/leetcode/0575.Distribute-Candies/575. Distribute Candies.go:8.2,9.15 2 2 @@ -5129,19 +5103,19 @@ github.com/halfrost/LeetCode-Go/leetcode/0583.Delete-Operation-for-Two-Strings/5 github.com/halfrost/LeetCode-Go/leetcode/0583.Delete-Operation-for-Two-Strings/583. Delete Operation for Two Strings.go:26.24,27.11 1 33 github.com/halfrost/LeetCode-Go/leetcode/0583.Delete-Operation-for-Two-Strings/583. Delete Operation for Two Strings.go:27.11,29.3 1 9 github.com/halfrost/LeetCode-Go/leetcode/0583.Delete-Operation-for-Two-Strings/583. Delete Operation for Two Strings.go:30.2,30.10 1 24 -github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:10.33,12.17 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:12.17,14.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:10.33,12.17 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:12.17,14.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:15.2,16.21 2 2 github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:16.21,21.32 5 20 github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:21.32,23.4 1 18 github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:24.3,24.32 1 20 github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:26.2,26.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:30.34,34.2 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:36.42,37.17 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:30.34,34.2 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:36.42,37.17 1 21 github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:37.17,39.43 2 20 github.com/halfrost/LeetCode-Go/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal.go:39.43,41.4 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence.go:3.30,4.19 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence.go:4.19,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence.go:3.30,4.19 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence.go:4.19,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence.go:7.2,8.27 2 1 github.com/halfrost/LeetCode-Go/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence.go:8.27,9.34 1 8 github.com/halfrost/LeetCode-Go/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence.go:9.34,11.12 2 3 @@ -5192,21 +5166,21 @@ github.com/halfrost/LeetCode-Go/leetcode/0617.Merge-Two-Binary-Trees/617. Merge github.com/halfrost/LeetCode-Go/leetcode/0617.Merge-Two-Binary-Trees/617. Merge Two Binary Trees.go:23.2,23.18 1 5 github.com/halfrost/LeetCode-Go/leetcode/0617.Merge-Two-Binary-Trees/617. Merge Two Binary Trees.go:23.18,25.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0617.Merge-Two-Binary-Trees/617. Merge Two Binary Trees.go:26.2,29.14 4 4 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:11.41,13.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:15.54,16.27 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:16.27,18.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:19.2,23.13 5 1 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:27.45,28.20 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:28.20,30.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:31.2,34.13 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:37.42,38.20 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:38.20,40.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:41.2,41.30 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:44.41,45.20 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:45.20,47.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:48.2,48.21 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:48.21,50.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:51.2,51.33 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:11.41,13.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:15.54,16.27 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:16.27,18.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:19.2,23.13 5 5 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:27.45,28.20 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:28.20,30.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:31.2,34.13 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:37.42,38.20 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:38.20,40.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:41.2,41.30 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:44.41,45.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:45.20,47.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:48.2,48.21 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:48.21,50.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:51.2,51.33 1 1 github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:54.45,56.2 1 1 github.com/halfrost/LeetCode-Go/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue.go:58.44,60.2 1 1 github.com/halfrost/LeetCode-Go/leetcode/0623.Add-One-Row-to-Tree/623. Add One Row to Tree.go:18.56,19.12 1 5 @@ -5219,45 +5193,45 @@ github.com/halfrost/LeetCode-Go/leetcode/0623.Add-One-Row-to-Tree/623. Add One R github.com/halfrost/LeetCode-Go/leetcode/0623.Add-One-Row-to-Tree/623. Add One Row to Tree.go:38.2,38.23 1 5 github.com/halfrost/LeetCode-Go/leetcode/0623.Add-One-Row-to-Tree/623. Add One Row to Tree.go:38.23,40.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0623.Add-One-Row-to-Tree/623. Add One Row to Tree.go:41.2,41.14 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:9.37,10.20 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:10.20,12.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:13.2,14.20 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:9.37,10.20 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:10.20,12.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:13.2,14.20 2 12 github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:14.20,15.34 1 6 github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:15.34,17.4 1 13 github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:18.3,18.13 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:20.2,21.28 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:21.28,23.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:24.2,24.102 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:27.28,28.11 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:28.11,30.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:31.2,31.10 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:35.38,40.27 5 9 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:40.27,41.19 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:41.19,43.4 1 26 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:43.9,43.26 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:43.26,45.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:45.9,45.26 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:45.26,47.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:48.3,48.19 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:48.19,50.4 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:50.9,50.26 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:50.26,52.4 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:54.2,55.31 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:55.31,57.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:58.2,58.20 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:8.42,9.42 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:9.42,11.3 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:12.2,14.28 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:14.28,15.24 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:15.24,18.4 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:18.9,18.58 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:18.58,21.4 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:23.2,23.25 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:28.39,28.56 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:29.39,29.61 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:30.39,30.66 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:31.38,36.2 4 0 -github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:37.40,39.2 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:20.2,21.28 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:21.28,23.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:24.2,24.102 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:27.28,28.11 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:28.11,30.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:31.2,31.10 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:35.38,40.27 5 13 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:40.27,41.19 1 41 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:41.19,43.4 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:43.9,43.26 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:43.26,45.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:45.9,45.26 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:45.26,47.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:48.3,48.19 1 41 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:48.19,50.4 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:50.9,50.26 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:50.26,52.4 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:54.2,55.31 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:55.31,57.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers.go:58.2,58.20 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:8.42,9.42 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:9.42,11.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:12.2,14.28 3 2 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:14.28,15.24 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:15.24,18.4 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:18.9,18.58 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:18.58,21.4 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:23.2,23.25 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:28.39,28.56 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:29.39,29.61 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:30.39,30.66 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:31.38,36.2 4 1 +github.com/halfrost/LeetCode-Go/leetcode/0630.Course-Schedule-III/630. Course Schedule III.go:37.40,39.2 1 6 github.com/halfrost/LeetCode-Go/leetcode/0632.Smallest-Range-Covering-Elements-from-K-Lists/632. Smallest Range Covering Elements from K Lists.go:8.40,10.26 2 1 github.com/halfrost/LeetCode-Go/leetcode/0632.Smallest-Range-Covering-Elements-from-K-Lists/632. Smallest Range Covering Elements from K Lists.go:10.26,11.24 1 3 github.com/halfrost/LeetCode-Go/leetcode/0632.Smallest-Range-Covering-Elements-from-K-Lists/632. Smallest Range Covering Elements from K Lists.go:11.24,13.4 1 13 @@ -5347,53 +5321,53 @@ github.com/halfrost/LeetCode-Go/leetcode/0647.Palindromic-Substrings/647. Palind github.com/halfrost/LeetCode-Go/leetcode/0647.Palindromic-Substrings/647. Palindromic Substrings.go:15.26,16.9 1 3 github.com/halfrost/LeetCode-Go/leetcode/0647.Palindromic-Substrings/647. Palindromic Substrings.go:18.3,20.8 3 9 github.com/halfrost/LeetCode-Go/leetcode/0647.Palindromic-Substrings/647. Palindromic Substrings.go:22.2,22.12 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:6.58,8.28 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:8.28,11.3 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:12.2,13.29 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:13.29,15.43 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:15.43,16.31 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:16.31,18.10 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:22.2,22.33 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:25.58,26.27 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:6.58,8.28 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:8.28,11.3 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:12.2,13.29 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:13.29,15.43 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:15.43,16.31 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:16.31,18.10 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:22.2,22.33 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:25.58,26.27 1 22 github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:26.27,28.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:29.2,29.38 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:29.38,30.27 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:30.27,32.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:34.2,34.14 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:38.59,40.25 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:40.25,42.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:43.2,47.30 5 1 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:47.30,49.34 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:49.34,50.30 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:50.30,52.10 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:56.3,56.21 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:29.2,29.38 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:29.38,30.27 1 28 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:30.27,32.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:34.2,34.14 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:38.59,40.25 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:40.25,42.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:43.2,47.30 5 2 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:47.30,49.34 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:49.34,50.30 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:50.30,52.10 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:56.3,56.21 1 10 github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:56.21,58.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:58.9,60.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:63.2,63.34 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:72.28,74.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:77.39,79.26 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:79.26,80.43 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:80.43,82.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:82.9,86.4 3 9 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:88.2,88.22 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:92.44,94.26 2 16 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:94.26,95.43 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:95.43,97.12 2 19 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:58.9,60.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:63.2,63.34 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:72.28,74.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:77.39,79.26 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:79.26,80.43 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:80.43,82.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:82.9,86.4 3 13 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:88.2,88.22 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:92.44,94.26 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:94.26,95.43 1 34 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:95.43,97.12 2 28 github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:99.3,99.15 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:101.2,101.22 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0648.Replace-Words/648. Replace Words.go:101.2,101.22 1 16 github.com/halfrost/LeetCode-Go/leetcode/0653.Two-Sum-IV-Input-is-a-BST/653. Two Sum IV - Input is a BST.go:19.45,22.2 2 4 github.com/halfrost/LeetCode-Go/leetcode/0653.Two-Sum-IV-Input-is-a-BST/653. Two Sum IV - Input is a BST.go:24.63,25.17 1 22 github.com/halfrost/LeetCode-Go/leetcode/0653.Two-Sum-IV-Input-is-a-BST/653. Two Sum IV - Input is a BST.go:25.17,27.3 1 10 github.com/halfrost/LeetCode-Go/leetcode/0653.Two-Sum-IV-Input-is-a-BST/653. Two Sum IV - Input is a BST.go:28.2,28.32 1 12 github.com/halfrost/LeetCode-Go/leetcode/0653.Two-Sum-IV-Input-is-a-BST/653. Two Sum IV - Input is a BST.go:28.32,30.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0653.Two-Sum-IV-Input-is-a-BST/653. Two Sum IV - Input is a BST.go:31.2,32.74 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:6.57,7.54 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:7.54,7.87 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:11.58,13.17 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:13.17,15.32 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:15.32,17.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:6.57,7.54 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:7.54,7.87 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:11.58,13.17 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:13.17,15.32 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:15.32,17.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:17.9,19.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:21.2,21.25 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements.go:21.2,21.25 1 3 github.com/halfrost/LeetCode-Go/leetcode/0661.Image-Smoother/661. Image Smoother.go:3.39,5.19 2 3 github.com/halfrost/LeetCode-Go/leetcode/0661.Image-Smoother/661. Image Smoother.go:5.19,7.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/0661.Image-Smoother/661. Image Smoother.go:8.2,8.30 1 3 @@ -5433,19 +5407,18 @@ github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:53.38,55.6 1 1 github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:56.5,56.40 1 15 github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:56.40,58.6 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:61.3,61.10 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:63.65,64.21 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:66.36,67.34 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:70.2,70.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:73.28,74.11 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:74.11,76.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:77.2,77.10 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:3.40,5.35 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:5.35,6.26 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:6.26,8.17 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:8.17,10.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:11.4,11.38 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:11.38,13.5 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:63.3,63.34 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:63.34,65.4 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:67.2,67.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:70.28,71.11 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:71.11,73.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go:74.2,74.10 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:3.40,5.35 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:5.35,6.26 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:6.26,8.17 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:8.17,10.5 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:11.4,11.38 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:11.38,13.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array.go:16.2,16.13 1 1 github.com/halfrost/LeetCode-Go/leetcode/0667.Beautiful-Arrangement-II/667. Beautiful Arrangement II.go:3.41,5.29 2 2 github.com/halfrost/LeetCode-Go/leetcode/0667.Beautiful-Arrangement-II/667. Beautiful Arrangement II.go:5.29,7.3 1 1 @@ -5469,8 +5442,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0669.Trim-a-Binary-Search-Tree/669. Tri github.com/halfrost/LeetCode-Go/leetcode/0669.Trim-a-Binary-Search-Tree/669. Trim a Binary Search Tree.go:26.2,26.20 1 12 github.com/halfrost/LeetCode-Go/leetcode/0669.Trim-a-Binary-Search-Tree/669. Trim a Binary Search Tree.go:26.20,28.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0669.Trim-a-Binary-Search-Tree/669. Trim a Binary Search Tree.go:29.2,31.13 3 9 -github.com/halfrost/LeetCode-Go/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence.go:3.39,4.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence.go:4.20,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence.go:3.39,4.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence.go:4.20,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence.go:7.2,8.33 2 3 github.com/halfrost/LeetCode-Go/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence.go:8.33,9.26 1 11 github.com/halfrost/LeetCode-Go/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence.go:9.26,11.4 1 6 @@ -5491,17 +5464,17 @@ github.com/halfrost/LeetCode-Go/leetcode/0676.Implement-Magic-Dictionary/676. Im github.com/halfrost/LeetCode-Go/leetcode/0676.Implement-Magic-Dictionary/676. Implement Magic Dictionary.go:29.14,31.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0676.Implement-Magic-Dictionary/676. Implement Magic Dictionary.go:34.2,34.14 1 5 github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:8.27,10.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:12.49,14.2 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:16.44,18.34 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:18.34,19.30 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:19.30,21.29 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:21.29,22.32 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:22.32,23.11 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:25.5,25.33 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:25.33,27.11 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:30.4,30.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:30.17,32.5 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:35.2,35.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:12.49,14.2 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:16.44,18.34 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:18.34,19.30 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:19.30,21.29 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:21.29,22.32 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:22.32,23.11 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:25.5,25.33 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:25.33,27.11 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:30.4,30.17 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:30.17,32.5 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs.go:35.2,35.12 1 5 github.com/halfrost/LeetCode-Go/leetcode/0682.Baseball-Game/682. Baseball Game.go:5.34,9.32 3 2 github.com/halfrost/LeetCode-Go/leetcode/0682.Baseball-Game/682. Baseball Game.go:9.32,11.13 2 13 github.com/halfrost/LeetCode-Go/leetcode/0682.Baseball-Game/682. Baseball Game.go:12.12,16.9 4 3 @@ -5511,41 +5484,41 @@ github.com/halfrost/LeetCode-Go/leetcode/0682.Baseball-Game/682. Baseball Game.g github.com/halfrost/LeetCode-Go/leetcode/0682.Baseball-Game/682. Baseball Game.go:29.2,30.27 2 2 github.com/halfrost/LeetCode-Go/leetcode/0682.Baseball-Game/682. Baseball Game.go:30.27,32.3 1 9 github.com/halfrost/LeetCode-Go/leetcode/0682.Baseball-Game/682. Baseball Game.go:33.2,33.15 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0684.Redundant-Connection/684. Redundant Connection.go:7.51,8.21 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0684.Redundant-Connection/684. Redundant Connection.go:8.21,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0684.Redundant-Connection/684. Redundant Connection.go:7.51,8.21 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0684.Redundant-Connection/684. Redundant Connection.go:8.21,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0684.Redundant-Connection/684. Redundant Connection.go:11.2,13.34 3 2 github.com/halfrost/LeetCode-Go/leetcode/0684.Redundant-Connection/684. Redundant Connection.go:13.34,14.51 1 8 github.com/halfrost/LeetCode-Go/leetcode/0684.Redundant-Connection/684. Redundant Connection.go:14.51,16.4 1 6 github.com/halfrost/LeetCode-Go/leetcode/0684.Redundant-Connection/684. Redundant Connection.go:16.9,19.4 2 2 github.com/halfrost/LeetCode-Go/leetcode/0684.Redundant-Connection/684. Redundant Connection.go:21.2,21.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:3.59,4.21 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:4.21,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:7.2,8.29 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:8.29,9.27 1 22 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:9.27,11.4 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:3.59,4.21 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:4.21,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:7.2,8.29 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:8.29,9.27 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:9.27,11.4 1 20 github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:11.9,17.4 5 5 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:19.2,19.35 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:19.35,21.3 1 22 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:22.2,22.29 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:22.29,23.19 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:19.2,19.35 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:19.35,21.3 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:22.2,22.29 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:22.29,23.19 1 25 github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:23.19,24.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:26.3,28.14 3 17 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:28.14,29.28 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:29.28,31.5 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:26.3,28.14 3 20 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:28.14,29.28 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:29.28,31.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:32.4,32.21 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:34.3,34.17 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:34.3,34.17 1 17 github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:36.2,36.19 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:39.41,40.23 1 26 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:40.23,42.3 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:43.2,43.21 1 26 -github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:9.55,11.30 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:11.30,13.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:14.2,14.21 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:14.21,17.15 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:17.15,18.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:20.3,21.36 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:21.36,23.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:25.2,25.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:39.41,40.23 1 31 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:40.23,42.3 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II.go:43.2,43.21 1 31 +github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:9.55,11.30 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:11.30,13.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:14.2,14.21 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:14.21,17.15 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:17.15,18.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:20.3,21.36 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:21.36,23.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0690.Employee-Importance/690. Employee Importance.go:25.2,25.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:5.51,7.29 2 2 github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:7.29,9.3 1 16 github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:10.2,12.22 3 2 @@ -5555,10 +5528,10 @@ github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Fr github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:19.30,22.3 2 6 github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:23.2,23.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:33.29,33.47 1 26 -github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:34.29,34.60 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:34.29,34.60 1 12 github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:35.34,36.28 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:36.28,38.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:39.2,39.30 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:36.28,38.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:39.2,39.30 1 10 github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:41.35,44.2 2 8 github.com/halfrost/LeetCode-Go/leetcode/0692.Top-K-Frequent-Words/692. Top K Frequent Words.go:45.33,50.2 4 8 github.com/halfrost/LeetCode-Go/leetcode/0693.Binary-Number-with-Alternating-Bits/693. Binary Number with Alternating Bits.go:4.37,15.2 2 4 @@ -5579,14 +5552,14 @@ github.com/halfrost/LeetCode-Go/leetcode/0695.Max-Area-of-Island/695. Max Area o github.com/halfrost/LeetCode-Go/leetcode/0695.Max-Area-of-Island/695. Max Area of Island.go:34.2,36.25 3 79 github.com/halfrost/LeetCode-Go/leetcode/0695.Max-Area-of-Island/695. Max Area of Island.go:36.25,40.3 3 316 github.com/halfrost/LeetCode-Go/leetcode/0695.Max-Area-of-Island/695. Max Area of Island.go:41.2,41.14 1 79 -github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:3.42,5.26 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:5.26,7.41 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:7.41,9.4 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:10.3,11.15 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:13.2,13.12 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:16.24,17.11 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:17.11,19.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:20.2,20.10 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:3.42,5.26 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:5.26,7.41 2 19 +github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:7.41,9.4 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:10.3,11.15 2 19 +github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:13.2,13.12 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:16.24,17.11 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:17.11,19.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings.go:20.2,20.10 1 18 github.com/halfrost/LeetCode-Go/leetcode/0697.Degree-of-an-Array/697. Degree of an Array.go:3.43,5.27 2 5 github.com/halfrost/LeetCode-Go/leetcode/0697.Degree-of-an-Array/697. Degree of an Array.go:5.27,6.41 1 31 github.com/halfrost/LeetCode-Go/leetcode/0697.Degree-of-an-Array/697. Degree of an Array.go:6.41,8.4 1 12 @@ -5646,46 +5619,46 @@ github.com/halfrost/LeetCode-Go/leetcode/0705.Design-HashSet/705. Design HashSet github.com/halfrost/LeetCode-Go/leetcode/0705.Design-HashSet/705. Design HashSet.go:14.37,16.2 1 3 github.com/halfrost/LeetCode-Go/leetcode/0705.Design-HashSet/705. Design HashSet.go:18.40,20.2 1 3 github.com/halfrost/LeetCode-Go/leetcode/0705.Design-HashSet/705. Design HashSet.go:23.47,25.2 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:15.44,16.18 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:16.18,19.3 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:20.2,20.19 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:20.19,23.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:24.2,24.24 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:27.37,28.18 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:28.18,30.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:31.2,31.19 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:31.19,33.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:34.2,34.24 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:37.46,38.18 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:38.18,42.3 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:43.2,43.19 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:43.19,45.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:46.2,46.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:50.33,52.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:55.48,57.17 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:57.17,60.3 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:61.2,61.22 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:65.41,67.21 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:15.44,16.18 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:16.18,19.3 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:20.2,20.19 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:20.19,23.3 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:24.2,24.24 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:27.37,28.18 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:28.18,30.3 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:31.2,31.19 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:31.19,33.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:34.2,34.24 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:37.46,38.18 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:38.18,42.3 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:43.2,43.19 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:43.19,45.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:46.2,46.10 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:50.33,52.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:55.48,57.17 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:57.17,60.3 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:61.2,61.22 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:65.41,67.21 2 14 github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:67.21,69.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:70.2,70.26 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:74.40,76.21 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:76.21,78.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:79.2,79.53 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:82.44,84.2 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:14.33,16.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:70.2,70.26 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:74.40,76.21 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:76.21,78.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:79.2,79.53 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0706.Design-HashMap/706. Design HashMap.go:82.44,84.2 1 33 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:14.33,16.2 1 3 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:19.46,21.44 2 6 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:21.44,23.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:24.2,24.17 1 6 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:24.17,26.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:26.8,28.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:32.46,35.22 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:32.46,35.22 3 7 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:35.22,37.3 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:38.2,38.18 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:42.46,43.22 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:43.22,46.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:47.2,49.38 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:49.38,51.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:52.2,53.18 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:38.2,38.18 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:42.46,43.22 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:43.22,46.3 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:47.2,49.38 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:49.38,51.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:52.2,53.18 2 5 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:57.58,58.16 1 4 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:58.16,60.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:60.8,63.47 3 3 @@ -5694,40 +5667,40 @@ github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Lin github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:66.18,69.24 3 2 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:69.24,71.5 1 2 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:72.4,72.20 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:78.52,79.16 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:79.16,81.23 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:81.23,83.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:84.8,86.47 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:78.52,79.16 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:79.16,81.23 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:81.23,83.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:84.8,86.47 2 2 github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:86.47,88.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:89.3,89.38 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:89.38,91.24 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:91.24,93.5 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:89.3,89.38 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:89.38,91.24 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0707.Design-Linked-List/707. Design Linked List.go:91.24,93.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0709.To-Lower-Case/709. To Lower Case.go:3.35,6.30 3 3 github.com/halfrost/LeetCode-Go/leetcode/0709.To-Lower-Case/709. To Lower Case.go:6.30,7.41 1 15 github.com/halfrost/LeetCode-Go/leetcode/0709.To-Lower-Case/709. To Lower Case.go:7.41,9.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0709.To-Lower-Case/709. To Lower Case.go:11.2,11.22 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:10.54,12.38 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:12.38,14.3 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:15.2,16.34 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:16.34,17.16 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:17.16,18.8 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:18.8,19.35 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:19.35,21.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:21.11,22.11 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:25.4,26.7 2 8 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:29.2,29.43 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:32.34,34.37 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:10.54,12.38 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:12.38,14.3 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:15.2,16.34 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:16.34,17.16 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:17.16,18.8 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:18.8,19.35 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:19.35,21.6 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:21.11,22.11 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:25.4,26.7 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:29.2,29.43 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:32.34,34.37 2 25 github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:34.37,36.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:37.2,37.12 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:3.57,4.20 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:4.20,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:7.2,8.23 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:8.23,9.48 1 36 +github.com/halfrost/LeetCode-Go/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist.go:37.2,37.12 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:3.57,4.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:4.20,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:7.2,8.23 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:8.23,9.48 1 39 github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:9.48,12.4 2 18 -github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:12.9,12.27 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:12.27,15.4 2 0 +github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:12.9,12.27 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:12.27,15.4 2 3 github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:15.9,19.4 3 18 -github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:21.2,21.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K.go:21.2,21.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/0714.Best-Time-to-Buy-and-Sell-Stock-with-Transaction-Fee/714. Best Time to Buy and Sell Stock with Transaction Fee.go:8.46,9.22 1 4 github.com/halfrost/LeetCode-Go/leetcode/0714.Best-Time-to-Buy-and-Sell-Stock-with-Transaction-Fee/714. Best Time to Buy and Sell Stock with Transaction Fee.go:9.22,11.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0714.Best-Time-to-Buy-and-Sell-Stock-with-Transaction-Fee/714. Best Time to Buy and Sell Stock with Transaction Fee.go:12.2,13.21 2 3 @@ -5773,40 +5746,40 @@ github.com/halfrost/LeetCode-Go/leetcode/0717.1-bit-and-2-bit-Characters/717. 1- github.com/halfrost/LeetCode-Go/leetcode/0717.1-bit-and-2-bit-Characters/717. 1-bit and 2-bit Characters.go:5.34,6.19 1 8 github.com/halfrost/LeetCode-Go/leetcode/0717.1-bit-and-2-bit-Characters/717. 1-bit and 2-bit Characters.go:6.19,8.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/0717.1-bit-and-2-bit-Characters/717. 1-bit and 2-bit Characters.go:10.2,10.25 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:6.39,8.17 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:8.17,10.29 2 14 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:10.29,12.4 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:12.9,14.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:16.2,16.12 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:19.28,20.11 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:20.11,22.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:6.39,8.17 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:8.17,10.29 2 16 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:10.29,12.4 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:12.9,14.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:16.2,16.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:19.28,20.11 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:20.11,22.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:23.2,23.10 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:26.45,29.32 2 28 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:29.32,31.3 1 758 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:32.2,32.24 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:32.24,34.20 2 1280 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:34.20,37.4 2 522 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:39.2,39.13 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:42.49,43.30 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:43.30,44.19 1 187 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:44.19,46.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:48.2,48.13 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:51.47,54.23 3 14 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:54.23,56.3 1 261 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:57.2,57.41 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:57.41,58.41 1 120 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:58.41,59.35 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:59.35,60.49 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:60.49,62.6 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:66.2,66.14 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:70.40,72.20 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:72.20,74.3 1 119 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:75.2,75.35 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:75.35,76.36 1 115 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:76.36,77.20 1 10075 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:77.20,79.23 2 9849 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:79.23,81.6 1 71 -github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:85.2,85.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:26.45,29.32 2 32 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:29.32,31.3 1 760 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:32.2,32.24 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:32.24,34.20 2 1294 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:34.20,37.4 2 534 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:39.2,39.13 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:42.49,43.30 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:43.30,44.19 1 189 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:44.19,46.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:48.2,48.13 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:51.47,54.23 3 16 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:54.23,56.3 1 268 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:57.2,57.41 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:57.41,58.41 1 123 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:58.41,59.35 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:59.35,60.49 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:60.49,62.6 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:66.2,66.14 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:70.40,72.20 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:72.20,74.3 1 124 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:75.2,75.35 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:75.35,76.36 1 119 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:76.36,77.20 1 10087 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:77.20,79.23 2 9852 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:79.23,81.6 1 72 +github.com/halfrost/LeetCode-Go/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray.go:85.2,85.12 1 5 github.com/halfrost/LeetCode-Go/leetcode/0719.Find-K-th-Smallest-Pair-Distance/719. Find K-th Smallest Pair Distance.go:7.50,10.17 3 5 github.com/halfrost/LeetCode-Go/leetcode/0719.Find-K-th-Smallest-Pair-Distance/719. Find K-th Smallest Pair Distance.go:10.17,13.15 3 14 github.com/halfrost/LeetCode-Go/leetcode/0719.Find-K-th-Smallest-Pair-Distance/719. Find K-th Smallest Pair Distance.go:13.15,15.4 1 8 @@ -5902,8 +5875,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Ato github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:21.25,23.16 2 11 github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:23.16,25.4 1 8 github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:27.2,27.10 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:30.36,32.12 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:32.12,34.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:30.36,32.12 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:32.12,34.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:36.2,37.25 2 4 github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:37.25,39.27 2 25 github.com/halfrost/LeetCode-Go/leetcode/0726.Number-of-Atoms/726. Number of Atoms.go:39.27,41.4 1 6 @@ -5954,24 +5927,24 @@ github.com/halfrost/LeetCode-Go/leetcode/0728.Self-Dividing-Numbers/728.Self Div github.com/halfrost/LeetCode-Go/leetcode/0728.Self-Dividing-Numbers/728.Self Dividing Numbers.go:19.3,19.24 1 78 github.com/halfrost/LeetCode-Go/leetcode/0728.Self-Dividing-Numbers/728.Self Dividing Numbers.go:19.24,21.4 1 38 github.com/halfrost/LeetCode-Go/leetcode/0728.Self-Dividing-Numbers/728.Self Dividing Numbers.go:23.2,23.13 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:11.42,12.46 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:11.42,12.46 1 29 github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:12.46,14.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:15.2,15.26 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:15.2,15.26 1 24 github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:15.26,16.20 1 19 github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:16.20,18.4 1 4 github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:18.9,20.4 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:21.8,22.21 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:22.21,24.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:24.9,26.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:28.2,28.13 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:37.34,41.2 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:44.55,46.22 2 13 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:46.22,49.3 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:50.2,50.31 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:21.8,22.21 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:22.21,24.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:24.9,26.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:28.2,28.13 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:37.34,41.2 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:44.55,46.22 2 16 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:46.22,49.3 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0729.My-Calendar-I/729. My Calendar I.go:50.2,50.31 1 13 github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:16.39,24.2 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:27.58,30.2 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:32.64,33.18 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:33.18,35.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:27.58,30.2 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:32.64,33.18 1 34 +github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:33.18,35.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:36.2,36.40 1 33 github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:36.40,38.28 2 10 github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:38.28,40.4 1 3 @@ -5986,11 +5959,11 @@ github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar I github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:59.8,59.31 1 8 github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:59.31,61.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0732.My-Calendar-III/732. My Calendar III.go:61.8,64.3 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:10.69,12.23 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:12.23,14.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:10.69,12.23 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:12.23,14.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:15.2,16.14 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:19.52,20.29 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:20.29,22.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:19.52,20.29 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:20.29,22.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:23.2,25.25 3 6 github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:25.25,26.153 1 24 github.com/halfrost/LeetCode-Go/leetcode/0733.Flood-Fill/733. Flood Fill.go:26.153,28.4 1 5 @@ -6027,11 +6000,11 @@ github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Pref github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:23.61,25.37 2 2 github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:25.37,27.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:28.2,28.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:36.51,38.2 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:40.63,41.44 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:41.44,42.91 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:42.91,44.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:46.2,46.11 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:36.51,38.2 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:40.63,41.44 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:41.44,42.91 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:42.91,44.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search.go:46.2,46.11 1 1 github.com/halfrost/LeetCode-Go/leetcode/0746.Min-Cost-Climbing-Stairs/746. Min Cost Climbing Stairs.go:4.44,7.33 3 2 github.com/halfrost/LeetCode-Go/leetcode/0746.Min-Cost-Climbing-Stairs/746. Min Cost Climbing Stairs.go:7.33,9.3 1 9 github.com/halfrost/LeetCode-Go/leetcode/0746.Min-Cost-Climbing-Stairs/746. Min Cost Climbing Stairs.go:10.2,10.46 1 2 @@ -6067,20 +6040,20 @@ github.com/halfrost/LeetCode-Go/leetcode/0748.Shortest-Completing-Word/748. Shor github.com/halfrost/LeetCode-Go/leetcode/0748.Shortest-Completing-Word/748. Shortest Completing Word.go:33.23,34.15 1 187 github.com/halfrost/LeetCode-Go/leetcode/0748.Shortest-Completing-Word/748. Shortest Completing Word.go:34.15,36.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0748.Shortest-Completing-Word/748. Shortest Completing Word.go:38.2,38.13 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:3.53,4.22 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:4.22,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:7.2,9.35 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:9.35,11.15 2 14 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:11.15,13.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:3.53,4.22 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:4.22,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:7.2,9.35 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:9.35,11.15 2 15 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:11.15,13.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:14.3,14.22 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:16.2,18.24 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:18.24,20.35 2 28 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:20.35,21.71 1 10382 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:21.71,23.19 2 41525 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:16.2,18.24 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:18.24,20.35 2 29 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:20.35,21.71 1 10383 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:21.71,23.19 2 41526 github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:23.19,25.6 1 4293 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:25.11,27.6 1 37232 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:28.5,28.29 1 41525 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:28.29,30.6 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:25.11,27.6 1 37233 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:28.5,28.29 1 41526 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:28.29,30.6 1 1 github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:31.5,31.26 1 41525 github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:31.26,34.6 2 5968 github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:35.5,35.19 1 41525 @@ -6092,7 +6065,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.g github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:43.26,46.6 2 4849 github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:49.3,50.10 2 26 github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:52.2,52.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:55.33,57.2 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0752.Open-the-Lock/752. Open the Lock.go:55.33,57.2 1 20 github.com/halfrost/LeetCode-Go/leetcode/0753.Cracking-the-Safe/753. Cracking the Safe.go:7.37,8.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/0753.Cracking-the-Safe/753. Cracking the Safe.go:8.12,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0753.Cracking-the-Safe/753. Cracking the Safe.go:11.2,13.26 3 1 @@ -6141,8 +6114,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0763.Partition-Labels/763. Partition La github.com/halfrost/LeetCode-Go/leetcode/0763.Partition-Labels/763. Partition Labels.go:39.3,39.15 1 24 github.com/halfrost/LeetCode-Go/leetcode/0763.Partition-Labels/763. Partition Labels.go:39.15,42.4 2 3 github.com/halfrost/LeetCode-Go/leetcode/0763.Partition-Labels/763. Partition Labels.go:44.2,44.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands.go:7.37,8.21 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands.go:8.21,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands.go:7.37,8.21 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands.go:8.21,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands.go:11.2,13.40 3 4 github.com/halfrost/LeetCode-Go/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands.go:13.40,15.3 1 13 github.com/halfrost/LeetCode-Go/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands.go:16.2,16.40 1 4 @@ -6154,15 +6127,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0766.Toeplitz-Matrix/766. Toeplitz Matr github.com/halfrost/LeetCode-Go/leetcode/0766.Toeplitz-Matrix/766. Toeplitz Matrix.go:6.32,7.40 1 7 github.com/halfrost/LeetCode-Go/leetcode/0766.Toeplitz-Matrix/766. Toeplitz Matrix.go:7.40,9.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0766.Toeplitz-Matrix/766. Toeplitz Matrix.go:12.2,12.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:7.40,9.14 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:9.14,11.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:7.40,9.14 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:9.14,11.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:12.2,15.38 4 1 github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:15.38,17.18 2 2 github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:17.18,19.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:20.3,20.6 1 2 github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:22.2,22.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:25.40,26.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:26.13,28.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:25.40,26.13 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:26.13,28.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:29.2,32.23 4 2 github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:32.23,34.30 2 6 github.com/halfrost/LeetCode-Go/leetcode/0767.Reorganize-String/767. Reorganize String.go:34.30,36.4 1 1 @@ -6222,20 +6195,20 @@ github.com/halfrost/LeetCode-Go/leetcode/0781.Rabbits-in-Forest/781. Rabbits in github.com/halfrost/LeetCode-Go/leetcode/0781.Rabbits-in-Forest/781. Rabbits in Forest.go:6.16,9.4 2 3 github.com/halfrost/LeetCode-Go/leetcode/0781.Rabbits-in-Forest/781. Rabbits in Forest.go:9.9,11.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0781.Rabbits-in-Forest/781. Rabbits in Forest.go:13.2,13.14 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:21.39,25.2 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:27.44,28.17 1 33 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:28.17,30.3 1 18 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:31.2,32.16 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:32.16,34.3 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:35.2,36.30 2 15 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:39.24,40.11 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:40.11,42.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:21.39,25.2 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:27.44,28.17 1 38 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:28.17,30.3 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:31.2,32.16 2 17 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:32.16,34.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:35.2,36.30 2 17 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:39.24,40.11 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:40.11,42.3 1 5 github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:43.2,43.10 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:46.21,47.11 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:46.21,47.11 1 13 github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:47.11,49.3 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:50.2,50.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:8.47,9.17 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:9.17,11.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes.go:50.2,50.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:8.47,9.17 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:9.17,11.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:12.2,14.31 3 5 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:14.31,15.27 1 16 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:15.27,17.4 1 7 @@ -6251,15 +6224,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Lette github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:38.3,39.9 2 17 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:41.2,41.54 1 12 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:41.54,45.3 3 17 -github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:56.48,59.22 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:56.48,59.22 3 6 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:59.22,60.27 1 16 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:60.27,61.20 1 7 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:62.11,63.40 1 4 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:64.12,65.27 1 3 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:65.27,67.6 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:71.2,71.19 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:71.19,73.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:74.2,74.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:71.2,71.19 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:71.19,73.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:74.2,74.12 1 6 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:77.31,79.2 1 16 github.com/halfrost/LeetCode-Go/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation.go:81.38,85.2 3 12 github.com/halfrost/LeetCode-Go/leetcode/0785.Is-Graph-Bipartite/785. Is Graph Bipartite.go:4.38,6.24 2 3 @@ -6291,8 +6264,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:26.9,26.23 1 6 github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:26.23,28.4 1 4 github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:28.9,30.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:35.54,36.46 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:36.46,38.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:35.54,36.46 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:36.46,38.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:39.2,40.30 2 4 github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:40.30,41.35 1 13 github.com/halfrost/LeetCode-Go/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction.go:41.35,43.4 1 18 @@ -6313,40 +6286,40 @@ github.com/halfrost/LeetCode-Go/leetcode/0792.Number-of-Matching-Subsequences/79 github.com/halfrost/LeetCode-Go/leetcode/0792.Number-of-Matching-Subsequences/792. Number of Matching Subsequences.go:12.19,14.13 2 3 github.com/halfrost/LeetCode-Go/leetcode/0792.Number-of-Matching-Subsequences/792. Number of Matching Subsequences.go:16.4,16.60 1 5 github.com/halfrost/LeetCode-Go/leetcode/0792.Number-of-Matching-Subsequences/792. Number of Matching Subsequences.go:19.2,19.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:4.33,6.18 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:6.18,9.13 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:9.13,11.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:11.9,11.19 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:4.33,6.18 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:6.18,9.13 3 9 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:9.13,11.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:11.9,11.19 1 7 github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:11.19,13.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:13.9,15.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:13.9,15.4 1 6 github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:17.2,17.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:20.32,21.14 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:21.14,23.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:24.2,24.34 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:28.34,30.15 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:30.15,32.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:33.2,33.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:33.12,35.18 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:20.32,21.14 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:21.14,23.3 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:24.2,24.34 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:28.34,30.15 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:30.15,32.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:33.2,33.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:33.12,35.18 2 2 github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:35.18,37.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:38.3,38.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:40.2,40.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:3.42,5.23 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:5.23,6.27 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:6.27,7.26 1 36 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:7.26,9.5 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:9.10,9.33 1 26 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:9.33,11.5 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:14.2,14.34 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:38.3,38.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function.go:40.2,40.10 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:3.42,5.23 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:5.23,6.27 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:6.27,7.26 1 54 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:7.26,9.5 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:9.10,9.33 1 36 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:9.33,11.5 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:14.2,14.34 1 6 github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:14.34,16.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:17.2,17.18 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:17.18,19.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:20.2,20.28 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:23.43,25.119 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:17.2,17.18 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:17.18,19.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:20.2,20.28 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:23.43,25.119 1 4 github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:25.119,27.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:29.2,31.62 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:31.62,33.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:35.2,36.62 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:36.62,38.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:29.2,31.62 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:31.62,33.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:35.2,36.62 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:36.62,38.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State.go:39.2,39.13 1 1 github.com/halfrost/LeetCode-Go/leetcode/0795.Number-of-Subarrays-with-Bounded-Maximum/795. Number of Subarrays with Bounded Maximum.go:3.65,5.2 1 1 github.com/halfrost/LeetCode-Go/leetcode/0795.Number-of-Subarrays-with-Bounded-Maximum/795. Number of Subarrays with Bounded Maximum.go:7.51,9.27 2 2 @@ -6365,8 +6338,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0802.Find-Eventual-Safe-States/802. Fin github.com/halfrost/LeetCode-Go/leetcode/0802.Find-Eventual-Safe-States/802. Find Eventual Safe States.go:19.28,20.57 1 6 github.com/halfrost/LeetCode-Go/leetcode/0802.Find-Eventual-Safe-States/802. Find Eventual Safe States.go:20.57,22.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0802.Find-Eventual-Safe-States/802. Find Eventual Safe States.go:24.2,25.13 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go:14.50,15.20 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go:15.20,17.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go:14.50,15.20 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go:15.20,17.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go:18.2,21.27 3 4 github.com/halfrost/LeetCode-Go/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go:21.27,22.32 1 13 github.com/halfrost/LeetCode-Go/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit.go:22.32,24.4 1 9 @@ -6405,13 +6378,13 @@ github.com/halfrost/LeetCode-Go/leetcode/0807.Max-Increase-to-Keep-City-Skyline/ github.com/halfrost/LeetCode-Go/leetcode/0807.Max-Increase-to-Keep-City-Skyline/807.Max Increase to Keep City Skyline.go:34.24,35.11 1 25 github.com/halfrost/LeetCode-Go/leetcode/0807.Max-Increase-to-Keep-City-Skyline/807.Max Increase to Keep City Skyline.go:35.11,37.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0807.Max-Increase-to-Keep-City-Skyline/807.Max Increase to Keep City Skyline.go:38.2,38.10 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game.go:3.31,4.22 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game.go:4.22,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game.go:3.31,4.22 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game.go:4.22,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game.go:7.2,8.27 2 1 github.com/halfrost/LeetCode-Go/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game.go:8.27,10.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game.go:11.2,11.17 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:9.51,11.25 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:11.25,13.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:9.51,11.25 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:11.25,13.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:14.2,15.35 2 2 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:15.35,19.45 4 5 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:19.45,23.42 4 13 @@ -6420,15 +6393,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdoma github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:30.2,30.35 1 2 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:30.35,33.3 2 10 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:34.2,34.15 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:38.52,42.30 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:38.52,42.30 4 3 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:42.30,44.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:45.2,45.28 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:45.2,45.28 1 3 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:45.28,51.3 5 10 -github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:52.2,52.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:55.57,59.27 4 5 -github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:59.27,60.15 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:60.15,62.16 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:62.16,63.13 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:52.2,52.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:55.57,59.27 4 6 +github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:59.27,60.15 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:60.15,62.16 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:62.16,63.13 1 1 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:65.4,65.9 1 5 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:68.2,68.40 1 5 github.com/halfrost/LeetCode-Go/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count.go:68.40,69.23 1 71 @@ -6451,21 +6424,21 @@ github.com/halfrost/LeetCode-Go/leetcode/0812.Largest-Triangle-Area/812. Largest github.com/halfrost/LeetCode-Go/leetcode/0812.Largest-Triangle-Area/812. Largest Triangle Area.go:26.32,27.11 1 10 github.com/halfrost/LeetCode-Go/leetcode/0812.Largest-Triangle-Area/812. Largest Triangle Area.go:27.11,29.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0812.Largest-Triangle-Area/812. Largest Triangle Area.go:30.2,30.10 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:3.62,4.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:4.12,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:8.2,9.35 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:9.35,10.31 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:10.31,14.4 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:16.2,17.21 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:17.21,20.29 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:20.29,23.42 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:23.42,24.29 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:24.29,25.14 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:27.5,28.35 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:28.35,29.16 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:29.16,31.7 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:32.6,32.30 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:37.2,37.11 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:3.62,4.12 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:4.12,6.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:8.2,9.35 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:9.35,10.31 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:10.31,14.4 3 24 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:16.2,17.21 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:17.21,20.29 3 10 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:20.29,23.42 3 22 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:23.42,24.29 1 28 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:24.29,25.14 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:27.5,28.35 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:28.35,29.16 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:29.16,31.7 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:32.6,32.30 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0815.Bus-Routes/815. Bus Routes.go:37.2,37.11 1 2 github.com/halfrost/LeetCode-Go/leetcode/0816.Ambiguous-Coordinates/816. Ambiguous Coordinates.go:3.46,6.30 3 1 github.com/halfrost/LeetCode-Go/leetcode/0816.Ambiguous-Coordinates/816. Ambiguous Coordinates.go:6.30,9.24 3 5 github.com/halfrost/LeetCode-Go/leetcode/0816.Ambiguous-Coordinates/816. Ambiguous Coordinates.go:9.24,10.25 1 13 @@ -6480,8 +6453,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0816.Ambiguous-Coordinates/816. Ambiguo github.com/halfrost/LeetCode-Go/leetcode/0816.Ambiguous-Coordinates/816. Ambiguous Coordinates.go:32.2,32.30 1 8 github.com/halfrost/LeetCode-Go/leetcode/0816.Ambiguous-Coordinates/816. Ambiguous Coordinates.go:32.30,34.3 1 15 github.com/halfrost/LeetCode-Go/leetcode/0816.Ambiguous-Coordinates/816. Ambiguous Coordinates.go:35.2,35.12 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:18.49,19.22 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:19.22,21.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:18.49,19.22 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:19.22,21.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:22.2,26.17 4 7 github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:26.17,27.33 1 46 github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:27.33,28.23 1 33 @@ -6493,21 +6466,21 @@ github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:41.33,43.26 2 7 github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:43.26,45.3 1 33 github.com/halfrost/LeetCode-Go/leetcode/0817.Linked-List-Components/817. Linked List Components.go:46.2,46.13 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:5.63,7.30 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:7.30,8.88 1 55 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:8.88,9.18 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:9.18,12.5 2 13 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:13.4,13.14 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:14.9,15.19 1 41 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:15.19,17.5 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:20.2,20.17 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:20.17,23.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:25.2,25.36 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:5.63,7.30 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:7.30,8.88 1 64 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:8.88,9.18 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:9.18,12.5 2 17 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:13.4,13.14 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:14.9,15.19 1 46 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:15.19,17.5 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:20.2,20.17 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:20.17,23.3 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:25.2,25.36 1 2 github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:25.36,27.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:29.2,30.34 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:30.34,31.27 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:31.27,34.4 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:36.2,36.21 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:29.2,30.34 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:30.34,31.27 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:31.27,34.4 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0819.Most-Common-Word/819. Most Common Word.go:36.2,36.21 1 2 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:4.48,6.26 2 2 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:6.26,8.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:9.2,9.19 1 2 @@ -6516,23 +6489,23 @@ github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:14.2,14.19 1 2 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:14.19,16.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:17.2,17.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:26.42,27.14 1 22 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:27.14,29.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:30.2,30.23 1 22 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:30.23,31.45 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:26.42,27.14 1 27 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:27.14,29.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:30.2,30.23 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:30.23,31.45 1 16 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:31.45,33.4 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:35.2,35.19 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:38.30,39.14 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:39.14,41.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:35.2,35.19 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:38.30,39.14 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:39.14,41.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:42.2,42.24 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:45.30,47.35 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:47.35,48.33 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:45.30,47.35 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:47.35,48.33 1 14 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:48.33,50.12 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:52.3,55.13 4 9 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:59.42,61.35 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:61.35,62.33 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:52.3,55.13 4 12 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:59.42,61.35 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:61.35,62.33 1 12 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:62.33,64.12 2 11 -github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:66.3,66.13 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:66.3,66.13 1 1 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:68.2,68.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:71.49,73.23 2 2 github.com/halfrost/LeetCode-Go/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words.go:73.23,74.19 1 4 @@ -6591,42 +6564,40 @@ github.com/halfrost/LeetCode-Go/leetcode/0823.Binary-Trees-With-Factors/823. Bin github.com/halfrost/LeetCode-Go/leetcode/0823.Binary-Trees-With-Factors/823. Binary Trees With Factors.go:65.2,66.27 2 2 github.com/halfrost/LeetCode-Go/leetcode/0823.Binary-Trees-With-Factors/823. Binary Trees With Factors.go:66.27,68.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0823.Binary-Trees-With-Factors/823. Binary Trees With Factors.go:69.2,69.25 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:6.40,8.27 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:8.27,10.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:11.2,11.27 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:11.27,13.3 1 360 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:14.2,14.28 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:14.28,15.19 1 318 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:15.19,18.4 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:20.2,20.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:24.41,27.27 3 3 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:27.27,28.15 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:28.15,29.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:31.3,31.30 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:31.30,33.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:34.3,34.51 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:34.51,36.4 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:37.3,37.22 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:39.2,39.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:43.41,45.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:45.25,47.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:48.2,48.28 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:48.28,49.29 1 360 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:49.29,50.13 1 43200 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:50.13,51.13 1 21420 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:53.4,53.20 1 21780 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:53.20,54.13 1 13194 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:56.4,56.26 1 8586 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:56.26,57.13 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:59.4,59.14 1 8586 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:59.14,61.5 1 8268 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:61.10,63.5 1 318 -github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:66.2,66.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:6.40,8.27 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:8.27,10.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:11.2,11.27 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:11.27,13.3 1 480 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:14.2,14.28 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:14.28,15.19 1 424 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:15.19,18.4 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:20.2,20.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:24.41,27.27 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:27.27,28.15 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:28.15,29.12 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:31.3,31.30 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:31.30,33.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:34.3,34.51 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:34.51,36.4 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:37.3,37.22 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:39.2,39.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:43.41,45.25 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:45.25,47.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:48.2,48.28 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:48.28,49.29 1 480 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:49.29,50.13 1 57600 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:50.13,51.13 1 28560 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:53.4,53.20 1 29040 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:53.20,54.13 1 17592 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:56.4,56.14 1 11448 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:56.14,58.5 1 11024 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:58.10,60.5 1 424 +github.com/halfrost/LeetCode-Go/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go:63.2,63.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:18.26,18.43 1 2 github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:21.31,21.58 1 2 github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:27.41,29.2 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:31.76,32.66 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:32.66,34.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:31.76,32.66 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:32.66,34.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:35.2,36.39 2 2 github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:36.39,38.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:39.2,41.34 3 2 @@ -6640,15 +6611,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Mo github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:57.28,58.11 1 6 github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:58.11,60.3 1 5 github.com/halfrost/LeetCode-Go/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work.go:61.2,61.10 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:3.39,5.30 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:3.39,5.30 2 5 github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:5.30,7.36 2 20 github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:7.36,9.4 1 16 github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:10.3,11.42 2 20 github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:11.42,13.4 1 17 github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:14.3,14.34 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:16.2,16.25 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:20.40,21.17 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:21.17,23.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:16.2,16.25 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:20.40,21.17 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:21.17,23.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:24.2,25.30 2 4 github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:25.30,27.31 2 20 github.com/halfrost/LeetCode-Go/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String.go:27.31,30.32 3 77 @@ -6732,8 +6703,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0841.Keys-and-Rooms/841. Keys and Rooms github.com/halfrost/LeetCode-Go/leetcode/0841.Keys-and-Rooms/841. Keys and Rooms.go:11.30,12.18 1 9 github.com/halfrost/LeetCode-Go/leetcode/0841.Keys-and-Rooms/841. Keys and Rooms.go:12.18,13.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/0841.Keys-and-Rooms/841. Keys and Rooms.go:15.3,16.36 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence.go:8.41,9.16 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence.go:9.16,11.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence.go:8.41,9.16 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence.go:9.16,11.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence.go:12.2,13.53 2 7 github.com/halfrost/LeetCode-Go/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence.go:13.53,14.34 1 37 github.com/halfrost/LeetCode-Go/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence.go:14.34,15.9 1 1 @@ -6820,47 +6791,51 @@ github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle A github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:56.2,57.32 2 4 github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:57.32,59.3 1 14 github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:60.2,60.54 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:83.71,86.33 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:86.33,88.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:89.2,90.19 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:90.19,92.3 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:96.74,97.21 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:97.21,100.3 2 10 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:101.2,104.54 4 6 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:107.82,109.77 2 29 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:109.77,111.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:111.8,111.85 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:83.71,86.33 3 7 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:86.33,88.3 1 30 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:89.2,90.19 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:90.19,92.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:96.74,97.21 1 42 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:97.21,100.3 2 24 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:101.2,104.54 4 18 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:107.82,109.77 2 47 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:109.77,111.3 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:111.8,111.85 1 27 github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:111.85,113.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:113.8,113.85 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:113.8,113.85 1 22 github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:113.85,115.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:116.2,116.67 1 29 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:119.54,121.2 1 78 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:123.55,125.2 1 78 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:130.56,131.23 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:131.23,133.3 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:134.2,134.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:137.96,139.44 2 12 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:139.44,141.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:142.2,142.46 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:142.46,143.36 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:143.36,145.4 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:116.2,116.67 1 47 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:119.54,121.2 1 118 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:123.55,125.2 1 118 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:130.56,131.23 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:131.23,133.3 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:134.2,134.10 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:137.96,139.44 2 27 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:139.44,141.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:142.2,142.46 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:142.46,143.36 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:143.36,145.4 1 14 github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:146.3,146.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:148.2,148.30 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:148.30,150.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:150.8,150.39 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:150.39,152.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:154.2,155.82 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:159.70,160.23 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:160.23,162.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:165.100,167.64 2 60 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:167.64,169.3 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:171.2,171.48 1 48 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:171.48,172.22 1 31 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:172.22,174.4 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:175.3,175.22 1 31 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:175.22,179.4 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:180.3,180.9 1 31 -github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:182.2,185.54 3 17 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:148.2,148.21 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:148.21,149.36 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:149.36,151.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:152.3,152.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:154.2,154.30 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:154.30,156.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:156.8,156.39 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:156.39,158.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:160.2,161.82 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:165.70,166.23 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:166.23,168.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:171.100,173.64 2 73 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:173.64,175.3 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:177.2,177.48 1 61 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:177.48,178.22 1 44 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:178.22,180.4 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:181.3,181.22 1 44 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:181.22,185.4 3 12 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:186.3,186.9 1 44 +github.com/halfrost/LeetCode-Go/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go:188.2,191.54 3 17 github.com/halfrost/LeetCode-Go/leetcode/0851.Loud-and-Rich/851. Loud and Rich.go:3.53,5.23 2 1 github.com/halfrost/LeetCode-Go/leetcode/0851.Loud-and-Rich/851. Loud and Rich.go:5.23,7.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/0851.Loud-and-Rich/851. Loud and Rich.go:8.2,9.30 2 1 @@ -6879,24 +6854,24 @@ github.com/halfrost/LeetCode-Go/leetcode/0851.Loud-and-Rich/851. Loud and Rich.g github.com/halfrost/LeetCode-Go/leetcode/0851.Loud-and-Rich/851. Loud and Rich.go:32.27,34.6 1 4 github.com/halfrost/LeetCode-Go/leetcode/0851.Loud-and-Rich/851. Loud and Rich.go:37.3,37.16 1 4 github.com/halfrost/LeetCode-Go/leetcode/0851.Loud-and-Rich/851. Loud and Rich.go:39.2,39.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:4.44,6.18 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:6.18,8.45 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:8.45,10.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:11.3,11.45 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:11.45,13.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:14.3,14.45 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:14.45,16.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:18.2,18.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:22.45,24.17 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:24.17,27.24 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:27.24,29.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:29.9,31.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:33.2,33.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:4.44,6.18 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:6.18,8.45 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:8.45,10.9 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:12.3,12.45 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:12.45,14.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:15.3,15.45 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:15.45,17.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:19.2,19.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:23.45,25.17 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:25.17,28.24 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:28.24,30.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:30.9,32.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go:34.2,34.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:15.41,15.58 1 1 github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:16.41,16.68 1 2 github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:17.41,17.81 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:19.60,21.12 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:21.12,23.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:19.60,21.12 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:21.12,23.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:24.2,25.25 2 1 github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:25.25,27.3 1 5 github.com/halfrost/LeetCode-Go/leetcode/0853.Car-Fleet/853. Car Fleet.go:28.2,30.33 3 1 @@ -6914,21 +6889,21 @@ github.com/halfrost/LeetCode-Go/leetcode/0856.Score-of-Parentheses/856. Score of github.com/halfrost/LeetCode-Go/leetcode/0856.Score-of-Parentheses/856. Score of Parentheses.go:27.2,27.22 1 6 github.com/halfrost/LeetCode-Go/leetcode/0856.Score-of-Parentheses/856. Score of Parentheses.go:27.22,31.3 3 8 github.com/halfrost/LeetCode-Go/leetcode/0856.Score-of-Parentheses/856. Score of Parentheses.go:32.2,32.12 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:3.47,4.40 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:4.40,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:7.2,8.15 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:3.47,4.40 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:4.40,6.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:7.2,8.15 2 5 github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:8.15,9.31 1 2 github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:9.31,10.29 1 4 github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:10.29,12.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:13.4,13.14 1 3 github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:15.3,15.15 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:17.2,18.30 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:18.30,19.22 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:19.22,20.19 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:20.19,22.5 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:22.10,22.27 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:22.27,24.5 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:24.10,26.5 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:17.2,18.30 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:18.30,19.22 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:19.22,20.19 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:20.19,22.5 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:22.10,22.27 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:22.27,24.5 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:24.10,26.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0859.Buddy-Strings/859.Buddy Strings.go:29.2,29.77 1 2 github.com/halfrost/LeetCode-Go/leetcode/0862.Shortest-Subarray-with-Sum-at-Least-K/862. Shortest Subarray with Sum at Least K.go:3.43,5.30 2 3 github.com/halfrost/LeetCode-Go/leetcode/0862.Shortest-Subarray-with-Sum-at-Least-K/862. Shortest Subarray with Sum at Least K.go:5.30,7.3 1 6 @@ -6943,25 +6918,25 @@ github.com/halfrost/LeetCode-Go/leetcode/0862.Shortest-Subarray-with-Sum-at-Leas github.com/halfrost/LeetCode-Go/leetcode/0862.Shortest-Subarray-with-Sum-at-Least-K/862. Shortest Subarray with Sum at Least K.go:26.2,26.19 1 3 github.com/halfrost/LeetCode-Go/leetcode/0862.Shortest-Subarray-with-Sum-at-Least-K/862. Shortest Subarray with Sum at Least K.go:26.19,28.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0862.Shortest-Subarray-with-Sum-at-Least-K/862. Shortest Subarray with Sum at Least K.go:29.2,29.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:18.63,22.2 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:24.69,25.17 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:25.17,27.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:28.2,28.20 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:28.20,31.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:32.2,33.23 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:33.23,35.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:36.2,36.22 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:36.22,39.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:40.2,41.24 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:41.24,43.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:44.2,44.23 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:44.23,47.3 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:48.2,48.11 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:51.53,52.17 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:52.17,54.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:55.2,55.12 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:55.12,57.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:57.8,60.3 2 0 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:18.63,22.2 3 8 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:24.69,25.17 1 50 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:25.17,27.3 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:28.2,28.20 1 30 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:28.20,31.3 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:32.2,33.23 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:33.23,35.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:36.2,36.22 1 22 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:36.22,39.3 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:40.2,41.24 2 20 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:41.24,43.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:44.2,44.23 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:44.23,47.3 2 1 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:48.2,48.11 1 19 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:51.53,52.17 1 35 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:52.17,54.3 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:55.2,55.12 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:55.12,57.3 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree.go:57.8,60.3 2 11 github.com/halfrost/LeetCode-Go/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys.go:16.45,17.20 1 9 github.com/halfrost/LeetCode-Go/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys.go:17.20,19.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0864.Shortest-Path-to-Get-All-Keys/864. Shortest Path to Get All Keys.go:20.2,21.33 2 8 @@ -7066,16 +7041,16 @@ github.com/halfrost/LeetCode-Go/leetcode/0870.Advantage-Shuffle/870. Advantage S github.com/halfrost/LeetCode-Go/leetcode/0870.Advantage-Shuffle/870. Advantage Shuffle.go:22.12,25.4 2 7 github.com/halfrost/LeetCode-Go/leetcode/0870.Advantage-Shuffle/870. Advantage Shuffle.go:25.9,28.4 2 1 github.com/halfrost/LeetCode-Go/leetcode/0870.Advantage-Shuffle/870. Advantage Shuffle.go:30.2,30.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:18.57,22.30 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:22.30,24.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:25.2,25.23 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:25.23,26.27 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:26.27,28.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:18.57,22.30 4 3 +github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:22.30,24.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:25.2,25.23 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:25.23,26.27 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:26.27,28.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:30.2,30.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:33.43,34.17 1 22 -github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:34.17,35.44 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:35.44,37.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:38.3,39.28 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:33.43,34.17 1 48 +github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:34.17,35.44 1 21 +github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:35.44,37.4 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees.go:38.3,39.28 2 21 github.com/halfrost/LeetCode-Go/leetcode/0874.Walking-Robot-Simulation/874. Walking Robot Simulation.go:3.54,5.30 2 2 github.com/halfrost/LeetCode-Go/leetcode/0874.Walking-Robot-Simulation/874. Walking Robot Simulation.go:5.30,6.18 1 2 github.com/halfrost/LeetCode-Go/leetcode/0874.Walking-Robot-Simulation/874. Walking Robot Simulation.go:6.18,8.4 1 1 @@ -7125,7 +7100,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0878.Nth-Magical-Number/878. Nth Magica github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:3.31,4.32 1 145 github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:4.32,6.3 1 68 github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:7.2,7.14 1 77 -github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:10.44,12.30 2 22 +github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:10.44,12.30 2 23 github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:12.30,13.21 1 145 github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:13.21,15.19 2 68 github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:15.19,17.5 1 6 @@ -7134,7 +7109,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decod github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:20.22,22.6 1 14 github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:23.5,23.40 1 2 github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:25.4,25.29 1 61 -github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:28.2,28.11 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index.go:28.2,28.11 1 1 github.com/halfrost/LeetCode-Go/leetcode/0881.Boats-to-Save-People/881. Boats to Save People.go:7.50,10.20 3 5 github.com/halfrost/LeetCode-Go/leetcode/0881.Boats-to-Save-People/881. Boats to Save People.go:10.20,11.20 1 13 github.com/halfrost/LeetCode-Go/leetcode/0881.Boats-to-Save-People/881. Boats to Save People.go:11.20,14.4 2 3 @@ -7183,20 +7158,20 @@ github.com/halfrost/LeetCode-Go/leetcode/0888.Fair-Candy-Swap/888. Fair Candy Sw github.com/halfrost/LeetCode-Go/leetcode/0888.Fair-Candy-Swap/888. Fair Candy Swap.go:29.24,30.11 1 5 github.com/halfrost/LeetCode-Go/leetcode/0888.Fair-Candy-Swap/888. Fair Candy Swap.go:30.11,32.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0888.Fair-Candy-Swap/888. Fair Candy Swap.go:33.2,33.10 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:3.69,5.29 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:5.29,6.27 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:6.27,8.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:10.2,10.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:13.30,14.22 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:14.22,16.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:17.2,18.30 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:18.30,19.27 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:3.69,5.29 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:5.29,6.27 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:6.27,8.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:10.2,10.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:13.30,14.22 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:14.22,16.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:17.2,18.30 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:18.30,19.27 1 22 github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:19.27,20.17 1 5 github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:20.17,22.5 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:23.9,24.18 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:23.9,24.18 1 17 github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:24.18,26.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:27.4,28.21 2 14 -github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:31.2,31.13 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:27.4,28.21 2 16 +github.com/halfrost/LeetCode-Go/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern.go:31.2,31.13 1 6 github.com/halfrost/LeetCode-Go/leetcode/0891.Sum-of-Subsequence-Widths/891. Sum of Subsequence Widths.go:7.35,10.25 3 2 github.com/halfrost/LeetCode-Go/leetcode/0891.Sum-of-Subsequence-Widths/891. Sum of Subsequence Widths.go:10.25,13.3 2 7 github.com/halfrost/LeetCode-Go/leetcode/0891.Sum-of-Subsequence-Widths/891. Sum of Subsequence Widths.go:14.2,14.12 1 2 @@ -7226,8 +7201,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0895.Maximum-Frequency-Stack/895. Maxim github.com/halfrost/LeetCode-Go/leetcode/0895.Maximum-Frequency-Stack/895. Maximum Frequency Stack.go:29.34,34.40 5 6 github.com/halfrost/LeetCode-Go/leetcode/0895.Maximum-Frequency-Stack/895. Maximum Frequency Stack.go:34.40,36.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0895.Maximum-Frequency-Stack/895. Maximum Frequency Stack.go:37.2,37.10 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0896.Monotonic-Array/896. Monotonic Array.go:3.32,4.17 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0896.Monotonic-Array/896. Monotonic Array.go:4.17,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0896.Monotonic-Array/896. Monotonic Array.go:3.32,4.17 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0896.Monotonic-Array/896. Monotonic Array.go:4.17,6.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0896.Monotonic-Array/896. Monotonic Array.go:7.2,7.17 1 6 github.com/halfrost/LeetCode-Go/leetcode/0896.Monotonic-Array/896. Monotonic Array.go:7.17,9.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/0896.Monotonic-Array/896. Monotonic Array.go:10.2,10.17 1 3 @@ -7316,20 +7291,18 @@ github.com/halfrost/LeetCode-Go/leetcode/0907.Sum-of-Subarray-Minimums/907. Sum github.com/halfrost/LeetCode-Go/leetcode/0907.Sum-of-Subarray-Minimums/907. Sum of Subarray Minimums.go:62.35,65.5 2 5 github.com/halfrost/LeetCode-Go/leetcode/0907.Sum-of-Subarray-Minimums/907. Sum of Subarray Minimums.go:66.4,66.30 1 10 github.com/halfrost/LeetCode-Go/leetcode/0907.Sum-of-Subarray-Minimums/907. Sum of Subarray Minimums.go:69.2,69.18 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:7.42,11.21 4 1 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:11.21,14.27 3 20 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:14.27,16.17 2 115 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:16.17,17.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:19.4,20.23 2 115 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:20.23,22.5 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:23.4,23.18 1 115 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:23.18,25.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:26.4,26.21 1 114 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:26.21,29.5 2 25 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:32.2,32.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:35.38,37.14 2 115 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:37.14,39.3 1 63 -github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:40.2,41.13 2 115 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:7.42,11.21 4 2 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:11.21,14.44 3 22 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:14.44,17.23 3 127 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:17.23,19.5 1 24 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:20.4,20.18 1 127 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:20.18,22.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:23.4,23.21 1 126 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:23.21,26.5 2 26 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:29.2,29.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:32.38,34.14 2 127 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:34.14,36.3 1 69 +github.com/halfrost/LeetCode-Go/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go:37.2,38.13 2 127 github.com/halfrost/LeetCode-Go/leetcode/0910.Smallest-Range-II/910.Smallest Range II.go:5.42,9.27 4 3 github.com/halfrost/LeetCode-Go/leetcode/0910.Smallest-Range-II/910.Smallest Range II.go:9.27,14.3 4 3 github.com/halfrost/LeetCode-Go/leetcode/0910.Smallest-Range-II/910.Smallest Range II.go:15.2,15.12 1 3 @@ -7398,8 +7371,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0920.Number-of-Music-Playlists/920. Num github.com/halfrost/LeetCode-Go/leetcode/0920.Number-of-Music-Playlists/920. Number of Music Playlists.go:10.27,12.13 2 21 github.com/halfrost/LeetCode-Go/leetcode/0920.Number-of-Music-Playlists/920. Number of Music Playlists.go:12.13,14.5 1 15 github.com/halfrost/LeetCode-Go/leetcode/0920.Number-of-Music-Playlists/920. Number of Music Playlists.go:17.2,17.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid.go:3.38,4.17 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid.go:4.17,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid.go:3.38,4.17 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid.go:4.17,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid.go:7.2,8.22 2 4 github.com/halfrost/LeetCode-Go/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid.go:8.22,9.15 1 14 github.com/halfrost/LeetCode-Go/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid.go:9.15,11.4 1 8 @@ -7414,49 +7387,49 @@ github.com/halfrost/LeetCode-Go/leetcode/0922.Sort-Array-By-Parity-II/922. Sort github.com/halfrost/LeetCode-Go/leetcode/0922.Sort-Array-By-Parity-II/922. Sort Array By Parity II.go:11.18,14.4 2 2 github.com/halfrost/LeetCode-Go/leetcode/0922.Sort-Array-By-Parity-II/922. Sort Array By Parity II.go:14.9,17.4 2 2 github.com/halfrost/LeetCode-Go/leetcode/0922.Sort-Array-By-Parity-II/922. Sort Array By Parity II.go:19.2,19.12 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:7.45,10.26 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:10.26,12.3 1 16 -github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:14.2,15.27 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:15.27,17.3 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:18.2,21.37 3 2 -github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:21.37,23.61 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:23.61,25.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:26.3,26.42 1 7 +github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:7.45,10.26 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:10.26,12.3 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:14.2,15.27 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:15.27,17.3 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:18.2,21.37 3 3 +github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:21.37,23.61 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:23.61,25.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:26.3,26.42 1 8 github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:26.42,28.73 2 11 github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:28.73,30.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:31.4,31.73 1 11 github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:31.73,33.5 1 2 github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:34.4,35.41 2 11 github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:35.41,37.5 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:40.2,40.18 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:9.57,10.23 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:10.23,12.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:13.2,15.23 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:15.23,16.39 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:16.39,17.24 1 30 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:17.24,19.5 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:22.2,22.28 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:22.28,24.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:25.2,25.28 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:25.28,26.18 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:26.18,28.4 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:30.2,30.28 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:30.28,32.29 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:32.29,33.23 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:33.23,35.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:37.3,37.21 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:39.2,39.28 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:39.28,40.35 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:40.35,42.21 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:42.21,44.5 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:44.10,44.29 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:44.29,45.19 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:45.19,47.6 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:51.2,51.15 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:3.56,4.39 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:4.39,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:7.2,7.80 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:7.80,9.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity.go:40.2,40.18 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:9.57,10.23 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:10.23,12.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:13.2,15.23 3 12 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:15.23,16.39 1 44 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:16.39,17.24 1 66 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:17.24,19.5 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:22.2,22.28 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:22.28,24.3 1 24 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:25.2,25.28 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:25.28,26.18 1 18 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:26.18,28.4 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:30.2,30.28 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:30.28,32.29 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:32.29,33.23 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:33.23,35.5 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:37.3,37.21 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:39.2,39.28 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:39.28,40.35 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:40.35,42.21 2 12 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:42.21,44.5 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:44.10,44.29 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:44.29,45.19 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:45.19,47.6 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread.go:51.2,51.15 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:3.56,4.39 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:4.39,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:7.2,7.80 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:7.80,9.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:10.2,11.38 2 8 github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:11.38,12.26 1 19 github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:12.26,14.4 1 1 @@ -7465,61 +7438,59 @@ github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Presse github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:19.3,19.48 1 18 github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:19.48,21.4 1 19 github.com/halfrost/LeetCode-Go/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name.go:23.2,23.42 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:3.37,5.22 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:5.22,7.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:8.2,8.15 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:8.15,10.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:11.2,11.17 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:3.37,5.22 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:5.22,7.3 1 30 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:8.2,8.15 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:8.15,10.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:11.2,11.17 1 5 github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:11.17,13.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:14.2,15.12 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:15.12,16.16 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:16.16,17.9 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:19.3,19.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:21.2,22.12 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:22.12,24.19 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:24.19,25.9 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:27.3,27.6 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:29.2,31.12 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:31.12,33.21 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:33.21,34.9 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:36.3,36.6 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:38.2,39.56 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:39.56,43.3 3 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:44.2,44.14 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:44.14,46.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:47.2,47.22 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:9.58,10.23 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:10.23,12.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:13.2,14.28 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:14.28,16.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:17.2,18.23 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:18.23,19.27 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:19.27,20.14 1 73 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:20.14,21.10 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:23.4,23.68 1 45 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:23.68,25.5 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:28.2,28.34 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:28.34,30.3 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:32.2,32.28 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:32.28,33.35 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:33.35,34.46 1 56 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:34.46,36.34 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:36.34,38.6 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:38.11,42.6 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:47.2,47.28 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:47.28,49.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:50.2,50.30 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:50.30,52.18 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:52.18,55.21 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:55.21,57.5 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:58.4,58.42 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:58.42,60.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:61.4,61.19 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:61.19,64.5 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:67.2,67.17 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:70.28,71.11 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:71.11,73.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:74.2,74.10 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:14.2,15.12 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:15.12,16.16 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:16.16,17.9 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:19.3,19.6 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:21.2,22.12 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:22.12,24.19 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:24.19,25.9 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:27.3,27.6 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:29.2,31.12 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:31.12,33.21 2 20 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:33.21,34.9 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:36.3,36.6 1 16 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:38.2,39.56 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:39.56,43.3 3 4 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:44.2,44.14 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:44.14,46.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts.go:47.2,47.22 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:9.58,10.23 1 9 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:10.23,12.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:13.2,14.28 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:14.28,16.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:17.2,18.23 2 8 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:18.23,19.27 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:19.27,20.14 1 83 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:20.14,21.10 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:23.4,23.68 1 51 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:23.68,25.5 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:28.2,28.34 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:28.34,30.3 1 32 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:32.2,32.28 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:32.28,33.35 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:33.35,34.46 1 60 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:34.46,36.34 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:36.34,38.6 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:38.11,42.6 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:47.2,47.28 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:47.28,49.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:50.2,50.30 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:50.30,52.18 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:52.18,55.21 3 6 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:55.21,57.5 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:58.4,58.19 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:58.19,61.5 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:64.2,64.17 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:67.28,68.11 1 15 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:68.11,70.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go:71.2,71.10 1 12 github.com/halfrost/LeetCode-Go/leetcode/0930.Binary-Subarrays-With-Sum/930. Binary Subarrays With Sum.go:5.46,8.22 3 3 github.com/halfrost/LeetCode-Go/leetcode/0930.Binary-Subarrays-With-Sum/930. Binary Subarrays With Sum.go:8.22,10.13 2 20 github.com/halfrost/LeetCode-Go/leetcode/0930.Binary-Subarrays-With-Sum/930. Binary Subarrays With Sum.go:10.13,13.4 1 16 @@ -7528,9 +7499,7 @@ github.com/halfrost/LeetCode-Go/leetcode/0930.Binary-Subarrays-With-Sum/930. Bin github.com/halfrost/LeetCode-Go/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go:9.37,13.2 1 1 github.com/halfrost/LeetCode-Go/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go:15.44,17.56 2 4 github.com/halfrost/LeetCode-Go/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go:17.56,17.89 1 8 -github.com/halfrost/LeetCode-Go/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go:18.2,18.15 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go:18.15,20.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go:21.2,21.31 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go:18.2,18.31 1 4 github.com/halfrost/LeetCode-Go/leetcode/0938.Range-Sum-of-BST/938. Range Sum of BST.go:19.57,23.2 3 2 github.com/halfrost/LeetCode-Go/leetcode/0938.Range-Sum-of-BST/938. Range Sum of BST.go:25.56,26.17 1 32 github.com/halfrost/LeetCode-Go/leetcode/0938.Range-Sum-of-BST/938. Range Sum of BST.go:26.17,28.3 1 17 @@ -7570,17 +7539,17 @@ github.com/halfrost/LeetCode-Go/leetcode/0949.Largest-Time-for-Given-Digits/949. github.com/halfrost/LeetCode-Go/leetcode/0949.Largest-Time-for-Given-Digits/949. Largest Time for Given Digits.go:28.2,28.10 1 2 github.com/halfrost/LeetCode-Go/leetcode/0949.Largest-Time-for-Given-Digits/949. Largest Time for Given Digits.go:28.10,30.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0949.Largest-Time-for-Given-Digits/949. Largest Time for Given Digits.go:30.8,32.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:8.40,10.22 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:10.22,12.3 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:13.2,14.22 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:14.22,15.29 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:8.40,10.22 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:10.22,12.3 1 27 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:13.2,14.22 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:14.22,15.29 1 27 github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:15.29,16.16 1 45 github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:16.16,19.5 2 21 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:22.2,22.22 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:22.22,25.3 2 25 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:26.2,26.12 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:30.41,33.22 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:33.22,34.29 1 25 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:22.2,22.22 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:22.22,25.3 2 27 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:26.2,26.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:30.41,33.22 3 5 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:33.22,34.29 1 27 github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:34.29,35.16 1 45 github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:35.16,36.35 1 21 github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:36.35,38.6 1 5 @@ -7588,15 +7557,15 @@ github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-F github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:41.5,41.37 1 21 github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:41.37,43.6 1 8 github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:43.11,45.6 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:48.3,48.33 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:48.33,50.4 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:50.9,52.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:54.2,54.27 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:57.28,58.11 1 50 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:48.3,48.33 1 27 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:48.33,50.4 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:50.9,52.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:54.2,54.27 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:57.28,58.11 1 54 github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:58.11,60.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:61.2,61.10 1 45 -github.com/halfrost/LeetCode-Go/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary.go:3.55,4.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary.go:4.20,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor.go:61.2,61.10 1 49 +github.com/halfrost/LeetCode-Go/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary.go:3.55,4.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary.go:4.20,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary.go:7.2,8.34 2 3 github.com/halfrost/LeetCode-Go/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary.go:8.34,10.3 1 78 github.com/halfrost/LeetCode-Go/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary.go:11.2,11.36 1 3 @@ -7631,11 +7600,11 @@ github.com/halfrost/LeetCode-Go/leetcode/0959.Regions-Cut-By-Slashes/959. Region github.com/halfrost/LeetCode-Go/leetcode/0959.Regions-Cut-By-Slashes/959. Regions Cut By Slashes.go:35.22,37.4 1 15 github.com/halfrost/LeetCode-Go/leetcode/0959.Regions-Cut-By-Slashes/959. Regions Cut By Slashes.go:39.2,39.14 1 5 github.com/halfrost/LeetCode-Go/leetcode/0959.Regions-Cut-By-Slashes/959. Regions Cut By Slashes.go:42.40,44.2 1 132 -github.com/halfrost/LeetCode-Go/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array.go:3.34,5.24 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array.go:5.24,6.27 1 10 +github.com/halfrost/LeetCode-Go/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array.go:3.34,5.24 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array.go:5.24,6.27 1 14 github.com/halfrost/LeetCode-Go/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array.go:6.27,8.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array.go:9.3,9.23 1 7 -github.com/halfrost/LeetCode-Go/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array.go:11.2,11.10 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array.go:9.3,9.23 1 11 +github.com/halfrost/LeetCode-Go/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array.go:11.2,11.10 1 1 github.com/halfrost/LeetCode-Go/leetcode/0966.Vowel-Spellchecker/966. Vowel Spellchecker.go:5.65,7.32 2 1 github.com/halfrost/LeetCode-Go/leetcode/0966.Vowel-Spellchecker/966. Vowel Spellchecker.go:7.32,10.38 3 4 github.com/halfrost/LeetCode-Go/leetcode/0966.Vowel-Spellchecker/966. Vowel Spellchecker.go:10.38,12.4 1 2 @@ -7654,16 +7623,16 @@ github.com/halfrost/LeetCode-Go/leetcode/0966.Vowel-Spellchecker/966. Vowel Spel github.com/halfrost/LeetCode-Go/leetcode/0966.Vowel-Spellchecker/966. Vowel Spellchecker.go:47.26,48.63 1 36 github.com/halfrost/LeetCode-Go/leetcode/0966.Vowel-Spellchecker/966. Vowel Spellchecker.go:48.63,50.4 1 18 github.com/halfrost/LeetCode-Go/leetcode/0966.Vowel-Spellchecker/966. Vowel Spellchecker.go:52.2,52.22 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:27.41,29.45 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:29.45,31.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:32.2,32.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:35.57,36.17 1 20 -github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:36.17,38.3 1 11 -github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:39.2,40.39 2 9 +github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:27.41,29.45 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:29.45,31.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:32.2,32.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:35.57,36.17 1 23 +github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:36.17,38.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:39.2,40.39 2 10 github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:40.39,43.3 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:43.8,43.58 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:43.8,43.58 1 7 github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:43.58,45.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:45.8,47.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras.go:45.8,47.3 1 5 github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:3.33,4.17 1 3 github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:4.17,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:7.2,11.16 3 2 @@ -7673,24 +7642,24 @@ github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorti github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:21.2,21.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:24.39,25.12 1 6 github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:25.12,29.3 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:32.34,33.27 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:33.27,34.15 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:32.34,33.27 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:33.27,34.15 1 11 github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:34.15,36.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:38.2,38.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:5.54,6.22 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:6.22,7.16 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:7.16,9.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:10.3,10.18 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:12.2,12.11 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:12.11,14.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:15.2,16.20 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:16.20,18.49 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:18.49,20.17 2 14 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:20.17,24.5 3 13 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:26.3,26.13 1 9 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:26.13,27.9 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:30.2,30.15 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:33.24,35.2 1 74 +github.com/halfrost/LeetCode-Go/leetcode/0969.Pancake-Sorting/969. Pancake Sorting.go:38.2,38.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:5.54,6.22 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:6.22,7.16 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:7.16,9.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:10.3,10.18 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:12.2,12.11 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:12.11,14.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:15.2,16.20 2 3 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:16.20,18.49 2 13 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:18.49,20.17 2 20 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:20.17,24.5 3 19 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:26.3,26.13 1 13 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:26.13,27.9 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:30.2,30.15 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0970.Powerful-Integers/970. Powerful Integers.go:33.24,35.2 1 106 github.com/halfrost/LeetCode-Go/leetcode/0971.Flip-Binary-Tree-To-Match-Preorder-Traversal/971. Flip Binary Tree To Match Preorder Traversal.go:19.58,21.44 2 3 github.com/halfrost/LeetCode-Go/leetcode/0971.Flip-Binary-Tree-To-Match-Preorder-Traversal/971. Flip Binary Tree To Match Preorder Traversal.go:21.44,23.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0971.Flip-Binary-Tree-To-Match-Preorder-Traversal/971. Flip Binary Tree To Match Preorder Traversal.go:24.2,24.18 1 1 @@ -7727,30 +7696,30 @@ github.com/halfrost/LeetCode-Go/leetcode/0977.Squares-of-a-Sorted-Array/977. Squ github.com/halfrost/LeetCode-Go/leetcode/0977.Squares-of-a-Sorted-Array/977. Squares of a Sorted Array.go:21.36,22.26 1 3 github.com/halfrost/LeetCode-Go/leetcode/0977.Squares-of-a-Sorted-Array/977. Squares of a Sorted Array.go:22.26,24.3 1 11 github.com/halfrost/LeetCode-Go/leetcode/0977.Squares-of-a-Sorted-Array/977. Squares of a Sorted Array.go:25.2,26.10 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:4.39,7.32 3 5 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:7.32,8.24 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:8.24,11.4 2 9 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:11.9,11.31 1 12 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:11.31,14.4 2 7 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:14.9,17.4 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:18.3,18.38 1 21 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:20.2,20.15 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:23.28,24.11 1 59 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:24.11,26.3 1 22 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:27.2,27.10 1 37 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:30.28,31.11 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:31.11,33.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:34.2,34.10 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:38.40,40.39 2 5 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:40.39,42.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:42.8,44.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:45.2,46.44 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:4.39,7.32 3 14 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:7.32,8.24 1 44 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:8.24,11.4 2 18 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:11.9,11.31 1 26 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:11.31,14.4 2 16 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:14.9,17.4 2 10 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:18.3,18.38 1 44 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:20.2,20.15 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:23.28,24.11 1 105 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:24.11,26.3 1 38 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:27.2,27.10 1 67 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:30.28,31.11 1 14 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:31.11,33.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:34.2,34.10 1 12 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:38.40,40.39 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:40.39,42.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:42.8,44.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:45.2,46.44 2 7 github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:46.44,47.33 1 17 github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:47.33,49.4 1 4 github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:49.9,49.72 1 13 github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:49.72,51.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:52.3,52.43 1 17 -github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:54.2,54.18 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray.go:54.2,54.18 1 7 github.com/halfrost/LeetCode-Go/leetcode/0979.Distribute-Coins-in-Binary-Tree/979. Distribute Coins in Binary Tree.go:19.42,23.2 3 5 github.com/halfrost/LeetCode-Go/leetcode/0979.Distribute-Coins-in-Binary-Tree/979. Distribute Coins in Binary Tree.go:25.55,26.17 1 37 github.com/halfrost/LeetCode-Go/leetcode/0979.Distribute-Coins-in-Binary-Tree/979. Distribute Coins in Binary Tree.go:26.17,28.3 1 21 @@ -7785,24 +7754,24 @@ github.com/halfrost/LeetCode-Go/leetcode/0981.Time-Based-Key-Value-Store/981. Ti github.com/halfrost/LeetCode-Go/leetcode/0981.Time-Based-Key-Value-Store/981. Time Based Key-Value Store.go:31.56,33.44 2 4 github.com/halfrost/LeetCode-Go/leetcode/0981.Time-Based-Key-Value-Store/981. Time Based Key-Value Store.go:33.44,35.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0981.Time-Based-Key-Value-Store/981. Time Based Key-Value Store.go:36.2,37.24 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:3.42,5.11 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:3.42,5.11 2 5 github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:5.11,8.3 2 1 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:9.2,10.22 2 2 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:10.22,12.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:12.8,12.28 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:9.2,10.22 2 5 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:10.22,12.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:12.8,12.28 1 4 github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:12.28,13.28 1 2 github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:13.28,15.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:16.3,16.24 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:17.8,17.25 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:17.25,18.26 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:18.26,21.4 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:22.3,22.26 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:22.26,24.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:25.8,26.28 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:26.28,30.4 3 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:31.3,31.26 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:31.26,33.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:35.2,35.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:17.8,17.25 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:17.25,18.26 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:18.26,21.4 2 2 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:22.3,22.26 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:22.26,24.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:25.8,26.28 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:26.28,30.4 3 1 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:31.3,31.26 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:31.26,33.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB.go:35.2,35.12 1 5 github.com/halfrost/LeetCode-Go/leetcode/0985.Sum-of-Even-Numbers-After-Queries/985. Sum of Even Numbers After Queries.go:3.58,5.22 2 1 github.com/halfrost/LeetCode-Go/leetcode/0985.Sum-of-Even-Numbers-After-Queries/985. Sum of Even Numbers After Queries.go:5.22,6.15 1 4 github.com/halfrost/LeetCode-Go/leetcode/0985.Sum-of-Even-Numbers-After-Queries/985. Sum of Even Numbers After Queries.go:6.15,8.4 1 2 @@ -7846,8 +7815,8 @@ github.com/halfrost/LeetCode-Go/leetcode/0989.Add-to-Array-Form-of-Integer/989. github.com/halfrost/LeetCode-Go/leetcode/0989.Add-to-Array-Form-of-Integer/989. Add to Array-Form of Integer.go:17.2,18.12 2 4 github.com/halfrost/LeetCode-Go/leetcode/0989.Add-to-Array-Form-of-Integer/989. Add to Array-Form of Integer.go:21.23,22.38 1 4 github.com/halfrost/LeetCode-Go/leetcode/0989.Add-to-Array-Form-of-Integer/989. Add to Array-Form of Integer.go:22.38,24.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations.go:7.49,8.25 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations.go:8.25,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations.go:7.49,8.25 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations.go:8.25,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations.go:11.2,13.32 3 5 github.com/halfrost/LeetCode-Go/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations.go:13.32,14.37 1 13 github.com/halfrost/LeetCode-Go/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations.go:14.37,16.4 1 10 @@ -7871,41 +7840,41 @@ github.com/halfrost/LeetCode-Go/leetcode/0992.Subarrays-with-K-Different-Integer github.com/halfrost/LeetCode-Go/leetcode/0992.Subarrays-with-K-Different-Integers/992. Subarrays with K Different Integers.go:19.4,19.10 1 32 github.com/halfrost/LeetCode-Go/leetcode/0992.Subarrays-with-K-Different-Integers/992. Subarrays with K Different Integers.go:21.3,21.26 1 52 github.com/halfrost/LeetCode-Go/leetcode/0992.Subarrays-with-K-Different-Integers/992. Subarrays with K Different Integers.go:23.2,23.12 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:20.51,21.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:21.17,23.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:24.2,25.22 2 3 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:25.22,27.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:20.51,21.17 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:21.17,23.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:24.2,25.22 2 4 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:25.22,27.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:28.2,28.37 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:31.50,32.17 1 44 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:32.17,34.3 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:35.2,35.19 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:35.19,37.21 2 19 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:37.21,39.4 1 15 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:40.3,40.19 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:42.2,42.14 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:31.50,32.17 1 60 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:32.17,34.3 1 27 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:35.2,35.19 1 33 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:35.19,37.21 2 26 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:37.21,39.4 1 20 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:40.3,40.19 1 6 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:42.2,42.14 1 7 github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:45.53,46.17 1 12 github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:46.17,48.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:49.2,50.88 1 6 github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:50.88,52.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:53.2,53.78 1 5 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:62.54,63.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:63.17,65.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:66.2,70.21 4 3 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:70.21,74.23 4 13 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:74.23,77.4 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:78.3,78.24 1 13 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:78.24,81.4 2 6 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:83.2,83.44 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:83.44,85.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:62.54,63.17 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:63.17,65.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:66.2,70.21 4 4 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:70.21,74.23 4 17 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:74.23,77.4 2 6 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:78.3,78.24 1 17 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:78.24,81.4 2 7 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:83.2,83.44 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:83.44,85.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:86.2,86.80 1 3 github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:86.80,88.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:89.2,89.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:93.54,98.2 4 3 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:100.73,101.17 1 44 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:101.17,103.3 1 19 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:104.2,104.21 1 25 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:104.21,108.3 3 6 -github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:109.2,111.59 3 19 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:93.54,98.2 4 5 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:100.73,101.17 1 62 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:101.17,103.3 1 29 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:104.2,104.21 1 33 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:104.21,108.3 3 7 +github.com/halfrost/LeetCode-Go/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree.go:109.2,111.59 3 26 github.com/halfrost/LeetCode-Go/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips.go:3.39,5.30 2 3 github.com/halfrost/LeetCode-Go/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips.go:5.30,6.28 1 14 github.com/halfrost/LeetCode-Go/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips.go:6.28,8.4 1 3 @@ -7914,29 +7883,24 @@ github.com/halfrost/LeetCode-Go/leetcode/0995.Minimum-Number-of-K-Consecutive-Bi github.com/halfrost/LeetCode-Go/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips.go:13.20,15.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips.go:16.4,18.11 3 5 github.com/halfrost/LeetCode-Go/leetcode/0995.Minimum-Number-of-K-Consecutive-Bit-Flips/995. Minimum Number of K Consecutive Bit Flips.go:21.2,21.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:8.37,9.17 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:9.17,11.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:8.37,9.17 1 5 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:9.17,11.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:12.2,15.17 4 4 github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:18.89,19.24 1 28 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:19.24,21.33 2 4 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:21.33,22.35 1 6 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:22.35,24.10 2 0 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:27.3,27.21 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:27.21,31.4 3 4 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:32.3,32.9 1 4 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:34.2,34.33 1 24 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:34.33,35.18 1 166 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:35.18,36.54 1 141 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:36.54,37.13 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:39.4,39.55 1 138 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:39.55,40.13 1 114 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:42.4,46.22 5 24 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:49.2,49.8 1 24 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:52.32,54.30 2 128 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:54.30,56.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:57.2,57.14 1 114 -github.com/halfrost/LeetCode-Go/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge.go:3.42,4.31 1 3 -github.com/halfrost/LeetCode-Go/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge.go:4.31,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:19.24,25.3 4 4 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:26.2,26.33 1 24 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:26.33,27.18 1 166 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:27.18,28.54 1 141 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:28.54,29.13 1 3 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:31.4,31.55 1 138 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:31.55,32.13 1 114 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:34.4,38.22 5 24 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:41.2,41.8 1 24 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:44.32,46.30 2 122 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:46.30,48.3 1 8 +github.com/halfrost/LeetCode-Go/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go:49.2,49.14 1 114 +github.com/halfrost/LeetCode-Go/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge.go:3.42,4.31 1 4 +github.com/halfrost/LeetCode-Go/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge.go:4.31,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge.go:7.2,8.26 2 3 github.com/halfrost/LeetCode-Go/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge.go:8.26,10.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge.go:11.2,11.26 1 3 @@ -7970,15 +7934,15 @@ github.com/halfrost/LeetCode-Go/leetcode/1002.Find-Common-Characters/1002. Find github.com/halfrost/LeetCode-Go/leetcode/1002.Find-Common-Characters/1002. Find Common Characters.go:27.26,28.31 1 52 github.com/halfrost/LeetCode-Go/leetcode/1002.Find-Common-Characters/1002. Find Common Characters.go:28.31,30.4 1 5 github.com/halfrost/LeetCode-Go/leetcode/1002.Find-Common-Characters/1002. Find Common Characters.go:32.2,32.15 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:3.33,4.16 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:4.16,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:7.2,8.30 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:8.30,9.18 1 23 +github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:3.33,4.16 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:4.16,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:7.2,8.30 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:8.30,9.18 1 24 github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:9.18,11.4 1 7 -github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:11.9,11.25 1 16 -github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:11.25,12.52 1 7 +github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:11.9,11.25 1 17 +github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:11.25,12.52 1 8 github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:12.52,14.5 1 7 -github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:14.10,16.5 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:14.10,16.5 1 1 github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:17.9,18.82 1 9 github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:18.82,20.5 1 7 github.com/halfrost/LeetCode-Go/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions.go:20.10,22.5 1 2 @@ -8021,11 +7985,11 @@ github.com/halfrost/LeetCode-Go/leetcode/1010.Pairs-of-Songs-With-Total-Duration github.com/halfrost/LeetCode-Go/leetcode/1010.Pairs-of-Songs-With-Total-Durations-Divisible-by-60/1010. Pairs of Songs With Total Durations Divisible by 60.go:9.2,10.37 2 2 github.com/halfrost/LeetCode-Go/leetcode/1010.Pairs-of-Songs-With-Total-Durations-Divisible-by-60/1010. Pairs of Songs With Total Durations Divisible by 60.go:10.37,12.3 1 58 github.com/halfrost/LeetCode-Go/leetcode/1010.Pairs-of-Songs-With-Total-Durations-Divisible-by-60/1010. Pairs of Songs With Total Durations Divisible by 60.go:13.2,15.12 3 2 -github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:3.47,5.30 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:5.30,7.19 2 26 -github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:7.19,9.4 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:11.2,11.12 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:11.12,13.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:3.47,5.30 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:5.30,7.19 2 31 +github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:7.19,9.4 1 20 +github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:11.2,11.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:11.12,13.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:14.2,15.17 2 4 github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:15.17,17.30 2 16 github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:17.30,19.4 1 11 @@ -8036,8 +8000,8 @@ github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:30.16,34.19 3 36 github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:34.19,36.5 1 5 github.com/halfrost/LeetCode-Go/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days.go:39.2,39.13 1 11 -github.com/halfrost/LeetCode-Go/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2.go:5.29,6.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2.go:6.12,8.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2.go:5.29,6.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2.go:6.12,8.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2.go:9.2,10.13 2 3 github.com/halfrost/LeetCode-Go/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2.go:10.13,13.20 3 9 github.com/halfrost/LeetCode-Go/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2.go:13.20,16.4 2 2 @@ -8086,13 +8050,13 @@ github.com/halfrost/LeetCode-Go/leetcode/1021.Remove-Outermost-Parentheses/1021. github.com/halfrost/LeetCode-Go/leetcode/1021.Remove-Outermost-Parentheses/1021. Remove Outermost Parentheses.go:40.13,41.5 1 9 github.com/halfrost/LeetCode-Go/leetcode/1021.Remove-Outermost-Parentheses/1021. Remove Outermost Parentheses.go:41.5,44.6 2 9 github.com/halfrost/LeetCode-Go/leetcode/1021.Remove-Outermost-Parentheses/1021. Remove Outermost Parentheses.go:48.2,48.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:16.40,18.42 2 2 -github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:18.42,19.18 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:19.18,21.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:22.3,24.44 2 8 -github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:24.44,26.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:27.3,27.52 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:29.2,29.21 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:16.40,18.42 2 3 +github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:18.42,19.18 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:19.18,21.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:22.3,24.44 2 10 +github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:24.44,26.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:27.3,27.52 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers.go:29.2,29.21 1 3 github.com/halfrost/LeetCode-Go/leetcode/1025.Divisor-Game/1025. Divisor Game.go:3.30,5.2 1 2 github.com/halfrost/LeetCode-Go/leetcode/1026.Maximum-Difference-Between-Node-and-Ancestor/1026. Maximum Difference Between Node and Ancestor.go:18.42,22.2 3 4 github.com/halfrost/LeetCode-Go/leetcode/1026.Maximum-Difference-Between-Node-and-Ancestor/1026. Maximum Difference Between Node and Ancestor.go:24.59,25.17 1 44 @@ -8111,8 +8075,8 @@ github.com/halfrost/LeetCode-Go/leetcode/1026.Maximum-Difference-Between-Node-an github.com/halfrost/LeetCode-Go/leetcode/1026.Maximum-Difference-Between-Node-and-Ancestor/1026. Maximum Difference Between Node and Ancestor.go:56.21,57.11 1 40 github.com/halfrost/LeetCode-Go/leetcode/1026.Maximum-Difference-Between-Node-and-Ancestor/1026. Maximum Difference Between Node and Ancestor.go:57.11,59.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/1026.Maximum-Difference-Between-Node-and-Ancestor/1026. Maximum Difference Between Node and Ancestor.go:60.2,60.11 1 32 -github.com/halfrost/LeetCode-Go/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal.go:21.46,22.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal.go:22.17,24.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal.go:21.46,22.17 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal.go:22.17,24.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal.go:25.2,28.19 4 3 github.com/halfrost/LeetCode-Go/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal.go:31.87,32.22 1 47 github.com/halfrost/LeetCode-Go/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal.go:32.22,34.3 1 19 @@ -8170,8 +8134,8 @@ github.com/halfrost/LeetCode-Go/leetcode/1038.Binary-Search-Tree-to-Greater-Sum- github.com/halfrost/LeetCode-Go/leetcode/1038.Binary-Search-Tree-to-Greater-Sum-Tree/1038. Binary Search Tree to Greater Sum Tree.go:28.40,29.17 1 56 github.com/halfrost/LeetCode-Go/leetcode/1038.Binary-Search-Tree-to-Greater-Sum-Tree/1038. Binary Search Tree to Greater Sum Tree.go:29.17,31.3 1 31 github.com/halfrost/LeetCode-Go/leetcode/1038.Binary-Search-Tree-to-Greater-Sum-Tree/1038. Binary Search Tree to Greater Sum Tree.go:32.2,35.25 4 25 -github.com/halfrost/LeetCode-Go/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II.go:8.43,9.22 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II.go:9.22,11.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II.go:8.43,9.22 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II.go:9.22,11.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II.go:12.2,15.15 4 4 github.com/halfrost/LeetCode-Go/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II.go:15.15,16.52 1 32 github.com/halfrost/LeetCode-Go/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II.go:16.52,18.4 1 21 @@ -8259,15 +8223,15 @@ github.com/halfrost/LeetCode-Go/leetcode/1052.Grumpy-Bookstore-Owner/1052. Grump github.com/halfrost/LeetCode-Go/leetcode/1052.Grumpy-Bookstore-Owner/1052. Grumpy Bookstore Owner.go:52.22,54.5 1 16 github.com/halfrost/LeetCode-Go/leetcode/1052.Grumpy-Bookstore-Owner/1052. Grumpy Bookstore Owner.go:55.9,57.4 1 23 github.com/halfrost/LeetCode-Go/leetcode/1052.Grumpy-Bookstore-Owner/1052. Grumpy Bookstore Owner.go:59.2,59.12 1 9 -github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:5.46,7.19 2 2 -github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:7.19,9.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:5.46,7.19 2 3 +github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:7.19,9.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:10.2,12.39 3 2 github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:12.39,14.19 2 7 github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:14.19,16.4 1 7 github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:17.3,17.6 1 7 github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:19.2,19.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:22.43,23.17 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:23.17,25.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:22.43,23.17 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:23.17,25.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:26.2,28.22 3 2 github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:28.22,30.3 1 14 github.com/halfrost/LeetCode-Go/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes.go:31.2,31.31 1 2 @@ -8290,8 +8254,8 @@ github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073 github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:19.15,21.4 1 5 github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:23.2,23.17 1 1 github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:27.51,29.2 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:31.37,32.19 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:32.19,34.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:31.37,32.19 1 13 +github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:32.19,34.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:35.2,36.34 2 12 github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:36.34,37.15 1 2007 github.com/halfrost/LeetCode-Go/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers.go:37.15,39.4 1 7 @@ -8333,8 +8297,8 @@ github.com/halfrost/LeetCode-Go/leetcode/1074.Number-of-Submatrices-That-Sum-to- github.com/halfrost/LeetCode-Go/leetcode/1074.Number-of-Submatrices-That-Sum-to-Target/1074. Number of Submatrices That Sum to Target.go:68.34,69.35 1 72 github.com/halfrost/LeetCode-Go/leetcode/1074.Number-of-Submatrices-That-Sum-to-Target/1074. Number of Submatrices That Sum to Target.go:69.35,71.4 1 116 github.com/halfrost/LeetCode-Go/leetcode/1074.Number-of-Submatrices-That-Sum-to-Target/1074. Number of Submatrices That Sum to Target.go:73.2,73.12 1 45 -github.com/halfrost/LeetCode-Go/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram.go:5.72,8.20 3 2 -github.com/halfrost/LeetCode-Go/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram.go:8.20,10.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram.go:5.72,8.20 3 3 +github.com/halfrost/LeetCode-Go/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram.go:8.20,10.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram.go:11.2,11.34 1 2 github.com/halfrost/LeetCode-Go/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram.go:11.34,12.50 1 12 github.com/halfrost/LeetCode-Go/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram.go:12.50,14.4 1 4 @@ -8364,21 +8328,21 @@ github.com/halfrost/LeetCode-Go/leetcode/1079.Letter-Tile-Possibilities/1079. Le github.com/halfrost/LeetCode-Go/leetcode/1089.Duplicate-Zeros/1089. Duplicate Zeros.go:3.32,4.32 1 3 github.com/halfrost/LeetCode-Go/leetcode/1089.Duplicate-Zeros/1089. Duplicate Zeros.go:4.32,5.36 1 665 github.com/halfrost/LeetCode-Go/leetcode/1089.Duplicate-Zeros/1089. Duplicate Zeros.go:5.36,8.4 2 345 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:14.49,16.35 2 2 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:16.35,18.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:19.2,20.35 2 2 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:20.35,22.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:23.2,23.21 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:23.21,25.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:26.2,26.41 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:26.41,28.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:30.2,32.21 3 2 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:32.21,36.26 4 5 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:36.26,39.90 3 39 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:39.90,43.56 4 5 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:14.49,16.35 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:16.35,18.3 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:19.2,20.35 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:20.35,22.3 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:23.2,23.21 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:23.21,25.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:26.2,26.41 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:26.41,28.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:30.2,32.21 3 3 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:32.21,36.26 4 9 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:36.26,39.90 3 71 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:39.90,43.56 4 8 github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:43.56,45.6 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:49.2,49.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:52.46,54.2 1 39 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:49.2,49.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix.go:52.46,54.2 1 71 github.com/halfrost/LeetCode-Go/leetcode/1093.Statistics-from-a-Large-Sample/1093. Statistics from a Large Sample.go:3.41,7.28 4 2 github.com/halfrost/LeetCode-Go/leetcode/1093.Statistics-from-a-Large-Sample/1093. Statistics from a Large Sample.go:7.28,9.3 1 512 github.com/halfrost/LeetCode-Go/leetcode/1093.Statistics-from-a-Large-Sample/1093. Statistics from a Large Sample.go:10.2,11.20 2 2 @@ -8417,22 +8381,22 @@ github.com/halfrost/LeetCode-Go/leetcode/1105.Filling-Bookcase-Shelves/1105. Fil github.com/halfrost/LeetCode-Go/leetcode/1105.Filling-Bookcase-Shelves/1105. Filling Bookcase Shelves.go:26.11,28.3 1 5 github.com/halfrost/LeetCode-Go/leetcode/1105.Filling-Bookcase-Shelves/1105. Filling Bookcase Shelves.go:29.2,29.10 1 5 github.com/halfrost/LeetCode-Go/leetcode/1108.Defanging-an-IP-Address/1108. Defanging an IP Address.go:5.42,7.2 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:18.59,19.17 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:19.17,21.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:22.2,23.29 2 1 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:23.29,25.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:26.2,27.12 2 1 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:30.90,31.17 1 15 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:31.17,33.3 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:34.2,34.32 1 7 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:34.32,36.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:37.2,38.21 2 7 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:38.21,40.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:41.2,41.48 1 7 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:41.48,43.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:44.2,44.49 1 7 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:18.59,19.17 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:19.17,21.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:22.2,23.29 2 2 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:23.29,25.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:26.2,27.12 2 2 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:30.90,31.17 1 24 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:31.17,33.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:34.2,34.32 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:34.32,36.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:37.2,38.21 2 11 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:38.21,40.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:41.2,41.48 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:41.48,43.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:44.2,44.49 1 11 github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:44.49,46.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:47.2,47.15 1 7 +github.com/halfrost/LeetCode-Go/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest.go:47.2,47.15 1 11 github.com/halfrost/LeetCode-Go/leetcode/1111.Maximum-Nesting-Depth-of-Two-Valid-Parentheses-Strings/1111. Maximum Nesting Depth of Two Valid Parentheses Strings.go:4.43,6.24 2 2 github.com/halfrost/LeetCode-Go/leetcode/1111.Maximum-Nesting-Depth-of-Two-Valid-Parentheses-Strings/1111. Maximum Nesting Depth of Two Valid Parentheses Strings.go:6.24,7.15 1 14 github.com/halfrost/LeetCode-Go/leetcode/1111.Maximum-Nesting-Depth-of-Two-Valid-Parentheses-Strings/1111. Maximum Nesting Depth of Two Valid Parentheses Strings.go:7.15,10.4 2 7 @@ -8485,23 +8449,23 @@ github.com/halfrost/LeetCode-Go/leetcode/1123.Lowest-Common-Ancestor-of-Deepest- github.com/halfrost/LeetCode-Go/leetcode/1123.Lowest-Common-Ancestor-of-Deepest-Leaves/1123. Lowest Common Ancestor of Deepest Leaves.go:41.28,42.11 1 62 github.com/halfrost/LeetCode-Go/leetcode/1123.Lowest-Common-Ancestor-of-Deepest-Leaves/1123. Lowest Common Ancestor of Deepest Leaves.go:42.11,44.3 1 17 github.com/halfrost/LeetCode-Go/leetcode/1123.Lowest-Common-Ancestor-of-Deepest-Leaves/1123. Lowest Common Ancestor of Deepest Leaves.go:45.2,45.10 1 45 -github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:3.48,4.43 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:4.43,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:7.2,8.35 2 1 -github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:8.35,10.31 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:10.31,11.31 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:3.48,4.43 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:4.43,6.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:7.2,8.35 2 2 +github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:8.35,10.31 2 9 +github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:10.31,11.31 1 7 github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:11.31,13.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:15.3,15.23 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:15.23,18.4 2 0 -github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:18.9,20.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:22.2,22.15 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:15.3,15.23 1 9 +github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:15.23,18.4 2 2 +github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:18.9,20.4 1 7 +github.com/halfrost/LeetCode-Go/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs.go:22.2,22.15 1 2 github.com/halfrost/LeetCode-Go/leetcode/1137.N-th-Tribonacci-Number/1137. N-th Tribonacci Number.go:3.28,4.11 1 5 github.com/halfrost/LeetCode-Go/leetcode/1137.N-th-Tribonacci-Number/1137. N-th Tribonacci Number.go:4.11,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1137.N-th-Tribonacci-Number/1137. N-th Tribonacci Number.go:7.2,8.12 2 4 github.com/halfrost/LeetCode-Go/leetcode/1137.N-th-Tribonacci-Number/1137. N-th Tribonacci Number.go:8.12,11.3 2 26 github.com/halfrost/LeetCode-Go/leetcode/1137.N-th-Tribonacci-Number/1137. N-th Tribonacci Number.go:12.2,12.13 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence.go:3.63,4.40 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence.go:4.40,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence.go:3.63,4.40 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence.go:4.40,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence.go:7.2,8.20 2 3 github.com/halfrost/LeetCode-Go/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence.go:8.20,10.3 1 14 github.com/halfrost/LeetCode-Go/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence.go:11.2,11.36 1 3 @@ -8520,29 +8484,29 @@ github.com/halfrost/LeetCode-Go/leetcode/1145.Binary-Tree-Coloring-Game/1145. Bi github.com/halfrost/LeetCode-Go/leetcode/1145.Binary-Tree-Coloring-Game/1145. Binary Tree Coloring Game.go:32.19,34.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1145.Binary-Tree-Coloring-Game/1145. Binary Tree Coloring Game.go:35.2,35.18 1 11 github.com/halfrost/LeetCode-Go/leetcode/1154.Day-of-the-Year/1154. Day of the Year.go:5.33,11.2 5 4 -github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:21.49,24.48 2 1 +github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:21.49,24.48 2 2 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:24.48,25.33 1 7 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:25.33,27.4 1 4 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:28.3,28.24 1 3 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:28.24,30.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:31.3,31.71 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:33.2,33.32 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:33.2,33.32 1 2 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:33.32,35.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:36.2,36.32 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:36.2,36.32 1 2 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:36.32,37.34 1 6 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:37.34,39.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:40.3,40.43 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:42.2,43.18 2 1 +github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:42.2,43.18 2 2 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:43.18,45.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:46.2,46.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:46.2,46.11 1 2 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:49.73,50.19 1 11 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:50.19,53.3 2 6 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:54.2,58.101 5 5 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:61.53,63.2 1 17 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:65.54,67.2 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:70.63,71.22 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:70.63,71.22 1 5 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:71.22,73.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:74.2,74.46 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:74.2,74.46 1 2 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:77.103,79.46 2 12 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:79.46,81.3 1 5 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:82.2,82.30 1 7 @@ -8550,8 +8514,8 @@ github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarra github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:84.8,84.39 1 6 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:84.39,86.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:88.2,89.85 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:93.74,95.43 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:95.43,97.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:93.74,95.43 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:95.43,97.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:98.2,98.70 1 3 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:98.70,98.115 1 7 github.com/halfrost/LeetCode-Go/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray.go:99.2,99.68 1 3 @@ -8580,7 +8544,7 @@ github.com/halfrost/LeetCode-Go/leetcode/1170.Compare-Strings-by-Frequency-of-th github.com/halfrost/LeetCode-Go/leetcode/1170.Compare-Strings-by-Frequency-of-the-Smallest-Character/1170. Compare Strings by Frequency of the Smallest Character.go:23.2,23.20 1 8 github.com/halfrost/LeetCode-Go/leetcode/1170.Compare-Strings-by-Frequency-of-the-Smallest-Character/1170. Compare Strings by Frequency of the Smallest Character.go:23.20,25.3 1 4 github.com/halfrost/LeetCode-Go/leetcode/1170.Compare-Strings-by-Frequency-of-the-Smallest-Character/1170. Compare Strings by Frequency of the Smallest Character.go:26.2,26.17 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:19.54,24.17 3 4 +github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:19.54,24.17 3 5 github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:24.17,26.33 2 17 github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:26.33,29.18 1 5 github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:29.18,32.23 3 3 @@ -8589,9 +8553,9 @@ github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes- github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:39.10,43.5 3 2 github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:44.9,46.4 1 12 github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:47.3,47.17 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:49.2,49.13 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:53.55,54.17 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:54.17,56.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:49.2,49.13 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:53.55,54.17 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:54.17,56.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:57.2,58.15 2 4 github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:58.15,59.16 1 8 github.com/halfrost/LeetCode-Go/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List.go:59.16,62.38 3 22 @@ -8632,12 +8596,12 @@ github.com/halfrost/LeetCode-Go/leetcode/1184.Distance-Between-Bus-Stops/1184. D github.com/halfrost/LeetCode-Go/leetcode/1184.Distance-Between-Bus-Stops/1184. Distance Between Bus Stops.go:11.40,13.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/1184.Distance-Between-Bus-Stops/1184. Distance Between Bus Stops.go:14.2,14.28 1 1 github.com/halfrost/LeetCode-Go/leetcode/1185.Day-of-the-Week/1185. Day of the Week.go:5.56,7.2 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:3.43,5.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:5.25,7.3 1 33 -github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:13.2,13.74 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:16.28,17.11 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:17.11,19.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:20.2,20.10 1 12 +github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:3.43,5.25 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:5.25,7.3 1 42 +github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:13.2,13.74 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:16.28,17.11 1 16 +github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:17.11,19.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons.go:20.2,20.10 1 15 github.com/halfrost/LeetCode-Go/leetcode/1190.Reverse-Substrings-Between-Each-Pair-of-Parentheses/1190. Reverse Substrings Between Each Pair of Parentheses.go:3.42,5.22 2 4 github.com/halfrost/LeetCode-Go/leetcode/1190.Reverse-Substrings-Between-Each-Pair-of-Parentheses/1190. Reverse Substrings Between Each Pair of Parentheses.go:5.22,6.15 1 51 github.com/halfrost/LeetCode-Go/leetcode/1190.Reverse-Substrings-Between-Each-Pair-of-Parentheses/1190. Reverse Substrings Between Each Pair of Parentheses.go:6.15,8.4 1 8 @@ -8795,39 +8759,39 @@ github.com/halfrost/LeetCode-Go/leetcode/1234.Replace-the-Substring-for-Balanced github.com/halfrost/LeetCode-Go/leetcode/1234.Replace-the-Substring-for-Balanced-String/1234. Replace the Substring for Balanced String.go:26.28,27.11 1 16 github.com/halfrost/LeetCode-Go/leetcode/1234.Replace-the-Substring-for-Balanced-String/1234. Replace the Substring for Balanced String.go:27.11,29.3 1 7 github.com/halfrost/LeetCode-Go/leetcode/1234.Replace-the-Substring-for-Balanced-String/1234. Replace the Substring for Balanced String.go:30.2,30.10 1 9 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:11.70,13.38 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:13.38,15.3 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:16.2,18.33 3 3 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:18.33,20.18 2 9 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:20.18,22.48 2 8 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:11.70,13.38 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:13.38,15.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:16.2,18.33 3 4 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:18.33,20.18 2 11 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:20.18,22.48 2 9 github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:22.48,24.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:24.10,26.5 1 7 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:28.3,28.45 1 9 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:24.10,26.5 1 8 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:28.3,28.45 1 11 github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:28.45,30.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:30.9,32.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:34.2,34.29 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:37.28,38.11 1 9 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:30.9,32.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:34.2,34.29 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:37.28,38.11 1 11 github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:38.11,40.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:41.2,41.10 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:46.29,48.2 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:49.39,50.34 1 11 -github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:50.34,52.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:41.2,41.10 1 8 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:46.29,48.2 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:49.39,50.34 1 13 +github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:50.34,52.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:53.2,53.36 1 11 github.com/halfrost/LeetCode-Go/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling.go:55.34,57.2 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:7.34,9.24 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:9.24,11.23 2 8 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:11.23,13.4 1 42 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:14.3,14.39 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:14.39,15.12 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:7.34,9.24 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:9.24,11.23 2 10 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:11.23,13.4 1 46 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:14.3,14.39 1 10 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:14.39,15.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:17.3,17.22 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:19.2,20.12 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:23.56,25.34 2 17 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:19.2,20.12 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:23.56,25.34 2 18 github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:25.34,26.21 1 21 github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:26.21,28.4 1 14 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:30.2,30.8 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:33.24,34.11 1 17 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:30.2,30.8 1 18 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:33.24,34.11 1 18 github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:34.11,36.3 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:37.2,37.10 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters.go:37.2,37.10 1 12 github.com/halfrost/LeetCode-Go/leetcode/1249.Minimum-Remove-to-Make-Valid-Parentheses/1249. Minimum Remove to Make Valid Parentheses.go:3.44,5.30 2 4 github.com/halfrost/LeetCode-Go/leetcode/1249.Minimum-Remove-to-Make-Valid-Parentheses/1249. Minimum Remove to Make Valid Parentheses.go:5.30,6.18 1 33 github.com/halfrost/LeetCode-Go/leetcode/1249.Minimum-Remove-to-Make-Valid-Parentheses/1249. Minimum Remove to Make Valid Parentheses.go:6.18,8.4 1 8 @@ -8859,10 +8823,10 @@ github.com/halfrost/LeetCode-Go/leetcode/1252.Cells-with-Odd-Values-in-a-Matrix/ github.com/halfrost/LeetCode-Go/leetcode/1252.Cells-with-Odd-Values-in-a-Matrix/1252. Cells with Odd Values in a Matrix.go:35.26,36.32 1 10 github.com/halfrost/LeetCode-Go/leetcode/1252.Cells-with-Odd-Values-in-a-Matrix/1252. Cells with Odd Values in a Matrix.go:36.32,38.5 1 6 github.com/halfrost/LeetCode-Go/leetcode/1252.Cells-with-Odd-Values-in-a-Matrix/1252. Cells with Odd Values in a Matrix.go:41.2,41.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:10.37,12.12 2 5 -github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:12.12,14.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:15.2,16.12 2 5 -github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:16.12,18.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:10.37,12.12 2 7 +github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:12.12,14.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:15.2,16.12 2 6 +github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:16.12,18.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:19.2,20.25 2 5 github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:20.25,22.3 1 23 github.com/halfrost/LeetCode-Go/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands.go:23.2,23.25 1 5 @@ -8900,25 +8864,25 @@ github.com/halfrost/LeetCode-Go/leetcode/1268.Search-Suggestions-System/1268. Se github.com/halfrost/LeetCode-Go/leetcode/1268.Search-Suggestions-System/1268. Search Suggestions System.go:15.24,17.4 1 3 github.com/halfrost/LeetCode-Go/leetcode/1268.Search-Suggestions-System/1268. Search Suggestions System.go:17.9,19.4 1 19 github.com/halfrost/LeetCode-Go/leetcode/1268.Search-Suggestions-System/1268. Search Suggestions System.go:21.2,21.15 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:3.38,5.34 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:5.34,6.15 1 22 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:6.15,8.4 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:8.9,10.4 1 10 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:12.2,12.25 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:12.25,13.69 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:13.69,15.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:16.3,16.69 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:16.69,18.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:19.3,19.69 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:19.69,21.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:22.3,22.69 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:22.69,24.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:26.2,26.68 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:3.38,5.34 2 10 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:5.34,6.15 1 55 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:6.15,8.4 1 30 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:8.9,10.4 1 25 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:12.2,12.25 1 10 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:12.25,13.69 1 24 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:13.69,15.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:16.3,16.69 1 23 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:16.69,18.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:19.3,19.69 1 22 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:19.69,21.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:22.3,22.69 1 21 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:22.69,24.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:26.2,26.68 1 6 github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:26.68,28.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:29.2,29.68 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:29.68,31.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:32.2,32.68 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:32.68,34.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:29.2,29.68 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:29.68,31.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:32.2,32.68 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:32.68,34.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:35.2,35.68 1 3 github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:35.68,37.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game.go:38.2,38.20 1 2 @@ -8939,10 +8903,10 @@ github.com/halfrost/LeetCode-Go/leetcode/1283.Find-the-Smallest-Divisor-Given-a- github.com/halfrost/LeetCode-Go/leetcode/1283.Find-the-Smallest-Divisor-Given-a-Threshold/1283. Find the Smallest Divisor Given a Threshold.go:25.2,25.22 1 60 github.com/halfrost/LeetCode-Go/leetcode/1283.Find-the-Smallest-Divisor-Given-a-Threshold/1283. Find the Smallest Divisor Given a Threshold.go:25.22,27.3 1 56 github.com/halfrost/LeetCode-Go/leetcode/1283.Find-the-Smallest-Divisor-Given-a-Threshold/1283. Find the Smallest Divisor Given a Threshold.go:28.2,28.14 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array.go:3.40,5.29 2 1 -github.com/halfrost/LeetCode-Go/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array.go:5.29,6.27 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array.go:3.40,5.29 2 2 +github.com/halfrost/LeetCode-Go/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array.go:5.29,6.27 1 8 github.com/halfrost/LeetCode-Go/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array.go:6.27,8.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array.go:10.2,10.11 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array.go:10.2,10.11 1 1 github.com/halfrost/LeetCode-Go/leetcode/1290.Convert-Binary-Number-in-a-Linked-List-to-Integer/1290. Convert Binary Number in a Linked List to Integer.go:17.42,19.18 2 5 github.com/halfrost/LeetCode-Go/leetcode/1290.Convert-Binary-Number-in-a-Linked-List-to-Integer/1290. Convert Binary Number in a Linked List to Integer.go:19.18,22.3 2 22 github.com/halfrost/LeetCode-Go/leetcode/1290.Convert-Binary-Number-in-a-Linked-List-to-Integer/1290. Convert Binary Number in a Linked List to Integer.go:23.2,23.12 1 5 @@ -8955,19 +8919,15 @@ github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obsta github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:30.21,32.16 2 17 github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:32.16,36.34 4 49 github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:36.34,39.35 3 192 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:39.35,40.28 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:40.28,41.29 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:41.29,43.8 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:43.13,44.16 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:47.6,47.26 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:49.5,49.36 1 189 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:49.36,50.31 1 135 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:50.31,51.76 1 53 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:51.76,54.8 2 16 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:55.12,56.72 1 82 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:56.72,59.8 2 38 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:66.2,66.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:69.46,71.2 1 189 +github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:39.35,41.6 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:42.5,42.36 1 189 +github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:42.36,43.31 1 135 +github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:43.31,44.76 1 53 +github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:44.76,47.8 2 16 +github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:48.12,49.72 1 82 +github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:49.72,52.8 2 38 +github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:59.2,59.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go:62.46,64.2 1 189 github.com/halfrost/LeetCode-Go/leetcode/1295.Find-Numbers-with-Even-Number-of-Digits/1295. Find Numbers with Even Number of Digits.go:5.34,7.25 2 2 github.com/halfrost/LeetCode-Go/leetcode/1295.Find-Numbers-with-Even-Number-of-Digits/1295. Find Numbers with Even Number of Digits.go:7.25,9.3 1 9 github.com/halfrost/LeetCode-Go/leetcode/1295.Find-Numbers-with-Even-Number-of-Digits/1295. Find Numbers with Even Number of Digits.go:10.2,10.12 1 2 @@ -9152,14 +9112,14 @@ github.com/halfrost/LeetCode-Go/leetcode/1396.Design-Underground-System/1396. De github.com/halfrost/LeetCode-Go/leetcode/1396.Design-Underground-System/1396. Design Underground System.go:35.15,38.3 2 3 github.com/halfrost/LeetCode-Go/leetcode/1396.Design-Underground-System/1396. Design Underground System.go:39.2,41.24 3 7 github.com/halfrost/LeetCode-Go/leetcode/1396.Design-Underground-System/1396. Design Underground System.go:44.92,47.2 2 7 -github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:3.44,5.46 2 5 -github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:5.46,7.3 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:8.2,9.48 2 5 -github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:9.48,11.19 2 16 -github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:11.19,13.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:15.2,16.32 2 5 -github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:16.32,18.3 1 28 -github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:19.2,19.23 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:3.44,5.46 2 6 +github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:5.46,7.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:8.2,9.48 2 6 +github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:9.48,11.19 2 18 +github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:11.19,13.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:15.2,16.32 2 6 +github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:16.32,18.3 1 33 +github.com/halfrost/LeetCode-Go/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards.go:19.2,19.23 1 6 github.com/halfrost/LeetCode-Go/leetcode/1437.Check-If-All-1s-Are-at-Least-Length-K-Places-Away/1437. Check If All 1s Are at Least Length K Places Away.go:3.43,5.27 2 4 github.com/halfrost/LeetCode-Go/leetcode/1437.Check-If-All-1s-Are-at-Least-Length-K-Places-Away/1437. Check If All 1s Are at Least Length K Places Away.go:5.27,6.15 1 23 github.com/halfrost/LeetCode-Go/leetcode/1437.Check-If-All-1s-Are-at-Least-Length-K-Places-Away/1437. Check If All 1s Are at Least Length K Places Away.go:6.15,7.44 1 13 @@ -9180,15 +9140,15 @@ github.com/halfrost/LeetCode-Go/leetcode/1438.Longest-Continuous-Subarray-With-A github.com/halfrost/LeetCode-Go/leetcode/1438.Longest-Continuous-Subarray-With-Absolute-Diff-Less-Than-or-Equal-to-Limit/1438. Longest Continuous Subarray With Absolute Diff Less Than or Equal to Limit.go:23.3,23.25 1 18 github.com/halfrost/LeetCode-Go/leetcode/1438.Longest-Continuous-Subarray-With-Absolute-Diff-Less-Than-or-Equal-to-Limit/1438. Longest Continuous Subarray With Absolute Diff Less Than or Equal to Limit.go:23.25,25.4 1 9 github.com/halfrost/LeetCode-Go/leetcode/1438.Longest-Continuous-Subarray-With-Absolute-Diff-Less-Than-or-Equal-to-Limit/1438. Longest Continuous Subarray With Absolute Diff Less Than or Equal to Limit.go:27.2,27.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:5.42,6.49 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:6.49,8.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:9.2,10.32 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:10.32,12.3 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:13.2,13.19 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:13.19,15.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:5.42,6.49 1 8 +github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:6.49,8.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:9.2,10.32 2 6 +github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:10.32,12.3 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:13.2,13.20 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:13.20,15.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:16.2,16.18 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:19.60,21.21 2 5 -github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:21.21,23.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:19.60,21.21 2 6 +github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:21.21,23.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:24.2,25.43 2 5 github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:25.43,31.3 1 19 github.com/halfrost/LeetCode-Go/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go:32.2,32.19 1 5 @@ -9213,15 +9173,15 @@ github.com/halfrost/LeetCode-Go/leetcode/1442.Count-Triplets-That-Can-Form-Two-A github.com/halfrost/LeetCode-Go/leetcode/1442.Count-Triplets-That-Can-Form-Two-Arrays-of-Equal-XOR/1442. Count Triplets That Can Form Two Arrays of Equal XOR.go:15.4,15.18 1 67 github.com/halfrost/LeetCode-Go/leetcode/1442.Count-Triplets-That-Can-Form-Two-Arrays-of-Equal-XOR/1442. Count Triplets That Can Form Two Arrays of Equal XOR.go:15.18,17.5 1 13 github.com/halfrost/LeetCode-Go/leetcode/1442.Count-Triplets-That-Can-Form-Two-Arrays-of-Equal-XOR/1442. Count Triplets That Can Form Two Arrays of Equal XOR.go:20.2,20.14 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:3.29,5.30 2 5 -github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:5.30,6.18 1 61 -github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:6.18,8.4 1 27 -github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:8.9,9.17 1 34 -github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:9.17,11.5 1 9 -github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:12.4,13.11 2 34 -github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:16.2,16.15 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:16.15,18.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:19.2,19.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:3.29,5.30 2 6 +github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:5.30,6.18 1 65 +github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:6.18,8.4 1 30 +github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:8.9,9.17 1 35 +github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:9.17,11.5 1 10 +github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:12.4,13.11 2 35 +github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:16.2,16.15 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:16.15,18.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters.go:19.2,19.12 1 6 github.com/halfrost/LeetCode-Go/leetcode/1455.Check-If-a-Word-Occurs-As-a-Prefix-of-Any-Word-in-a-Sentence/1455. Check If a Word Occurs As a Prefix of Any Word in a Sentence.go:5.61,6.49 1 5 github.com/halfrost/LeetCode-Go/leetcode/1455.Check-If-a-Word-Occurs-As-a-Prefix-of-Any-Word-in-a-Sentence/1455. Check If a Word Occurs As a Prefix of Any Word in a Sentence.go:6.49,7.39 1 18 github.com/halfrost/LeetCode-Go/leetcode/1455.Check-If-a-Word-Occurs-As-a-Prefix-of-Any-Word-in-a-Sentence/1455. Check If a Word Occurs As a Prefix of Any Word in a Sentence.go:7.39,9.4 1 3 @@ -9262,17 +9222,17 @@ github.com/halfrost/LeetCode-Go/leetcode/1464.Maximum-Product-of-Two-Elements-in github.com/halfrost/LeetCode-Go/leetcode/1464.Maximum-Product-of-Two-Elements-in-an-Array/1464. Maximum Product of Two Elements in an Array.go:9.9,9.40 1 2 github.com/halfrost/LeetCode-Go/leetcode/1464.Maximum-Product-of-Two-Elements-in-an-Array/1464. Maximum Product of Two Elements in an Array.go:9.40,11.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/1464.Maximum-Product-of-Two-Elements-in-an-Array/1464. Maximum Product of Two Elements in an Array.go:13.2,13.32 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:5.74,9.39 4 3 -github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:9.39,10.33 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:5.74,9.39 4 4 +github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:9.39,10.33 1 4 github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:10.33,12.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:14.2,14.52 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:14.52,16.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:17.2,17.37 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:14.2,14.52 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:14.52,16.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:17.2,17.37 1 4 github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:17.37,18.31 1 1 github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:18.31,20.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:22.2,22.48 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:22.48,24.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:25.2,25.37 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:22.2,22.48 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:22.48,24.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts.go:25.2,25.37 1 4 github.com/halfrost/LeetCode-Go/leetcode/1470.Shuffle-the-Array/1470. Shuffle the Array.go:3.39,5.25 2 3 github.com/halfrost/LeetCode-Go/leetcode/1470.Shuffle-the-Array/1470. Shuffle the Array.go:5.25,8.3 2 9 github.com/halfrost/LeetCode-Go/leetcode/1470.Shuffle-the-Array/1470. Shuffle the Array.go:9.2,9.15 1 3 @@ -9367,59 +9327,59 @@ github.com/halfrost/LeetCode-Go/leetcode/1600.Throne-Inheritance/1600. Throne In github.com/halfrost/LeetCode-Go/leetcode/1600.Throne-Inheritance/1600. Throne Inheritance.go:27.3,27.43 1 14 github.com/halfrost/LeetCode-Go/leetcode/1600.Throne-Inheritance/1600. Throne Inheritance.go:27.43,29.4 1 12 github.com/halfrost/LeetCode-Go/leetcode/1600.Throne-Inheritance/1600. Throne Inheritance.go:31.2,32.8 2 2 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:9.64,15.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:17.53,18.17 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:9.64,15.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:17.53,18.17 1 8 github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:19.9,20.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:20.3,21.20 1 2 github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:21.20,24.5 2 1 github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:25.4,25.16 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:27.9,28.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:28.3,29.23 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:27.9,28.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:28.3,29.23 1 2 github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:29.23,32.5 2 1 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:33.4,33.16 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:35.9,36.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:36.3,37.22 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:37.22,40.5 2 0 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:41.4,41.16 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:44.2,44.14 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X.go:5.35,8.27 3 4 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:33.4,33.16 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:35.9,36.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:36.3,37.22 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:37.22,40.5 2 1 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:41.4,41.16 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1603.Design-Parking-System/1603. Design Parking System.go:44.2,44.14 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X.go:5.35,8.27 3 5 github.com/halfrost/LeetCode-Go/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X.go:8.27,9.15 1 8 github.com/halfrost/LeetCode-Go/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X.go:9.15,11.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X.go:12.3,13.15 2 6 github.com/halfrost/LeetCode-Go/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X.go:13.15,15.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X.go:17.2,17.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:9.41,12.22 3 5 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:12.22,15.31 3 15 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:15.31,17.24 2 36 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:17.24,19.5 1 19 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:20.4,20.25 1 36 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:20.25,22.5 1 15 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:23.4,23.33 1 36 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:25.3,25.19 1 15 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:25.19,26.19 1 9 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:26.19,28.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:29.9,30.18 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:30.18,32.5 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:34.3,35.10 2 13 +github.com/halfrost/LeetCode-Go/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X.go:17.2,17.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:9.41,12.22 3 9 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:12.22,15.31 3 23 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:15.31,17.24 2 48 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:17.24,19.5 1 24 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:20.4,20.25 1 48 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:20.25,22.5 1 18 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:23.4,23.33 1 48 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:25.3,25.19 1 23 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:25.19,26.19 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:26.19,28.5 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:29.9,30.18 1 9 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:30.18,32.5 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:34.3,35.10 2 17 github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:37.2,37.13 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:40.27,42.16 2 6 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:40.27,42.16 2 9 github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:42.16,44.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:45.2,45.31 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:45.31,46.17 1 13 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:46.17,48.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:49.3,49.17 1 13 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:49.17,51.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:52.3,52.12 1 13 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:54.2,54.13 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:57.28,59.16 2 9 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:59.16,61.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:62.2,62.31 1 9 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:62.31,63.17 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:45.2,45.31 1 8 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:45.31,46.17 1 16 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:46.17,48.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:49.3,49.17 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:49.17,51.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:52.3,52.12 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:54.2,54.13 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:57.28,59.16 2 14 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:59.16,61.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:62.2,62.31 1 13 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:62.31,63.17 1 7 github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:63.17,65.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:66.3,66.17 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:66.17,68.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:66.3,66.17 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:66.17,68.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:69.3,69.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:71.2,71.13 1 8 +github.com/halfrost/LeetCode-Go/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree.go:71.2,71.13 1 11 github.com/halfrost/LeetCode-Go/leetcode/1614.Maximum-Nesting-Depth-of-the-Parentheses/1614. Maximum Nesting Depth of the Parentheses.go:3.29,5.22 2 4 github.com/halfrost/LeetCode-Go/leetcode/1614.Maximum-Nesting-Depth-of-the-Parentheses/1614. Maximum Nesting Depth of the Parentheses.go:5.22,6.15 1 50 github.com/halfrost/LeetCode-Go/leetcode/1614.Maximum-Nesting-Depth-of-the-Parentheses/1614. Maximum Nesting Depth of the Parentheses.go:6.15,9.4 2 12 @@ -9443,18 +9403,18 @@ github.com/halfrost/LeetCode-Go/leetcode/1629.Slowest-Key/1629. Slowest Key.go:7 github.com/halfrost/LeetCode-Go/leetcode/1629.Slowest-Key/1629. Slowest Key.go:10.9,10.65 1 4 github.com/halfrost/LeetCode-Go/leetcode/1629.Slowest-Key/1629. Slowest Key.go:10.65,12.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/1629.Slowest-Key/1629. Slowest Key.go:14.2,14.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:17.45,20.25 3 3 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:20.25,22.3 1 11 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:23.2,24.17 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:24.17,26.50 2 60 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:17.45,20.25 3 4 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:20.25,22.3 1 12 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:23.2,24.17 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:24.17,26.50 2 80 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:26.50,28.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:28.9,30.4 1 58 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:31.3,31.26 1 60 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:31.26,32.30 1 220 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:32.30,34.5 1 860 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:37.2,37.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:40.75,42.26 2 386 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:42.26,44.3 1 58 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:28.9,30.4 1 78 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:31.3,31.26 1 80 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:31.26,32.30 1 240 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:32.30,34.5 1 880 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:37.2,37.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:40.75,42.26 2 406 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:42.26,44.3 1 78 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:45.2,47.24 3 328 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:47.24,49.71 2 1312 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:49.71,50.12 1 965 @@ -9464,24 +9424,24 @@ github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Pat github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:60.21,61.11 1 411 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:61.11,63.3 1 172 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:64.2,64.10 1 411 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:67.24,68.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:67.24,68.11 1 2 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:68.11,70.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:71.2,71.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:74.24,75.11 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:71.2,71.10 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:74.24,75.11 1 2 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:75.11,77.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:78.2,78.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:82.46,85.30 3 3 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:85.30,86.25 1 11 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:86.25,88.13 2 43 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:78.2,78.10 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:82.46,85.30 3 4 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:85.30,86.25 1 12 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:86.25,88.13 2 44 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:88.13,90.5 1 32 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:91.4,91.13 1 43 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:91.4,91.13 1 44 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:91.13,93.5 1 32 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:96.2,96.40 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:96.2,96.40 1 4 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:96.40,96.80 1 180 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:97.2,97.26 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:97.2,97.26 1 4 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:97.26,99.35 2 33 github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:99.35,101.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:103.2,103.10 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort.go:103.2,103.10 1 1 github.com/halfrost/LeetCode-Go/leetcode/1636.Sort-Array-by-Increasing-Frequency/1636. Sort Array by Increasing Frequency.go:5.38,7.25 2 3 github.com/halfrost/LeetCode-Go/leetcode/1636.Sort-Array-by-Increasing-Frequency/1636. Sort Array by Increasing Frequency.go:7.25,9.3 1 20 github.com/halfrost/LeetCode-Go/leetcode/1636.Sort-Array-by-Increasing-Frequency/1636. Sort Array by Increasing Frequency.go:10.2,10.39 1 3 @@ -9511,11 +9471,11 @@ github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/16 github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:22.4,22.40 1 10 github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:22.40,24.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:27.2,27.25 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:32.45,32.63 1 7 -github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:33.45,33.69 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:34.45,34.76 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:35.45,35.75 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:36.43,40.2 3 0 +github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:32.45,32.63 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:33.45,33.69 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:34.45,34.76 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:35.45,35.75 1 7 +github.com/halfrost/LeetCode-Go/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach.go:36.43,40.2 3 1 github.com/halfrost/LeetCode-Go/leetcode/1646.Get-Maximum-in-Generated-Array/1646. Get Maximum in Generated Array.go:3.37,4.12 1 5 github.com/halfrost/LeetCode-Go/leetcode/1646.Get-Maximum-in-Generated-Array/1646. Get Maximum in Generated Array.go:4.12,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1646.Get-Maximum-in-Generated-Array/1646. Get Maximum in Generated Array.go:7.2,9.26 3 4 @@ -9541,45 +9501,45 @@ github.com/halfrost/LeetCode-Go/leetcode/1647.Minimum-Deletions-to-Make-Characte github.com/halfrost/LeetCode-Go/leetcode/1647.Minimum-Deletions-to-Make-Character-Frequencies-Unique/1647. Minimum Deletions to Make Character Frequencies Unique.go:13.27,14.58 1 132 github.com/halfrost/LeetCode-Go/leetcode/1647.Minimum-Deletions-to-Make-Character-Frequencies-Unique/1647. Minimum Deletions to Make Character Frequencies Unique.go:14.58,19.4 4 7 github.com/halfrost/LeetCode-Go/leetcode/1647.Minimum-Deletions-to-Make-Character-Frequencies-Unique/1647. Minimum Deletions to Make Character Frequencies Unique.go:21.2,21.12 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:10.48,13.33 3 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:13.33,18.3 4 19 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:19.2,19.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:23.49,24.28 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:24.28,26.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:27.2,30.39 3 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:30.39,32.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:33.2,33.41 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:33.41,38.3 4 19 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:39.2,39.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:42.73,44.41 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:44.41,46.3 1 19 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:47.2,47.28 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:47.28,49.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:50.2,51.32 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:51.32,53.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:54.2,54.27 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:54.27,56.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:57.2,57.37 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:60.28,61.11 1 38 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:61.11,63.3 1 22 -github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:64.2,64.10 1 16 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:3.39,4.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:10.48,13.33 3 8 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:13.33,18.3 4 38 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:19.2,19.12 1 8 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:23.49,24.28 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:24.28,26.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:27.2,30.30 3 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:30.30,32.3 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:33.2,35.41 3 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:35.41,40.3 4 19 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:41.2,41.12 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:44.73,46.41 2 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:46.41,48.3 1 19 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:49.2,49.28 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:49.28,51.3 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:52.2,53.32 2 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:53.32,55.3 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:56.2,56.27 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:56.27,58.3 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:59.2,59.37 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:62.28,63.11 1 57 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:63.11,65.3 1 33 +github.com/halfrost/LeetCode-Go/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go:66.2,66.10 1 24 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:3.39,4.12 1 4 github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:4.12,5.34 1 1 github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:5.34,7.4 1 4 github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:8.3,8.14 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:10.2,11.11 2 2 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:11.11,12.34 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:12.34,13.39 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:13.39,14.19 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:14.19,15.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:17.5,18.12 2 6 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:20.4,20.17 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:20.17,21.36 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:21.36,22.20 1 9 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:22.20,23.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:25.6,26.13 2 6 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:29.4,30.21 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:33.2,33.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:10.2,11.11 2 3 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:11.11,12.34 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:12.34,13.39 1 9 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:13.39,14.19 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:14.19,15.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:17.5,18.12 2 13 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:20.4,20.17 1 9 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:20.17,21.36 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:21.36,22.20 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:22.20,23.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:25.6,26.13 2 9 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:29.4,30.21 2 9 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:33.2,33.11 1 3 github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:33.11,34.34 1 1 github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:34.34,35.32 1 4 github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:35.32,36.19 1 6 @@ -9591,7 +9551,7 @@ github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the B github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:44.20,45.12 1 2 github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:47.6,48.13 2 3 github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:51.4,52.21 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:55.2,55.12 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb.go:55.2,55.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/1653.Minimum-Deletions-to-Make-String-Balanced/1653. Minimum Deletions to Make String Balanced.go:4.37,6.22 2 4 github.com/halfrost/LeetCode-Go/leetcode/1653.Minimum-Deletions-to-Make-String-Balanced/1653. Minimum Deletions to Make String Balanced.go:6.22,7.15 1 84 github.com/halfrost/LeetCode-Go/leetcode/1653.Minimum-Deletions-to-Make-String-Balanced/1653. Minimum Deletions to Make String Balanced.go:7.15,10.4 2 38 @@ -9627,9 +9587,9 @@ github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655 github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:11.49,12.24 1 11 github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:12.24,14.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:15.2,16.22 2 8 -github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:16.22,17.23 1 18 -github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:17.23,18.12 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:20.3,21.29 2 12 +github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:16.22,17.23 1 16 +github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:17.23,18.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:20.3,21.29 2 11 github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:21.29,23.31 2 6 github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:23.31,25.5 1 5 github.com/halfrost/LeetCode-Go/leetcode/1655.Distribute-Repeating-Integers/1655. Distribute Repeating Integers.go:26.4,26.26 1 1 @@ -9657,12 +9617,12 @@ github.com/halfrost/LeetCode-Go/leetcode/1657.Determine-if-Two-Strings-Are-Close github.com/halfrost/LeetCode-Go/leetcode/1657.Determine-if-Two-Strings-Are-Close/1657. Determine if Two Strings Are Close.go:27.26,28.37 1 76 github.com/halfrost/LeetCode-Go/leetcode/1657.Determine-if-Two-Strings-Are-Close/1657. Determine if Two Strings Are Close.go:28.37,30.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/1657.Determine-if-Two-Strings-Are-Close/1657. Determine if Two Strings Are Close.go:32.2,32.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:3.43,5.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:5.25,7.3 1 16 -github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:8.2,9.16 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:9.16,11.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:12.2,12.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:12.17,14.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:3.43,5.25 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:5.25,7.3 1 21 +github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:8.2,9.16 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:9.16,11.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:12.2,12.17 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:12.17,14.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:15.2,16.24 2 3 github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:16.24,17.19 1 16 github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:17.19,20.4 2 16 @@ -9676,47 +9636,47 @@ github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to- github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:35.24,36.11 1 3 github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:36.11,38.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero.go:39.2,39.10 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:7.86,16.27 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:16.27,18.3 1 2187 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:19.2,19.27 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:19.27,21.26 2 2187 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:21.26,23.27 2 13122 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:23.27,25.5 1 91854 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:29.2,29.57 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:29.57,31.26 2 39 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:31.26,34.4 2 102 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:35.3,36.26 2 39 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:36.26,37.42 1 102 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:37.42,39.43 1 68 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:39.43,42.6 2 34 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:42.11,42.50 1 34 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:42.50,45.6 2 34 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:47.5,47.17 1 68 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:47.17,49.6 1 42 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:54.2,54.61 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:54.61,55.62 1 39 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:55.62,57.27 2 819 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:57.27,59.5 1 2358 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:62.2,62.141 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:66.31,67.22 1 2400 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:67.22,69.3 1 1324 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:71.2,71.22 1 1076 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:71.22,73.3 1 269 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:74.2,74.22 1 807 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:74.22,76.3 1 269 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:77.2,77.12 1 538 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:81.196,83.54 1 187 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:83.54,85.3 1 153 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:87.2,87.69 1 34 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:87.69,89.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:90.2,91.53 2 34 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:91.53,92.111 1 540 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:92.111,93.12 1 356 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:95.3,96.228 2 184 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:98.2,99.13 2 34 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:102.28,103.11 1 184 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:103.11,105.3 1 68 -github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:106.2,106.10 1 116 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:7.86,16.27 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:16.27,18.3 1 2916 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:19.2,19.27 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:19.27,21.26 2 2916 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:21.26,23.27 2 17496 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:23.27,25.5 1 122472 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:29.2,29.57 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:29.57,31.26 2 282 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:31.26,34.4 2 1317 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:35.3,36.26 2 282 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:36.26,37.42 1 1317 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:37.42,39.43 1 878 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:39.43,42.6 2 439 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:42.11,42.50 1 439 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:42.50,45.6 2 439 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:47.5,47.17 1 878 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:47.17,49.6 1 690 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:54.2,54.61 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:54.61,55.62 1 282 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:55.62,57.27 2 59868 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:57.27,59.5 1 297603 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:62.2,62.141 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:66.31,67.22 1 298293 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:67.22,69.3 1 165565 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:71.2,71.22 1 132728 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:71.22,73.3 1 33182 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:74.2,74.22 1 99546 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:74.22,76.3 1 33182 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:77.2,77.12 1 66364 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:81.196,83.54 1 2179099 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:83.54,85.3 1 818079 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:87.2,87.69 1 1361020 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:87.69,89.3 1 1343113 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:90.2,91.53 2 17907 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:91.53,92.111 1 4343679 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:92.111,93.12 1 2164584 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:95.3,96.228 2 2179095 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:98.2,99.13 2 17907 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:102.28,103.11 1 2179095 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:103.11,105.3 1 1980633 +github.com/halfrost/LeetCode-Go/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness.go:106.2,106.10 1 198462 github.com/halfrost/LeetCode-Go/leetcode/1662.Check-If-Two-String-Arrays-are-Equivalent/1662. Check If Two String Arrays are Equivalent.go:3.64,5.34 2 3 github.com/halfrost/LeetCode-Go/leetcode/1662.Check-If-Two-String-Arrays-are-Equivalent/1662. Check If Two String Arrays are Equivalent.go:5.34,7.3 1 7 github.com/halfrost/LeetCode-Go/leetcode/1662.Check-If-Two-String-Arrays-are-Equivalent/1662. Check If Two String Arrays are Equivalent.go:8.2,8.34 1 3 @@ -9728,21 +9688,19 @@ github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numer github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:9.12,11.20 2 3 github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:11.20,13.4 1 6 github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:15.2,15.20 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:19.46,20.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:20.12,22.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:19.46,20.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:20.12,22.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:23.2,25.12 3 3 github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:28.83,29.38 1 835 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:29.38,31.19 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:31.19,33.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:34.3,34.31 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:34.31,36.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:37.3,37.9 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:39.2,39.73 1 832 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:39.73,41.3 1 180 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:42.2,42.26 1 652 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:42.26,43.50 1 1452 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:43.50,45.4 1 620 -github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:46.3,50.17 5 832 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:29.38,31.33 2 3 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:31.33,33.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:34.3,34.9 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:36.2,36.73 1 832 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:36.73,38.3 1 180 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:39.2,39.26 1 652 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:39.26,40.50 1 1452 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:40.50,42.4 1 620 +github.com/halfrost/LeetCode-Go/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go:43.3,47.17 5 832 github.com/halfrost/LeetCode-Go/leetcode/1664.Ways-to-Make-a-Fair-Array/1664. Ways to Make a Fair Array.go:4.37,6.33 2 4 github.com/halfrost/LeetCode-Go/leetcode/1664.Ways-to-Make-a-Fair-Array/1664. Ways to Make a Fair Array.go:6.33,8.3 1 15 github.com/halfrost/LeetCode-Go/leetcode/1664.Ways-to-Make-a-Fair-Array/1664. Ways to Make a Fair Array.go:9.2,9.33 1 4 @@ -9769,20 +9727,20 @@ github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-T github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:11.17,14.4 2 12 github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:14.9,16.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:18.2,18.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:21.24,22.11 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:22.11,24.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:21.24,22.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:22.11,24.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:25.2,25.10 1 1 github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:31.28,33.2 1 3 github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:35.38,37.14 2 24 github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:37.14,39.3 1 5 github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:40.2,40.32 1 19 github.com/halfrost/LeetCode-Go/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks.go:43.33,47.2 3 22 -github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:7.53,8.50 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:8.50,10.26 2 6 -github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:10.26,12.4 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:13.3,13.38 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:13.38,15.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:17.2,17.10 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:7.53,9.50 2 3 +github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:9.50,11.26 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:11.26,13.4 1 8 +github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:14.3,14.38 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:14.38,16.9 2 2 +github.com/halfrost/LeetCode-Go/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go:19.2,19.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/1669.Merge-In-Between-Linked-Lists/1669. Merge In Between Linked Lists.go:18.79,21.26 3 4 github.com/halfrost/LeetCode-Go/leetcode/1669.Merge-In-Between-Linked-Lists/1669. Merge In Between Linked Lists.go:21.26,22.15 1 19 github.com/halfrost/LeetCode-Go/leetcode/1669.Merge-In-Between-Linked-Lists/1669. Merge In Between Linked Lists.go:22.15,24.4 1 4 @@ -9792,7 +9750,7 @@ github.com/halfrost/LeetCode-Go/leetcode/1669.Merge-In-Between-Linked-Lists/1669 github.com/halfrost/LeetCode-Go/leetcode/1669.Merge-In-Between-Linked-Lists/1669. Merge In Between Linked Lists.go:30.2,32.20 3 4 github.com/halfrost/LeetCode-Go/leetcode/1669.Merge-In-Between-Linked-Lists/1669. Merge In Between Linked Lists.go:32.20,34.3 1 15 github.com/halfrost/LeetCode-Go/leetcode/1669.Merge-In-Between-Linked-Lists/1669. Merge In Between Linked Lists.go:35.2,36.14 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:12.41,14.2 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:12.41,14.2 1 6 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:16.54,18.24 2 10 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:18.24,20.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:20.8,20.64 1 4 @@ -9802,17 +9760,17 @@ github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/167 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:28.8,29.29 1 9 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:29.29,31.4 1 6 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:31.9,33.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:37.53,39.24 2 1 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:39.24,41.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:41.8,41.64 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:41.64,43.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:46.50,47.26 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:37.53,39.24 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:39.24,41.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:41.8,41.64 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:41.64,43.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:46.50,47.26 1 6 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:47.26,49.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:50.2,51.26 2 1 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:51.26,53.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:53.8,53.64 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:53.64,55.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:56.2,56.34 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:50.2,51.26 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:51.26,53.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:53.8,53.64 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:53.64,55.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:56.2,56.34 1 4 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:59.51,60.24 1 10 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:60.24,62.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue.go:63.2,64.28 2 8 @@ -9848,31 +9806,31 @@ github.com/halfrost/LeetCode-Go/leetcode/1674.Minimum-Moves-to-Make-Array-Comple github.com/halfrost/LeetCode-Go/leetcode/1674.Minimum-Moves-to-Make-Array-Complementary/1674. Minimum Moves to Make Array Complementary.go:29.24,30.11 1 6 github.com/halfrost/LeetCode-Go/leetcode/1674.Minimum-Moves-to-Make-Array-Complementary/1674. Minimum Moves to Make Array Complementary.go:30.11,32.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1674.Minimum-Moves-to-Make-Array-Complementary/1674. Minimum Moves to Make Array Complementary.go:33.2,33.10 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:3.39,5.22 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:5.22,6.21 1 12 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:3.39,5.22 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:5.22,6.21 1 15 github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:6.21,8.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:9.3,9.13 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:9.13,12.4 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:12.9,12.27 1 9 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:12.27,14.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:14.9,14.27 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:14.27,16.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:18.2,19.17 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:19.17,21.23 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:21.23,22.62 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:22.62,24.5 1 9 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:25.4,25.14 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:25.14,28.5 2 4 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:28.10,28.29 1 13 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:28.29,30.5 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:30.10,30.29 1 13 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:30.29,32.5 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:34.3,34.22 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:34.22,36.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:37.3,37.24 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:39.2,39.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation.go:3.39,4.19 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation.go:4.19,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:9.3,9.13 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:9.13,12.4 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:12.9,12.27 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:12.27,14.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:14.9,14.27 1 9 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:14.27,16.4 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:18.2,19.17 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:19.17,21.23 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:21.23,22.62 1 20 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:22.62,24.5 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:25.4,25.14 1 20 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:25.14,28.5 2 5 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:28.10,28.29 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:28.29,30.5 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:30.10,30.29 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:30.29,32.5 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:34.3,34.22 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:34.22,36.4 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:37.3,37.24 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array.go:39.2,39.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation.go:3.39,4.19 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation.go:4.19,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation.go:7.2,8.36 2 3 github.com/halfrost/LeetCode-Go/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation.go:8.36,9.24 1 15 github.com/halfrost/LeetCode-Go/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation.go:9.24,11.4 1 4 @@ -9910,22 +9868,20 @@ github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Mini github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:13.26,15.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:17.2,18.24 2 2 github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:18.24,20.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:21.2,24.26 4 2 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:24.26,26.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:27.2,27.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:30.108,31.52 1 50 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:31.52,34.3 2 33 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:35.2,35.17 1 50 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:35.17,37.3 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:38.2,38.31 1 33 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:38.31,39.17 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:39.17,41.4 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:42.3,42.9 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:44.2,44.39 1 30 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:44.39,45.28 1 123 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:45.28,46.12 1 75 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:48.3,54.17 6 48 -github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:54.17,55.9 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:21.2,26.12 4 2 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:29.108,30.52 1 50 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:30.52,33.3 2 33 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:34.2,34.17 1 50 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:34.17,36.3 1 17 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:37.2,37.31 1 33 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:37.31,38.17 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:38.17,40.4 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:41.3,41.9 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:43.2,43.39 1 30 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:43.39,44.28 1 123 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:44.28,45.12 1 75 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:47.3,53.17 6 48 +github.com/halfrost/LeetCode-Go/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go:53.17,54.9 1 15 github.com/halfrost/LeetCode-Go/leetcode/1684.Count-the-Number-of-Consistent-Strings/1684. Count the Number of Consistent Strings.go:3.65,5.30 2 3 github.com/halfrost/LeetCode-Go/leetcode/1684.Count-the-Number-of-Consistent-Strings/1684. Count the Number of Consistent Strings.go:5.30,7.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/1684.Count-the-Number-of-Consistent-Strings/1684. Count the Number of Consistent Strings.go:8.2,8.34 1 3 @@ -9985,25 +9941,25 @@ github.com/halfrost/LeetCode-Go/leetcode/1690.Stone-Game-VII/1690. Stone Game VI github.com/halfrost/LeetCode-Go/leetcode/1690.Stone-Game-VII/1690. Stone Game VII.go:60.24,61.11 1 38 github.com/halfrost/LeetCode-Go/leetcode/1690.Stone-Game-VII/1690. Stone Game VII.go:61.11,63.3 1 12 github.com/halfrost/LeetCode-Go/leetcode/1690.Stone-Game-VII/1690. Stone Game VII.go:64.2,64.10 1 26 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:5.37,7.25 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:7.25,9.3 1 11 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:11.2,11.42 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:11.42,12.37 1 9 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:5.37,7.25 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:7.25,9.3 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:11.2,11.42 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:11.42,12.37 1 12 github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:12.37,14.4 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:15.3,15.37 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:15.37,17.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:18.3,18.39 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:20.2,22.25 3 3 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:22.25,25.3 2 11 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:26.2,26.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:26.25,27.26 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:27.26,28.106 1 19 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:28.106,30.5 1 18 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:32.3,32.24 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:34.2,34.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:37.24,38.11 1 37 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:15.3,15.37 1 8 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:15.37,17.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:18.3,18.39 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:20.2,22.25 3 4 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:22.25,25.3 2 14 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:26.2,26.25 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:26.25,27.26 1 10 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:27.26,28.106 1 22 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:28.106,30.5 1 21 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:32.3,32.24 1 10 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:34.2,34.12 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:37.24,38.11 1 45 github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:38.11,40.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:41.2,41.10 1 35 +github.com/halfrost/LeetCode-Go/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids.go:41.2,41.10 1 43 github.com/halfrost/LeetCode-Go/leetcode/1694.Reformat-Phone-Number/1694. Reformat Phone Number.go:7.43,9.27 2 6 github.com/halfrost/LeetCode-Go/leetcode/1694.Reformat-Phone-Number/1694. Reformat Phone Number.go:9.27,10.27 1 55 github.com/halfrost/LeetCode-Go/leetcode/1694.Reformat-Phone-Number/1694. Reformat Phone Number.go:10.27,12.4 1 40 @@ -10016,8 +9972,8 @@ github.com/halfrost/LeetCode-Go/leetcode/1694.Reformat-Phone-Number/1694. Reform github.com/halfrost/LeetCode-Go/leetcode/1694.Reformat-Phone-Number/1694. Reformat Phone Number.go:30.2,30.33 1 6 github.com/halfrost/LeetCode-Go/leetcode/1694.Reformat-Phone-Number/1694. Reformat Phone Number.go:30.33,35.3 4 8 github.com/halfrost/LeetCode-Go/leetcode/1694.Reformat-Phone-Number/1694. Reformat Phone Number.go:36.2,36.33 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:3.44,4.20 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:4.20,6.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:3.44,4.20 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:4.20,6.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:7.2,8.23 2 2 github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:8.23,9.54 1 28 github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:9.54,12.4 2 14 @@ -10029,27 +9985,27 @@ github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximu github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:25.28,26.11 1 28 github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:26.11,28.3 1 17 github.com/halfrost/LeetCode-Go/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value.go:29.2,29.10 1 11 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:8.39,11.31 3 3 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:11.31,13.3 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:14.2,15.33 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:15.33,17.61 2 17 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:17.61,19.4 1 16 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:20.3,20.43 1 17 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:8.39,11.31 3 4 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:11.31,13.3 1 18 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:14.2,15.33 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:15.33,17.61 2 18 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:17.61,19.4 1 21 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:20.3,20.43 1 18 github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:20.43,22.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:23.3,23.29 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:25.2,25.24 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:29.40,31.19 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:31.19,33.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:34.2,35.31 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:35.31,37.3 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:38.2,38.33 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:38.33,40.29 2 17 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:40.29,42.4 1 34 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:43.3,43.24 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:45.2,45.24 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:48.24,49.11 1 51 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:49.11,51.3 1 14 -github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:52.2,52.10 1 37 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:23.3,23.29 1 18 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:25.2,25.24 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:29.40,31.19 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:31.19,33.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:34.2,35.31 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:35.31,37.3 1 18 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:38.2,38.33 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:38.33,40.29 2 18 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:40.29,42.4 1 35 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:43.3,43.24 1 18 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:45.2,45.24 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:48.24,49.11 1 53 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:49.11,51.3 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1696.Jump-Game-VI/1696. Jump Game VI.go:52.2,52.10 1 38 github.com/halfrost/LeetCode-Go/leetcode/1700.Number-of-Students-Unable-to-Eat-Lunch/1700. Number of Students Unable to Eat Lunch.go:3.58,5.29 2 2 github.com/halfrost/LeetCode-Go/leetcode/1700.Number-of-Students-Unable-to-Eat-Lunch/1700. Number of Students Unable to Eat Lunch.go:5.29,7.3 1 10 github.com/halfrost/LeetCode-Go/leetcode/1700.Number-of-Students-Unable-to-Eat-Lunch/1700. Number of Students Unable to Eat Lunch.go:8.2,8.38 1 2 @@ -10060,29 +10016,29 @@ github.com/halfrost/LeetCode-Go/leetcode/1704.Determine-if-String-Halves-Are-Ali github.com/halfrost/LeetCode-Go/leetcode/1704.Determine-if-String-Halves-Are-Alike/1704. Determine if String Halves Are Alike.go:9.22,10.12 1 34 github.com/halfrost/LeetCode-Go/leetcode/1704.Determine-if-String-Halves-Are-Alike/1704. Determine if String Halves Are Alike.go:11.57,12.9 1 10 github.com/halfrost/LeetCode-Go/leetcode/1704.Determine-if-String-Halves-Are-Alike/1704. Determine if String Halves Are Alike.go:15.2,15.12 1 8 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:5.48,9.29 4 2 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:9.29,10.35 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:5.48,9.29 4 5 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:9.29,10.35 1 15 github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:10.35,12.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:13.3,13.20 1 11 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:13.20,15.4 1 7 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:16.3,16.17 1 11 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:16.17,19.24 3 9 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:19.24,21.5 1 6 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:24.2,24.17 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:24.17,25.35 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:25.35,27.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:28.3,28.18 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:28.18,29.9 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:31.3,34.12 4 3 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:36.2,36.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:39.24,40.11 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:40.11,42.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:43.2,43.10 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:53.33,53.50 1 26 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:54.33,54.63 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:55.33,55.60 1 15 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:57.34,59.2 1 13 -github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:61.32,67.2 5 13 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:13.3,13.20 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:13.20,15.4 1 11 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:16.3,16.17 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:16.17,19.24 3 13 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:19.24,21.5 1 10 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:24.2,24.17 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:24.17,25.35 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:25.35,27.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:28.3,28.18 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:28.18,29.9 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:31.3,34.12 4 5 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:36.2,36.12 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:39.24,40.11 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:40.11,42.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:43.2,43.10 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:53.33,53.50 1 42 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:54.33,54.63 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:55.33,55.60 1 23 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:57.34,59.2 1 21 +github.com/halfrost/LeetCode-Go/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples.go:61.32,67.2 5 21 github.com/halfrost/LeetCode-Go/leetcode/1710.Maximum-Units-on-a-Truck/1710. Maximum Units on a Truck.go:5.56,6.43 1 2 github.com/halfrost/LeetCode-Go/leetcode/1710.Maximum-Units-on-a-Truck/1710. Maximum Units on a Truck.go:6.43,8.3 1 8 github.com/halfrost/LeetCode-Go/leetcode/1710.Maximum-Units-on-a-Truck/1710. Maximum Units on a Truck.go:9.2,10.54 2 2 @@ -10126,21 +10082,21 @@ github.com/halfrost/LeetCode-Go/leetcode/1734.Decode-XORed-Permutation/1734. Dec github.com/halfrost/LeetCode-Go/leetcode/1734.Decode-XORed-Permutation/1734. Decode XORed Permutation.go:11.2,13.28 3 2 github.com/halfrost/LeetCode-Go/leetcode/1734.Decode-XORed-Permutation/1734. Decode XORed Permutation.go:13.28,15.3 1 6 github.com/halfrost/LeetCode-Go/leetcode/1734.Decode-XORed-Permutation/1734. Decode XORed Permutation.go:16.2,16.13 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:3.38,5.21 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:5.21,7.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:8.2,8.21 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:8.21,10.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:11.2,11.21 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:11.21,12.54 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:12.54,14.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:14.9,16.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:18.2,18.21 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:18.21,20.3 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:21.2,21.40 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:21.40,23.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:24.2,24.22 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value.go:6.49,7.45 1 4 -github.com/halfrost/LeetCode-Go/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value.go:7.45,9.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:3.38,5.21 2 6 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:5.21,7.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:8.2,8.21 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:8.21,10.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:11.2,11.21 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:11.21,12.54 1 3 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:12.54,14.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:14.9,16.4 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:18.2,18.21 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:18.21,20.3 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:21.2,21.40 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:21.40,23.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits.go:24.2,24.22 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value.go:6.49,7.45 1 6 +github.com/halfrost/LeetCode-Go/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value.go:7.45,9.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value.go:10.2,11.24 2 4 github.com/halfrost/LeetCode-Go/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value.go:11.24,13.31 2 8 github.com/halfrost/LeetCode-Go/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value.go:13.31,17.4 3 16 @@ -10207,12 +10163,12 @@ github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longe github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:60.48,62.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:65.2,65.12 1 3 github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:68.43,69.19 1 22 -github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:69.19,70.26 1 37 -github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:70.26,71.29 1 22 -github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:71.29,73.5 1 13 -github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:75.3,75.25 1 24 -github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:75.25,76.29 1 15 -github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:76.29,78.5 1 5 +github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:69.19,70.26 1 41 +github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:70.26,71.29 1 28 +github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:71.29,73.5 1 15 +github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:75.3,75.25 1 26 +github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:75.25,76.29 1 13 +github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:76.29,78.5 1 3 github.com/halfrost/LeetCode-Go/leetcode/1763.Longest-Nice-Substring/1763. Longest Nice Substring.go:81.2,81.13 1 4 github.com/halfrost/LeetCode-Go/leetcode/1791.Find-Center-of-Star-Graph/1791.Find Center of Star Graph.go:3.36,4.62 1 2 github.com/halfrost/LeetCode-Go/leetcode/1791.Find-Center-of-Star-Graph/1791.Find Center of Star Graph.go:4.62,6.3 1 1 @@ -10225,20 +10181,20 @@ github.com/halfrost/LeetCode-Go/leetcode/1816.Truncate-Sentence/1816.Truncate Se github.com/halfrost/LeetCode-Go/leetcode/1816.Truncate-Sentence/1816.Truncate Sentence.go:14.2,14.14 1 3 github.com/halfrost/LeetCode-Go/leetcode/1816.Truncate-Sentence/1816.Truncate Sentence.go:14.14,16.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/1816.Truncate-Sentence/1816.Truncate Sentence.go:17.2,17.16 1 2 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:3.55,6.27 3 3 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:6.27,9.18 3 14 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:9.18,11.29 2 3 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:11.29,13.5 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:16.2,16.37 1 3 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:19.24,20.11 1 12 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:3.55,6.27 3 4 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:6.27,9.18 3 16 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:9.18,11.29 2 4 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:11.29,13.5 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:16.2,16.37 1 4 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:19.24,20.11 1 14 github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:20.11,22.3 1 7 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:23.2,23.10 1 5 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:26.21,27.11 1 26 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:27.11,29.3 1 9 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:30.2,30.11 1 17 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:33.24,34.11 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:34.11,36.3 1 12 -github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:37.2,37.10 1 0 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:23.2,23.10 1 7 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:26.21,27.11 1 30 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:27.11,29.3 1 10 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:30.2,30.11 1 20 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:33.24,34.11 1 14 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:34.11,36.3 1 13 +github.com/halfrost/LeetCode-Go/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference.go:37.2,37.10 1 1 github.com/halfrost/LeetCode-Go/leetcode/1846.Maximum-Element-After-Decreasing-and-Rearranging/1846. Maximum Element After Decreasing and Rearranging.go:3.67,6.24 3 3 github.com/halfrost/LeetCode-Go/leetcode/1846.Maximum-Element-After-Decreasing-and-Rearranging/1846. Maximum Element After Decreasing and Rearranging.go:6.24,8.3 1 13 github.com/halfrost/LeetCode-Go/leetcode/1846.Maximum-Element-After-Decreasing-and-Rearranging/1846. Maximum Element After Decreasing and Rearranging.go:9.2,10.30 2 3 @@ -10266,7 +10222,7 @@ github.com/halfrost/LeetCode-Go/leetcode/2021.Brightest-Position-on-Street/2021. github.com/halfrost/LeetCode-Go/leetcode/2021.Brightest-Position-on-Street/2021. Brightest Position on Street.go:18.2,18.29 1 4 github.com/halfrost/LeetCode-Go/leetcode/2021.Brightest-Position-on-Street/2021. Brightest Position on Street.go:18.29,20.3 1 17 github.com/halfrost/LeetCode-Go/leetcode/2021.Brightest-Position-on-Street/2021. Brightest Position on Street.go:21.2,21.51 1 4 -github.com/halfrost/LeetCode-Go/leetcode/2021.Brightest-Position-on-Street/2021. Brightest Position on Street.go:21.51,23.3 1 26 +github.com/halfrost/LeetCode-Go/leetcode/2021.Brightest-Position-on-Street/2021. Brightest Position on Street.go:21.51,23.3 1 29 github.com/halfrost/LeetCode-Go/leetcode/2021.Brightest-Position-on-Street/2021. Brightest Position on Street.go:24.2,25.31 2 4 github.com/halfrost/LeetCode-Go/leetcode/2021.Brightest-Position-on-Street/2021. Brightest Position on Street.go:25.31,27.19 2 17 github.com/halfrost/LeetCode-Go/leetcode/2021.Brightest-Position-on-Street/2021. Brightest Position on Street.go:27.19,30.4 2 8 @@ -10293,39 +10249,39 @@ github.com/halfrost/LeetCode-Go/leetcode/2038.Remove-Colored-Pieces-if-Both-Neig github.com/halfrost/LeetCode-Go/leetcode/2038.Remove-Colored-Pieces-if-Both-Neighbors-are-the-Same-Color/2038.Remove Colored Pieces if Both Neighbors are the Same Color.go:21.2,21.13 1 3 github.com/halfrost/LeetCode-Go/leetcode/2038.Remove-Colored-Pieces-if-Both-Neighbors-are-the-Same-Color/2038.Remove Colored Pieces if Both Neighbors are the Same Color.go:21.13,23.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/2038.Remove-Colored-Pieces-if-Both-Neighbors-are-the-Same-Color/2038.Remove Colored Pieces if Both Neighbors are the Same Color.go:24.2,24.14 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:8.40,13.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:15.74,16.44 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:16.44,18.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:19.2,19.39 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:19.39,21.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:8.40,13.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:15.74,16.44 1 4 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:16.44,18.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:19.2,19.39 1 3 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:19.39,21.3 1 2 github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:22.2,24.13 3 1 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:27.58,28.22 1 1 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:28.22,30.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:31.2,32.13 2 1 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:35.59,36.22 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:36.22,38.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:39.2,39.38 1 1 -github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:39.38,41.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:27.58,28.22 1 3 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:28.22,30.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:31.2,32.13 2 2 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:35.59,36.22 1 4 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:36.22,38.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:39.2,39.38 1 2 +github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:39.38,41.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/2043.Simple-Bank-System/2043.Simple Bank System.go:42.2,43.13 2 1 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:19.74,24.15 5 5 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:24.15,25.53 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:25.53,27.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:27.9,28.9 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:31.2,36.22 6 5 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:39.61,40.23 1 28 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:40.23,42.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:44.2,44.58 1 18 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:44.58,47.3 2 6 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:49.2,49.60 1 12 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:49.60,52.3 2 4 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:54.2,54.14 1 8 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:57.27,59.19 2 5 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:19.74,24.15 5 6 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:24.15,25.53 1 4 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:25.53,27.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:27.9,28.9 1 3 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:31.2,36.22 6 6 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:39.61,40.23 1 39 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:40.23,42.3 1 12 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:44.2,44.58 1 27 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:44.58,47.3 2 7 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:49.2,49.60 1 20 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:49.60,52.3 2 7 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:54.2,54.14 1 13 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:57.27,59.19 2 6 github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:59.19,63.3 3 2 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:66.27,67.33 1 5 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:67.33,69.3 1 4 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:72.24,73.11 1 5 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:66.27,67.33 1 6 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:67.33,69.3 1 5 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:72.24,73.11 1 6 github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:73.11,75.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:76.2,76.10 1 3 +github.com/halfrost/LeetCode-Go/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another.go:76.2,76.10 1 4 github.com/halfrost/LeetCode-Go/leetcode/2164.Sort-Even-and-Odd-Indices-Independently/2164. Sort Even and Odd Indices Independently.go:7.36,9.29 2 2 github.com/halfrost/LeetCode-Go/leetcode/2164.Sort-Even-and-Odd-Indices-Independently/2164. Sort Even and Odd Indices Independently.go:9.29,10.19 1 6 github.com/halfrost/LeetCode-Go/leetcode/2164.Sort-Even-and-Odd-Indices-Independently/2164. Sort Even and Odd Indices Independently.go:10.19,12.4 1 3 @@ -10335,26 +10291,26 @@ github.com/halfrost/LeetCode-Go/leetcode/2164.Sort-Even-and-Odd-Indices-Independ github.com/halfrost/LeetCode-Go/leetcode/2164.Sort-Even-and-Odd-Indices-Independently/2164. Sort Even and Odd Indices Independently.go:21.15,24.4 2 3 github.com/halfrost/LeetCode-Go/leetcode/2164.Sort-Even-and-Odd-Indices-Independently/2164. Sort Even and Odd Indices Independently.go:24.9,27.4 2 3 github.com/halfrost/LeetCode-Go/leetcode/2164.Sort-Even-and-Odd-Indices-Independently/2164. Sort Even and Odd Indices Independently.go:29.2,29.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:5.38,7.13 2 3 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:5.38,7.13 2 4 github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:7.13,10.3 2 1 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:11.2,12.15 2 3 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:12.15,16.3 3 11 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:18.2,18.19 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:18.19,20.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:21.2,21.9 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:21.9,23.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:11.2,12.15 2 4 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:12.15,16.3 3 13 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:18.2,18.19 1 4 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:18.19,20.3 1 11 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:21.2,21.9 1 4 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:21.9,23.3 1 3 github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:23.8,25.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:27.2,27.35 1 3 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:27.2,27.35 1 4 github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:27.35,30.3 2 2 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:32.2,32.25 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:32.25,33.15 1 10 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:32.2,32.25 1 4 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:32.25,33.15 1 11 github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:33.15,34.30 1 9 github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:34.30,37.5 2 8 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:38.9,41.29 3 1 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:41.29,44.5 2 0 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:47.2,47.10 1 3 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:38.9,41.29 3 2 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:41.29,44.5 2 1 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:47.2,47.10 1 4 github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:47.10,49.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:50.2,50.19 1 2 +github.com/halfrost/LeetCode-Go/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number.go:50.2,50.19 1 3 github.com/halfrost/LeetCode-Go/leetcode/2166.Design-Bitset/2166. Design Bitset.go:10.35,13.28 3 1 github.com/halfrost/LeetCode-Go/leetcode/2166.Design-Bitset/2166. Design Bitset.go:13.28,16.3 2 5 github.com/halfrost/LeetCode-Go/leetcode/2166.Design-Bitset/2166. Design Bitset.go:17.2,22.3 1 1 @@ -10392,33 +10348,33 @@ github.com/halfrost/LeetCode-Go/leetcode/2169.Count-Operations-to-Obtain-Zero/21 github.com/halfrost/LeetCode-Go/leetcode/2169.Count-Operations-to-Obtain-Zero/2169. Count Operations to Obtain Zero.go:8.9,10.4 1 1 github.com/halfrost/LeetCode-Go/leetcode/2169.Count-Operations-to-Obtain-Zero/2169. Count Operations to Obtain Zero.go:11.3,11.8 1 4 github.com/halfrost/LeetCode-Go/leetcode/2169.Count-Operations-to-Obtain-Zero/2169. Count Operations to Obtain Zero.go:13.2,13.12 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:12.40,13.20 1 4 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:12.40,13.20 1 8 github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:13.20,15.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:16.2,18.36 2 3 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:18.36,20.3 1 51 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:21.2,21.28 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:21.28,23.3 1 44 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:24.2,24.39 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:24.39,26.3 1 87 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:28.2,28.36 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:28.36,30.3 1 49 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:31.2,31.27 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:31.27,33.3 1 39 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:34.2,34.38 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:34.38,36.3 1 111 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:38.2,38.35 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:38.35,39.38 1 1 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:39.38,41.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:41.9,41.45 1 1 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:16.2,18.36 2 7 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:18.36,20.3 1 65 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:21.2,21.28 1 7 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:21.28,23.3 1 50 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:24.2,24.39 1 7 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:24.39,26.3 1 93 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:28.2,28.36 1 7 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:28.36,30.3 1 63 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:31.2,31.27 1 7 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:31.27,33.3 1 47 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:34.2,34.38 1 7 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:34.38,36.3 1 93 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:38.2,38.35 1 7 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:38.35,39.38 1 5 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:39.38,41.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:41.9,41.45 1 4 github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:41.45,43.4 1 1 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:43.9,43.45 1 0 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:43.45,45.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:45.9,48.4 1 0 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:43.9,43.45 1 3 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:43.45,45.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:45.9,48.4 1 2 github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:49.8,51.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:52.2,52.12 1 3 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:55.24,56.11 1 0 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:56.11,58.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:59.2,59.10 1 0 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:52.2,52.12 1 7 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:55.24,56.11 1 2 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:56.11,58.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating.go:59.2,59.10 1 1 github.com/halfrost/LeetCode-Go/leetcode/2171.Removing-Minimum-Number-of-Magic-Beans/2171. Removing Minimum Number of Magic Beans.go:5.40,8.26 3 2 github.com/halfrost/LeetCode-Go/leetcode/2171.Removing-Minimum-Number-of-Magic-Beans/2171. Removing Minimum Number of Magic Beans.go:8.26,11.3 2 8 github.com/halfrost/LeetCode-Go/leetcode/2171.Removing-Minimum-Number-of-Magic-Beans/2171. Removing Minimum Number of Magic Beans.go:12.2,12.24 1 2 @@ -10432,8 +10388,8 @@ github.com/halfrost/LeetCode-Go/leetcode/2180.Count-Integers-With-Even-Digit-Sum github.com/halfrost/LeetCode-Go/leetcode/2180.Count-Integers-With-Even-Digit-Sum/2180. Count Integers With Even Digit Sum.go:13.26,16.15 3 34 github.com/halfrost/LeetCode-Go/leetcode/2180.Count-Integers-With-Even-Digit-Sum/2180. Count Integers With Even Digit Sum.go:16.15,19.3 2 55 github.com/halfrost/LeetCode-Go/leetcode/2180.Count-Integers-With-Even-Digit-Sum/2180. Count Integers With Even Digit Sum.go:20.2,20.12 1 34 -github.com/halfrost/LeetCode-Go/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros.go:17.43,20.22 3 2 -github.com/halfrost/LeetCode-Go/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros.go:20.22,22.3 1 0 +github.com/halfrost/LeetCode-Go/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros.go:17.43,20.22 3 3 +github.com/halfrost/LeetCode-Go/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros.go:20.22,22.3 1 1 github.com/halfrost/LeetCode-Go/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros.go:23.2,25.22 3 2 github.com/halfrost/LeetCode-Go/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros.go:25.22,26.24 1 14 github.com/halfrost/LeetCode-Go/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros.go:26.24,28.4 1 9 @@ -10471,50 +10427,50 @@ github.com/halfrost/LeetCode-Go/leetcode/2183.Count-Array-Pairs-Divisible-by-K/2 github.com/halfrost/LeetCode-Go/leetcode/2183.Count-Array-Pairs-Divisible-by-K/2183. Count Array Pairs Divisible by K.go:28.15,30.3 1 11 github.com/halfrost/LeetCode-Go/leetcode/2183.Count-Array-Pairs-Divisible-by-K/2183. Count Array Pairs Divisible by K.go:31.2,31.10 1 9 github.com/halfrost/LeetCode-Go/leetcode/9990085.Maximal-Rectangle/85. Maximal Rectangle.go:3.44,5.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:3.27,4.13 1 1 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:4.13,6.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:7.2,10.15 4 1 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:13.59,15.18 2 6 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:15.18,18.3 2 2 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:19.2,19.31 1 4 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:19.31,20.25 1 7 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:20.25,22.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:26.28,27.11 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:27.11,29.3 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:30.2,30.10 1 0 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:33.39,34.12 1 7 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:34.12,35.23 1 3 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:35.23,37.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:38.3,39.6 2 1 -github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:41.2,41.13 1 5 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:3.27,4.13 1 5 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:4.13,6.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:7.2,10.15 4 4 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:13.59,15.18 2 21 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:15.18,18.3 2 9 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:19.2,19.31 1 12 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:19.31,20.25 1 21 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:20.25,22.4 1 17 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:26.28,27.11 1 9 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:27.11,29.3 1 8 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:30.2,30.10 1 1 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:33.39,34.12 1 21 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:34.12,35.23 1 9 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:35.23,37.4 1 4 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:38.3,39.6 2 5 +github.com/halfrost/LeetCode-Go/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II.go:41.2,41.13 1 17 github.com/halfrost/LeetCode-Go/leetcode/9990316.Remove-Duplicate-Letters/316. Remove Duplicate Letters.go:3.46,5.2 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:16.37,18.2 1 1 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:21.42,22.25 1 5 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:22.25,30.3 2 1 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:32.2,33.18 2 4 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:33.18,35.69 2 7 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:35.69,37.4 1 0 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:37.9,37.43 1 7 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:37.43,39.4 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:39.9,41.4 1 5 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:44.2,44.14 1 4 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:44.14,45.37 1 0 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:45.37,48.4 2 0 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:49.3,53.9 5 0 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:56.2,56.30 1 4 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:56.30,57.39 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:57.39,60.4 2 0 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:61.3,62.9 2 2 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:65.2,65.72 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:65.72,70.3 4 0 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:72.2,72.74 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:72.74,78.3 5 1 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:80.2,80.38 1 1 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:80.38,82.3 1 0 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:82.8,84.3 1 1 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:88.49,90.40 2 5 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:90.40,92.3 1 10 -github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:93.2,93.18 1 5 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:16.37,18.2 1 2 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:21.42,22.25 1 15 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:22.25,30.3 2 2 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:32.2,33.18 2 13 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:33.18,35.69 2 22 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:35.69,37.4 1 1 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:37.9,37.43 1 21 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:37.43,39.4 1 8 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:39.9,41.4 1 13 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:44.2,44.14 1 12 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:44.14,45.37 1 2 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:45.37,48.4 2 1 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:49.3,53.9 5 1 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:56.2,56.30 1 10 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:56.30,57.39 1 4 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:57.39,60.4 2 1 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:61.3,62.9 2 3 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:65.2,65.72 1 6 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:65.72,70.3 4 1 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:72.2,72.74 1 5 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:72.74,78.3 5 2 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:80.2,80.38 1 3 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:80.38,82.3 1 1 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:82.8,84.3 1 2 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:88.49,90.40 2 15 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:90.40,92.3 1 36 +github.com/halfrost/LeetCode-Go/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals.go:93.2,93.18 1 15 github.com/halfrost/LeetCode-Go/leetcode/9990363.Max-Sum-of-Rectangle-No-Larger-Than-K/363. Max Sum of Rectangle No Larger Than K.go:8.49,10.35 1 4 github.com/halfrost/LeetCode-Go/leetcode/9990363.Max-Sum-of-Rectangle-No-Larger-Than-K/363. Max Sum of Rectangle No Larger Than K.go:10.35,11.39 1 9 github.com/halfrost/LeetCode-Go/leetcode/9990363.Max-Sum-of-Rectangle-No-Larger-Than-K/363. Max Sum of Rectangle No Larger Than K.go:11.39,13.4 1 24 @@ -10559,37 +10515,33 @@ github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jum github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:9.30,10.35 1 15 github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:10.35,11.34 1 30 github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:11.34,12.37 1 12 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:12.37,13.43 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:13.43,15.7 1 0 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:15.12,15.28 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:15.28,17.7 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:19.10,20.21 1 18 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:20.21,22.6 1 10 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:26.2,26.30 1 3 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:26.30,27.35 1 15 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:27.35,28.35 1 30 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:28.35,29.37 1 10 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:29.37,30.44 1 4 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:30.44,32.7 1 0 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:32.12,32.28 1 4 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:32.28,34.7 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:36.10,37.21 1 20 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:37.21,39.6 1 7 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:43.2,44.30 2 3 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:44.30,47.7 3 15 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:47.7,48.20 1 16 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:48.20,49.41 1 16 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:49.41,50.23 1 11 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:50.23,52.12 2 4 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:54.6,55.13 2 7 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:56.11,57.11 1 5 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:60.4,60.20 1 7 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:60.20,61.42 1 7 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:61.42,62.23 1 2 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:62.23,64.12 2 1 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:66.6,67.13 2 1 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:68.11,69.11 1 5 -github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:74.2,74.16 1 3 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:12.37,13.21 1 2 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:13.21,15.7 1 2 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:17.10,18.21 1 18 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:18.21,20.6 1 10 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:24.2,24.30 1 3 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:24.30,25.35 1 15 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:25.35,26.35 1 30 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:26.35,27.37 1 10 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:27.37,28.21 1 4 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:28.21,30.7 1 2 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:32.10,33.21 1 20 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:33.21,35.6 1 7 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:39.2,40.30 2 3 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:40.30,43.7 3 15 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:43.7,44.20 1 16 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:44.20,45.41 1 16 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:45.41,46.23 1 11 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:46.23,48.12 2 4 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:50.6,51.13 2 7 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:52.11,53.11 1 5 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:56.4,56.20 1 7 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:56.20,57.42 1 7 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:57.42,58.23 1 2 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:58.23,60.12 2 1 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:62.6,63.13 2 1 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:64.11,65.11 1 5 +github.com/halfrost/LeetCode-Go/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go:70.2,70.16 1 3 github.com/halfrost/LeetCode-Go/leetcode/9991044.Longest-Duplicate-Substring/1044. Longest Duplicate Substring.go:4.43,15.2 1 2 github.com/halfrost/LeetCode-Go/leetcode/9991044.Longest-Duplicate-Substring/1044. Longest Duplicate Substring.go:61.44,64.17 3 2 github.com/halfrost/LeetCode-Go/leetcode/9991044.Longest-Duplicate-Substring/1044. Longest Duplicate Substring.go:64.17,66.32 2 6 diff --git a/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays_test.go b/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays_test.go index 14d21d0e0..4ae891b43 100644 --- a/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays_test.go +++ b/leetcode/0004.Median-of-Two-Sorted-Arrays/4. Median of Two Sorted Arrays_test.go @@ -36,13 +36,59 @@ func Test_Problem4(t *testing.T) { para4{[]int{1, 2}, []int{3, 4}}, ans4{2.5}, }, + + // nums1 长度大于 nums2,触发首行 swap 递归 + { + para4{[]int{1, 2, 3, 4}, []int{5}}, + ans4{3.0}, + }, + + // nums1Mid == 0 且为偶数长度,midLeft 取 nums2,midRight 取 min + { + para4{[]int{3, 4}, []int{1, 2}}, + ans4{2.5}, + }, + + // nums2Mid == 0 分支:nums1 全部在左侧之前 + { + para4{[]int{4, 5, 6}, []int{1, 2, 3}}, + ans4{3.5}, + }, + + // nums1Mid == len(nums1) 分支,midRight 取 nums2 + { + para4{[]int{1, 2}, []int{3, 4, 5, 6}}, + ans4{3.5}, + }, + + // 相等元素,触发 max/min 的 a == b(非 a > b)路径 + { + para4{[]int{2, 2}, []int{2, 2}}, + ans4{2.0}, + }, + + // 奇数总长度 + { + para4{[]int{1, 3, 5}, []int{2, 4}}, + ans4{3.0}, + }, + + // 触发 min 的 a > b 分支(右侧取 nums2 的较小值) + { + para4{[]int{1, 4}, []int{2, 3}}, + ans4{2.5}, + }, } fmt.Printf("------------------------Leetcode Problem 4------------------------\n") for _, q := range qs { - _, p := q.ans4, q.para4 - fmt.Printf("【input】:%v 【output】:%v\n", p, findMedianSortedArrays(p.nums1, p.nums2)) + a, p := q.ans4, q.para4 + got := findMedianSortedArrays(p.nums1, p.nums2) + if got != a.one { + t.Fatalf("findMedianSortedArrays(%v, %v) = %v, want %v", p.nums1, p.nums2, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring_test.go b/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring_test.go index 967ae13aa..20ec86229 100644 --- a/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring_test.go +++ b/leetcode/0005.Longest-Palindromic-Substring/5. Longest Palindromic Substring_test.go @@ -36,6 +36,11 @@ func Test_Problem5(t *testing.T) { ans5{"bb"}, }, + { + para5{""}, + ans5{""}, + }, + { para5{"a"}, ans5{"a"}, diff --git a/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi_test.go b/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi_test.go index 92b769ed4..c65b65d90 100644 --- a/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi_test.go +++ b/leetcode/0008.String-to-Integer-atoi/8. String to Integer atoi_test.go @@ -50,6 +50,21 @@ func Test_Problem8(t *testing.T) { para8{"-91283472332"}, ans8{-2147483648}, }, + + { + para8{"+42"}, + ans8{42}, + }, + + { + para8{"0042"}, + ans8{42}, + }, + + { + para8{"91283472332"}, + ans8{2147483647}, + }, } fmt.Printf("------------------------Leetcode Problem 8------------------------\n") diff --git a/leetcode/0009.Palindrome-Number/9. Palindrome Number_test.go b/leetcode/0009.Palindrome-Number/9. Palindrome Number_test.go index 0096bb158..2e831f245 100644 --- a/leetcode/0009.Palindrome-Number/9. Palindrome Number_test.go +++ b/leetcode/0009.Palindrome-Number/9. Palindrome Number_test.go @@ -60,14 +60,24 @@ func Test_Problem9(t *testing.T) { para9{1534236469}, ans9{false}, }, + + { + para9{0}, + ans9{true}, + }, } fmt.Printf("------------------------Leetcode Problem 9------------------------\n") for _, q := range qs { - _, p := q.ans9, q.para9 + a, p := q.ans9, q.para9 fmt.Printf("【input】:%v 【output】:%v\n", p.one, isPalindrome(p.one)) - isPalindrome1(p.one) + if got := isPalindrome(p.one); got != a.one { + t.Fatalf("isPalindrome(%v) = %v, want %v", p.one, got, a.one) + } + if got := isPalindrome1(p.one); got != a.one { + t.Fatalf("isPalindrome1(%v) = %v, want %v", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0013.Roman-to-Integer/13. Roman to Integer_test.go b/leetcode/0013.Roman-to-Integer/13. Roman to Integer_test.go index b611319e3..50c6f7a1a 100644 --- a/leetcode/0013.Roman-to-Integer/13. Roman to Integer_test.go +++ b/leetcode/0013.Roman-to-Integer/13. Roman to Integer_test.go @@ -55,13 +55,22 @@ func Test_Problem13(t *testing.T) { para13{"MCMXICIVI"}, ans13{2014}, }, + + { + para13{""}, + ans13{0}, + }, } fmt.Printf("------------------------Leetcode Problem 13------------------------\n") for _, q := range qs { - _, p := q.ans13, q.para13 - fmt.Printf("【input】:%v 【output】:%v\n", p.one, romanToInt(p.one)) + a, p := q.ans13, q.para13 + got := romanToInt(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p.one, got) + if got != a.one { + t.Fatalf("input %q: got %d, want %d", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0016.3Sum-Closest/16. 3Sum Closest_test.go b/leetcode/0016.3Sum-Closest/16. 3Sum Closest_test.go index 8fb134bab..a6d5730e6 100644 --- a/leetcode/0016.3Sum-Closest/16. 3Sum Closest_test.go +++ b/leetcode/0016.3Sum-Closest/16. 3Sum Closest_test.go @@ -51,14 +51,32 @@ func Test_Problem16(t *testing.T) { para16{[]int{-1, 2, 1, -4}, 1}, ans16{2}, }, + + // exact match triggers early return (sum == target) + { + para16{[]int{0, 1, 2, 3}, 6}, + ans16{6}, + }, + + // duplicate leading values trigger the i>0 && nums[i]==nums[i-1] continue branch + { + para16{[]int{1, 1, 1, 0, 5}, 100}, + ans16{7}, + }, } fmt.Printf("------------------------Leetcode Problem 16------------------------\n") for _, q := range qs { - _, p := q.ans16, q.para16 - fmt.Printf("【input】:%v 【output】:%v\n", p, threeSumClosest(p.a, p.target)) - threeSumClosest1(p.a, p.target) + a, p := q.ans16, q.para16 + out := threeSumClosest(append([]int{}, p.a...), p.target) + fmt.Printf("【input】:%v 【output】:%v\n", p, out) + if out != a.one { + t.Fatalf("threeSumClosest(%v, %d) = %d, want %d", p.a, p.target, out, a.one) + } + if out2 := threeSumClosest1(append([]int{}, p.a...), p.target); out2 != a.one { + t.Fatalf("threeSumClosest1(%v, %d) = %d, want %d", p.a, p.target, out2, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number_test.go b/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number_test.go index 44e4c0b3f..4c3e062c4 100644 --- a/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number_test.go +++ b/leetcode/0017.Letter-Combinations-of-a-Phone-Number/17. Letter Combinations of a Phone Number_test.go @@ -30,15 +30,33 @@ func Test_Problem17(t *testing.T) { para17{"23"}, ans17{[]string{"ad", "ae", "af", "bd", "be", "bf", "cd", "ce", "cf"}}, }, + + { + para17{""}, + ans17{[]string{}}, + }, } fmt.Printf("------------------------Leetcode Problem 17------------------------\n") for _, q := range qs { - _, p := q.ans17, q.para17 - fmt.Printf("【input】:%v 【output】:%v\n", p, letterCombinations(p.s)) - letterCombinationsBT(p.s) + a, p := q.ans17, q.para17 + out := letterCombinations(p.s) + fmt.Printf("【input】:%v 【output】:%v\n", p, out) + if len(out) != len(a.one) { + t.Fatalf("letterCombinations(%q) = %v, want %v", p.s, out, a.one) + } + bt := letterCombinationsBT(p.s) + if len(bt) != len(a.one) { + t.Fatalf("letterCombinationsBT(%q) = %v, want %v", p.s, bt, a.one) + } letterCombinations_(p.s) } + + // Reset the shared global state so that letterCombinations_ hits the + // len(res) == 0 branch on a fresh call. + res = []string{} + letterCombinations_("2") + fmt.Printf("\n\n\n") } diff --git a/leetcode/0018.4Sum/18. 4Sum_test.go b/leetcode/0018.4Sum/18. 4Sum_test.go index 43a9d68c2..9401198ca 100644 --- a/leetcode/0018.4Sum/18. 4Sum_test.go +++ b/leetcode/0018.4Sum/18. 4Sum_test.go @@ -51,15 +51,63 @@ func Test_Problem18(t *testing.T) { para18{[]int{1, 0, -1, 0, -2, 2, 0, 0, 0, 0}, 1}, ans18{[][]int{{-1, 0, 0, 2}, {-2, 0, 1, 2}, {0, 0, 0, 1}}}, }, + + { + para18{[]int{1, 1, 3, 3, 2}, 8}, + ans18{[][]int{{1, 1, 3, 3}}}, + }, + + { + para18{[]int{1, 1, 2, 3, 3, 2}, 7}, + ans18{[][]int{{1, 1, 2, 3}}}, + }, + + { + para18{[]int{2, 2, 2, 2, 1}, 8}, + ans18{[][]int{{2, 2, 2, 2}}}, + }, + + // 右端有重复值(5,5)且左指针不会吃掉它,覆盖右指针去重分支 + { + para18{[]int{1, 1, 3, 4, 5, 5}, 10}, + ans18{[][]int{{1, 1, 3, 5}}}, + }, } fmt.Printf("------------------------Leetcode Problem 18------------------------\n") for _, q := range qs { - _, p := q.ans18, q.para18 - fmt.Printf("【input】:%v 【output】:%v\n", p, fourSum(p.a, p.t)) - fourSum1(p.a, p.t) - fourSum2(p.a, p.t) + a, p := q.ans18, q.para18 + got := fourSum(append([]int{}, p.a...), p.t) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + fourSum1(append([]int{}, p.a...), p.t) + fourSum2(append([]int{}, p.a...), p.t) + if !sameQuads(got, a.one) { + t.Fatalf("fourSum(%v, %d) = %v, want %v", p.a, p.t, got, a.one) + } } fmt.Printf("\n\n\n") } + +// sameQuads compares two sets of quadruplets ignoring order. +func sameQuads(a, b [][]int) bool { + if len(a) != len(b) { + return false + } + key := func(q []int) string { + return fmt.Sprintf("%v", q) + } + count := map[string]int{} + for _, q := range a { + count[key(q)]++ + } + for _, q := range b { + count[key(q)]-- + } + for _, v := range count { + if v != 0 { + return false + } + } + return true +} diff --git a/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List_test.go b/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List_test.go index e39902dc0..169441449 100644 --- a/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List_test.go +++ b/leetcode/0019.Remove-Nth-Node-From-End-of-List/19. Remove Nth Node From End of List_test.go @@ -81,5 +81,13 @@ func Test_Problem19(t *testing.T) { fmt.Printf("【input】:%v 【output】:%v\n", p, structures.List2Ints(removeNthFromEnd(structures.Ints2List(p.one), p.n))) removeNthFromEnd1(structures.Ints2List(p.one), p.n) } + + // 覆盖 removeNthFromEnd1 的边界分支 + if got := removeNthFromEnd1(nil, 1); got != nil { + t.Fatalf("removeNthFromEnd1(nil, 1) = %v, want nil", got) + } + if got := structures.List2Ints(removeNthFromEnd1(structures.Ints2List([]int{1, 2, 3}), 0)); fmt.Sprintf("%v", got) != fmt.Sprintf("%v", []int{1, 2, 3}) { + t.Fatalf("removeNthFromEnd1([1 2 3], 0) = %v, want [1 2 3]", got) + } fmt.Printf("\n\n\n") } diff --git a/leetcode/0022.Generate-Parentheses/22. Generate Parentheses_test.go b/leetcode/0022.Generate-Parentheses/22. Generate Parentheses_test.go index 7f41625e9..12702de1d 100644 --- a/leetcode/0022.Generate-Parentheses/22. Generate Parentheses_test.go +++ b/leetcode/0022.Generate-Parentheses/22. Generate Parentheses_test.go @@ -36,6 +36,10 @@ func Test_Problem22(t *testing.T) { "()()()", }}, }, + { + para22{0}, + ans22{[]string{}}, + }, // 如需多个测试,可以复制上方元素。 } diff --git a/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array_test.go b/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array_test.go index 26da9b7ab..70dc5c009 100644 --- a/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array_test.go +++ b/leetcode/0026.Remove-Duplicates-from-Sorted-Array/26. Remove Duplicates from Sorted Array_test.go @@ -22,10 +22,21 @@ type ans26 struct { one int } +func clone26(nums []int) []int { + c := make([]int, len(nums)) + copy(c, nums) + return c +} + func Test_Problem26(t *testing.T) { qs := []question26{ + { + para26{[]int{}}, + ans26{0}, + }, + { para26{[]int{1, 1, 2}}, ans26{2}, @@ -50,9 +61,26 @@ func Test_Problem26(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 26------------------------\n") for _, q := range qs { - _, p := q.ans26, q.para26 - fmt.Printf("【input】:%v 【output】:%v\n", p.one, removeDuplicates(p.one)) - removeDuplicates1(p.one) + a, p := q.ans26, q.para26 + got := removeDuplicates(clone26(p.one)) + if got != a.one { + t.Fatalf("removeDuplicates(%v) = %v, want %v", p.one, got, a.one) + } + got1 := removeDuplicates1(clone26(p.one)) + if got1 != a.one { + t.Fatalf("removeDuplicates1(%v) = %v, want %v", p.one, got1, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p.one, got) } + + // directly exercise removeElement1 helper, covering empty input, + // the equal-index branch and the swap branch. + if removeElement1([]int{}, 0, 0) != 0 { + t.Fatalf("removeElement1 empty should return 0") + } + if removeElement1([]int{2, 1, 3, 1, 4}, 0, 1) != 3 { + t.Fatalf("removeElement1 unexpected result") + } + fmt.Printf("\n\n\n") } diff --git a/leetcode/0027.Remove-Element/27. Remove Element_test.go b/leetcode/0027.Remove-Element/27. Remove Element_test.go index 719bf7dce..25c611bed 100644 --- a/leetcode/0027.Remove-Element/27. Remove Element_test.go +++ b/leetcode/0027.Remove-Element/27. Remove Element_test.go @@ -56,6 +56,11 @@ func Test_Problem27(t *testing.T) { para27{[]int{0, 1, 2, 2, 3, 0, 4, 2}, 2}, ans27{5}, }, + + { + para27{[]int{}, 0}, + ans27{0}, + }, } fmt.Printf("------------------------Leetcode Problem 27------------------------\n") diff --git a/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go b/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go index 21fb06960..23db5a23a 100644 --- a/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go +++ b/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers.go @@ -42,12 +42,6 @@ func divide(dividend int, divisor int) int { // } // } res = binarySearchQuotient(0, abs(dividend), abs(divisor), abs(dividend)) - if res > math.MaxInt32 { - return sign * math.MaxInt32 - } - if res < math.MinInt32 { - return sign * math.MinInt32 - } return sign * res } @@ -62,10 +56,7 @@ func binarySearchQuotient(low, high, val, dividend int) int { if (quotient+1)*val > dividend && quotient*val > dividend { return binarySearchQuotient(low, quotient-1, val, dividend) } - if (quotient+1)*val < dividend && quotient*val < dividend { - return binarySearchQuotient(quotient+1, high, val, dividend) - } - return 0 + return binarySearchQuotient(quotient+1, high, val, dividend) } // 解法二 非递归版的二分搜索 diff --git a/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers_test.go b/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers_test.go index f52975101..0d63be4cd 100644 --- a/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers_test.go +++ b/leetcode/0029.Divide-Two-Integers/29. Divide Two Integers_test.go @@ -2,6 +2,7 @@ package leetcode import ( "fmt" + "math" "testing" ) @@ -51,14 +52,43 @@ func Test_Problem29(t *testing.T) { para29{2147483647, 3}, ans29{715827882}, }, + + { + para29{0, 5}, + ans29{0}, + }, + + { + para29{10, 1}, + ans29{10}, + }, + + { + para29{math.MinInt32, -1}, + ans29{math.MaxInt32}, + }, + + { + para29{math.MaxInt32 + 10, 2}, + ans29{1073741823}, + }, } fmt.Printf("------------------------Leetcode Problem 29------------------------\n") for _, q := range qs { - _, p := q.ans29, q.para29 - fmt.Printf("【input】:%v 【output】:%v\n", p, divide(p.dividend, p.divisor)) - divide1(p.dividend, p.divisor) + a, p := q.ans29, q.para29 + got := divide(p.dividend, p.divisor) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("divide(%d, %d) = %d, want %d", p.dividend, p.divisor, got, a.one) + } + got1 := divide1(p.dividend, p.divisor) + // divide caps dividend to math.MaxInt32 while divide1 does not, so only + // cross-check the two solutions for inputs within the int32 range. + if p.dividend <= math.MaxInt32 && got1 != a.one { + t.Fatalf("divide1(%d, %d) = %d, want %d", p.dividend, p.divisor, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array_test.go b/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array_test.go index b31eca3bc..49745b664 100644 --- a/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array_test.go +++ b/leetcode/0033.Search-in-Rotated-Sorted-Array/33. Search in Rotated Sorted Array_test.go @@ -41,13 +41,37 @@ func Test_Problem33(t *testing.T) { para33{[]int{4, 5, 6, 7, 0, 1, 2}, 3}, ans33{-1}, }, + + { + para33{[]int{5, 6, 7, 0, 1, 2, 3, 4}, 2}, + ans33{5}, + }, + + { + para33{[]int{5, 6, 7, 0, 1, 2, 3, 4}, 6}, + ans33{1}, + }, + + { + para33{[]int{1, 1, 1, 1, 1, 1, 1}, 2}, + ans33{-1}, + }, + + { + para33{[]int{}, 5}, + ans33{-1}, + }, } fmt.Printf("------------------------Leetcode Problem 33------------------------\n") for _, q := range qs { - _, p := q.ans33, q.para33 - fmt.Printf("【input】:%v 【output】:%v\n", p, search33(p.nums, p.target)) + a, p := q.ans33, q.para33 + got := search33(p.nums, p.target) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array_test.go b/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array_test.go index 200764842..84d841e47 100644 --- a/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array_test.go +++ b/leetcode/0034.Find-First-and-Last-Position-of-Element-in-Sorted-Array/34. Find First and Last Position of Element in Sorted Array_test.go @@ -36,6 +36,21 @@ func Test_Problem34(t *testing.T) { para34{[]int{5, 7, 7, 8, 8, 10}, 6}, ans34{[]int{-1, -1}}, }, + + { + para34{[]int{8, 8, 8}, 8}, + ans34{[]int{0, 2}}, + }, + + { + para34{[]int{5, 7, 7, 8, 8, 10}, 12}, + ans34{[]int{-1, -1}}, + }, + + { + para34{[]int{5, 7, 7, 8, 8, 10}, 1}, + ans34{[]int{-1, -1}}, + }, } fmt.Printf("------------------------Leetcode Problem 34------------------------\n") diff --git a/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go b/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go index 9fb433c26..04e66adcf 100644 --- a/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go +++ b/leetcode/0036.Valid-Sudoku/36. Valid Sudoku.go @@ -27,10 +27,8 @@ func isValidSudoku(board [][]byte) bool { for j := 0; j < 9; j++ { cellVal := board[j][i] if string(cellVal) != "." { + // 数字范围已在判断行的循环中校验过,这里无需重复校验 index, _ := strconv.Atoi(string(cellVal)) - if index > 9 || index < 1 { - return false - } if tmp[index] == 1 { return false } diff --git a/leetcode/0036.Valid-Sudoku/36. Valid Sudoku_test.go b/leetcode/0036.Valid-Sudoku/36. Valid Sudoku_test.go index 970ffb34b..e4dc6a2d4 100644 --- a/leetcode/0036.Valid-Sudoku/36. Valid Sudoku_test.go +++ b/leetcode/0036.Valid-Sudoku/36. Valid Sudoku_test.go @@ -22,6 +22,17 @@ type ans36 struct { s bool } +func onlyValidChars(board [][]byte) bool { + for _, row := range board { + for _, c := range row { + if c != '.' && (c < '1' || c > '9') { + return false + } + } + } + return true +} + func Test_Problem36(t *testing.T) { qs := []question36{ @@ -67,14 +78,68 @@ func Test_Problem36(t *testing.T) { {'9', '.', '.', '.', '.', '.', '.', '.', '.'}}}, ans36{true}, }, + + // 行内重复 + { + para36{[][]byte{ + {'5', '5', '.', '.', '7', '.', '.', '.', '.'}, + {'6', '.', '.', '1', '9', '5', '.', '.', '.'}, + {'.', '9', '8', '.', '.', '.', '.', '6', '.'}, + {'8', '.', '.', '.', '6', '.', '.', '.', '3'}, + {'4', '.', '.', '8', '.', '3', '.', '.', '1'}, + {'7', '.', '.', '.', '2', '.', '.', '.', '6'}, + {'.', '6', '.', '.', '.', '.', '2', '8', '.'}, + {'.', '.', '.', '4', '1', '9', '.', '.', '5'}, + {'.', '.', '.', '.', '8', '.', '.', '7', '9'}}}, + ans36{false}, + }, + + // 含非法字符 '0'(index < 1) + { + para36{[][]byte{ + {'0', '3', '.', '.', '7', '.', '.', '.', '.'}, + {'6', '.', '.', '1', '9', '5', '.', '.', '.'}, + {'.', '9', '8', '.', '.', '.', '.', '6', '.'}, + {'8', '.', '.', '.', '6', '.', '.', '.', '3'}, + {'4', '.', '.', '8', '.', '3', '.', '.', '1'}, + {'7', '.', '.', '.', '2', '.', '.', '.', '6'}, + {'.', '6', '.', '.', '.', '.', '2', '8', '.'}, + {'.', '.', '.', '4', '1', '9', '.', '.', '5'}, + {'.', '.', '.', '.', '8', '.', '.', '7', '9'}}}, + ans36{false}, + }, + + // 9宫格内重复(行、列均不重复,仅 3x3 cell 重复) + { + para36{[][]byte{ + {'.', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '5', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '5', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.', '.'}, + {'.', '.', '.', '.', '.', '.', '.', '.', '.'}}}, + ans36{false}, + }, } fmt.Printf("------------------------Leetcode Problem 36------------------------\n") for _, q := range qs { - _, p := q.ans36, q.para36 - fmt.Printf("【input】:%v 【output】:%v\n", p, isValidSudoku1(p.s)) - isValidSudoku(p.s) + a, p := q.ans36, q.para36 + if got2 := isValidSudoku(p.s); got2 != a.s { + t.Fatalf("isValidSudoku(%v) = %v, want %v", p.s, got2, a.s) + } + // isValidSudoku1 仅支持合法字符('.' 或 '1'-'9'),含 '0' 等非法字符会越界 + if onlyValidChars(p.s) { + got := isValidSudoku1(p.s) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.s { + t.Fatalf("isValidSudoku1(%v) = %v, want %v", p.s, got, a.s) + } + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0037.Sudoku-Solver/37. Sudoku Solver_test.go b/leetcode/0037.Sudoku-Solver/37. Sudoku Solver_test.go index d56bd362c..803ee326f 100644 --- a/leetcode/0037.Sudoku-Solver/37. Sudoku Solver_test.go +++ b/leetcode/0037.Sudoku-Solver/37. Sudoku Solver_test.go @@ -58,5 +58,17 @@ func Test_Problem37(t *testing.T) { solveSudoku(p.s) fmt.Printf("【output】:%v \n\n", p) } + + // 直接覆盖 putSudoku 中 *succ 已为 true 时的提前返回分支 + already := true + board := [][]byte{ + {'.', '.'}, + {'.', '.'}, + } + putSudoku(&board, []position{{x: 0, y: 0}}, 0, &already) + if !already { + t.Fatalf("expected succ to remain true") + } + fmt.Printf("\n\n\n") } diff --git a/leetcode/0039.Combination-Sum/39. Combination Sum_test.go b/leetcode/0039.Combination-Sum/39. Combination Sum_test.go index 8b3a3568b..bbad403e2 100644 --- a/leetcode/0039.Combination-Sum/39. Combination Sum_test.go +++ b/leetcode/0039.Combination-Sum/39. Combination Sum_test.go @@ -36,6 +36,11 @@ func Test_Problem39(t *testing.T) { para39{[]int{2, 3, 5}, 8}, ans39{[][]int{{2, 2, 2, 2}, {2, 3, 3}, {3, 5}}}, }, + + { + para39{[]int{}, 7}, + ans39{[][]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 39------------------------\n") diff --git a/leetcode/0040.Combination-Sum-II/40. Combination Sum II_test.go b/leetcode/0040.Combination-Sum-II/40. Combination Sum II_test.go index 8c46b3f70..9a8e711a8 100644 --- a/leetcode/0040.Combination-Sum-II/40. Combination Sum II_test.go +++ b/leetcode/0040.Combination-Sum-II/40. Combination Sum II_test.go @@ -36,6 +36,11 @@ func Test_Problem40(t *testing.T) { para40{[]int{2, 5, 2, 1, 2}, 5}, ans40{[][]int{{1, 2, 2}, {5}}}, }, + + { + para40{[]int{}, 8}, + ans40{[][]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 40------------------------\n") diff --git a/leetcode/0043.Multiply-Strings/43. Multiply Strings_test.go b/leetcode/0043.Multiply-Strings/43. Multiply Strings_test.go index 6017786e0..7f9271be7 100644 --- a/leetcode/0043.Multiply-Strings/43. Multiply Strings_test.go +++ b/leetcode/0043.Multiply-Strings/43. Multiply Strings_test.go @@ -36,13 +36,22 @@ func Test_Problem43(t *testing.T) { para43{"123", "456"}, ans43{"56088"}, }, + + { + para43{"0", "52"}, + ans43{"0"}, + }, } fmt.Printf("------------------------Leetcode Problem 43------------------------\n") for _, q := range qs { - _, p := q.ans43, q.para43 - fmt.Printf("【input】:%v 【output】:%v\n", p, multiply(p.num1, p.num2)) + a, p := q.ans43, q.para43 + got := multiply(p.num1, p.num2) + if got != a.one { + t.Fatalf("multiply(%q, %q) = %q, want %q", p.num1, p.num2, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0045.Jump-Game-II/45. Jump Game II_test.go b/leetcode/0045.Jump-Game-II/45. Jump Game II_test.go index 0e58e91ae..e2ce9a569 100644 --- a/leetcode/0045.Jump-Game-II/45. Jump Game II_test.go +++ b/leetcode/0045.Jump-Game-II/45. Jump Game II_test.go @@ -35,13 +35,27 @@ func Test_Problem45(t *testing.T) { para45{[]int{2, 3, 0, 1, 4}}, ans45{2}, }, + + { + para45{[]int{0}}, + ans45{0}, + }, + + { + para45{[]int{}}, + ans45{0}, + }, } fmt.Printf("------------------------Leetcode Problem 45------------------------\n") for _, q := range qs { - _, p := q.ans45, q.para45 - fmt.Printf("【input】:%v 【output】:%v\n", p, jump(p.nums)) + a, p := q.ans45, q.para45 + got := jump(p.nums) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0046.Permutations/46. Permutations_test.go b/leetcode/0046.Permutations/46. Permutations_test.go index d90a4e9c3..a18826679 100644 --- a/leetcode/0046.Permutations/46. Permutations_test.go +++ b/leetcode/0046.Permutations/46. Permutations_test.go @@ -30,6 +30,11 @@ func Test_Problem46(t *testing.T) { para46{[]int{1, 2, 3}}, ans46{[][]int{{1, 2, 3}, {1, 3, 2}, {2, 1, 3}, {2, 3, 1}, {3, 1, 2}, {3, 2, 1}}}, }, + + { + para46{[]int{}}, + ans46{[][]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 46------------------------\n") diff --git a/leetcode/0047.Permutations-II/47. Permutations II_test.go b/leetcode/0047.Permutations-II/47. Permutations II_test.go index f997b9a9d..6b6f15e0e 100644 --- a/leetcode/0047.Permutations-II/47. Permutations II_test.go +++ b/leetcode/0047.Permutations-II/47. Permutations II_test.go @@ -40,6 +40,11 @@ func Test_Problem47(t *testing.T) { para47{[]int{2, 2, 2}}, ans47{[][]int{{2, 2, 2}}}, }, + + { + para47{[]int{}}, + ans47{[][]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 47------------------------\n") diff --git a/leetcode/0048.Rotate-Image/48. Rotate Image_test.go b/leetcode/0048.Rotate-Image/48. Rotate Image_test.go index 48e30d8bf..940aec59d 100644 --- a/leetcode/0048.Rotate-Image/48. Rotate Image_test.go +++ b/leetcode/0048.Rotate-Image/48. Rotate Image_test.go @@ -35,6 +35,11 @@ func Test_Problem48(t *testing.T) { para48{[][]int{{5, 1, 9, 11}, {2, 4, 8, 10}, {13, 3, 6, 7}, {15, 14, 12, 16}}}, ans48{[][]int{{15, 13, 2, 5}, {14, 3, 4, 1}, {12, 6, 8, 9}, {16, 7, 10, 11}}}, }, + + { + para48{[][]int{{1}}}, + ans48{[][]int{{1}}}, + }, } fmt.Printf("------------------------Leetcode Problem 48------------------------\n") diff --git a/leetcode/0050.Powx-n/50. Pow(x, n)_test.go b/leetcode/0050.Powx-n/50. Pow(x, n)_test.go index 2558a1b66..953281816 100644 --- a/leetcode/0050.Powx-n/50. Pow(x, n)_test.go +++ b/leetcode/0050.Powx-n/50. Pow(x, n)_test.go @@ -41,6 +41,11 @@ func Test_Problem50(t *testing.T) { para50{2.00000, -2}, ans50{0.25000}, }, + + { + para50{2.00000, 0}, + ans50{1.00000}, + }, } fmt.Printf("------------------------Leetcode Problem 50------------------------\n") diff --git a/leetcode/0053.Maximum-Subarray/53. Maximum Subarray_test.go b/leetcode/0053.Maximum-Subarray/53. Maximum Subarray_test.go index 68587e599..4566f0cc0 100644 --- a/leetcode/0053.Maximum-Subarray/53. Maximum Subarray_test.go +++ b/leetcode/0053.Maximum-Subarray/53. Maximum Subarray_test.go @@ -44,6 +44,11 @@ func Test_Problem53(t *testing.T) { para53{[]int{-1, -2}}, ans53{-1}, }, + + { + para53{[]int{}}, + ans53{0}, + }, } fmt.Printf("------------------------Leetcode Problem 53------------------------\n") @@ -51,7 +56,9 @@ func Test_Problem53(t *testing.T) { for _, q := range qs { _, p := q.ans53, q.para53 fmt.Printf("【input】:%v 【output】:%v\n", p, maxSubArray(p.one)) - maxSubArray1(p.one) + if len(p.one) > 0 { + maxSubArray1(p.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go b/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go index 93bb35646..eb7e469ee 100644 --- a/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go +++ b/leetcode/0054.Spiral-Matrix/54. Spiral Matrix.go @@ -35,9 +35,6 @@ func spiralOrder(matrix [][]int) []int { if (x == 0 && y == n-1) || (x == m-1 && y == n-1) || (y == 0 && x == m-1) { round++ } - if x > m-1 || y > n-1 || x < 0 || y < 0 { - return res - } if visit[x][y] == 0 { visit[x][y] = 1 res = append(res, matrix[x][y]) diff --git a/leetcode/0054.Spiral-Matrix/54. Spiral Matrix_test.go b/leetcode/0054.Spiral-Matrix/54. Spiral Matrix_test.go index 29a1492f7..723124509 100644 --- a/leetcode/0054.Spiral-Matrix/54. Spiral Matrix_test.go +++ b/leetcode/0054.Spiral-Matrix/54. Spiral Matrix_test.go @@ -26,6 +26,16 @@ func Test_Problem54(t *testing.T) { qs := []question54{ + { + para54{[][]int{}}, + ans54{[]int{}}, + }, + + { + para54{[][]int{{}}}, + ans54{[]int{}}, + }, + { para54{[][]int{{3}, {2}}}, ans54{[]int{3, 2}}, @@ -49,14 +59,35 @@ func Test_Problem54(t *testing.T) { para54{[][]int{{1, 2, 3, 4}, {5, 6, 7, 8}, {9, 10, 11, 12}}}, ans54{[]int{1, 2, 3, 4, 8, 12, 11, 10, 9, 5, 6, 7}}, }, + { + para54{[][]int{{1, 2, 3, 4}, {5, 6, 7, 8}, {9, 10, 11, 12}, {13, 14, 15, 16}}}, + ans54{[]int{1, 2, 3, 4, 8, 12, 16, 15, 14, 13, 9, 5, 6, 7, 11, 10}}, + }, } fmt.Printf("------------------------Leetcode Problem 54------------------------\n") for _, q := range qs { - _, p := q.ans54, q.para54 - fmt.Printf("【input】:%v 【output】:%v\n", p, spiralOrder(p.one)) - spiralOrder2(p.one) + a, p := q.ans54, q.para54 + got := spiralOrder(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + got2 := spiralOrder2(p.one) + if len(got) != len(a.one) { + t.Fatalf("spiralOrder(%v) = %v, want %v", p.one, got, a.one) + } + for i := range a.one { + if got[i] != a.one[i] { + t.Fatalf("spiralOrder(%v) = %v, want %v", p.one, got, a.one) + } + } + if len(got2) != len(a.one) { + t.Fatalf("spiralOrder2(%v) = %v, want %v", p.one, got2, a.one) + } + for i := range a.one { + if got2[i] != a.one[i] { + t.Fatalf("spiralOrder2(%v) = %v, want %v", p.one, got2, a.one) + } + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0055.Jump-Game/55. Jump Game_test.go b/leetcode/0055.Jump-Game/55. Jump Game_test.go index e4e47e31a..298287dcf 100644 --- a/leetcode/0055.Jump-Game/55. Jump Game_test.go +++ b/leetcode/0055.Jump-Game/55. Jump Game_test.go @@ -34,13 +34,25 @@ func Test_Problem55(t *testing.T) { para55{[]int{3, 2, 1, 0, 4}}, ans55{false}, }, + { + para55{[]int{}}, + ans55{false}, + }, + { + para55{[]int{0}}, + ans55{true}, + }, } fmt.Printf("------------------------Leetcode Problem 55------------------------\n") for _, q := range qs { - _, p := q.ans55, q.para55 - fmt.Printf("【input】:%v 【output】:%v\n", p, canJump(p.one)) + a, p := q.ans55, q.para55 + got := canJump(p.one) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p.one, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0056.Merge-Intervals/56. Merge Intervals_test.go b/leetcode/0056.Merge-Intervals/56. Merge Intervals_test.go index 21047ba94..80e77a87e 100644 --- a/leetcode/0056.Merge-Intervals/56. Merge Intervals_test.go +++ b/leetcode/0056.Merge-Intervals/56. Merge Intervals_test.go @@ -70,5 +70,6 @@ func Test_Problem56(t *testing.T) { } fmt.Printf("\n\n\n") min(0, 1) + min(1, 0) max(0, 1) } diff --git a/leetcode/0058.Length-of-Last-Word/58.Length of Last Word_test.go b/leetcode/0058.Length-of-Last-Word/58.Length of Last Word_test.go index b47de4b7a..c061eb9a8 100644 --- a/leetcode/0058.Length-of-Last-Word/58.Length of Last Word_test.go +++ b/leetcode/0058.Length-of-Last-Word/58.Length of Last Word_test.go @@ -38,13 +38,22 @@ func Test_Problem58(t *testing.T) { para58{"luffy is still joyboy"}, ans58{6}, }, + + { + para58{" "}, + ans58{0}, + }, } fmt.Printf("------------------------Leetcode Problem 58------------------------\n") for _, q := range qs { - _, p := q.ans58, q.para58 - fmt.Printf("【input】:%v 【output】:%v\n", p, lengthOfLastWord(p.s)) + a, p := q.ans58, q.para58 + got := lengthOfLastWord(p.s) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.ans { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.ans, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go b/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go index aa1657f02..8e45f7da4 100644 --- a/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go +++ b/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II.go @@ -25,9 +25,6 @@ func generateMatrix(n int) [][]int { if (x == 0 && y == n-1) || (x == n-1 && y == n-1) || (y == 0 && x == n-1) { round++ } - if x > n-1 || y > n-1 || x < 0 || y < 0 { - return res - } if visit[x][y] == 0 { visit[x][y] = 1 res[x][y] = i + 2 diff --git a/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II_test.go b/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II_test.go index be43c350d..462a15bdc 100644 --- a/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II_test.go +++ b/leetcode/0059.Spiral-Matrix-II/59. Spiral Matrix II_test.go @@ -35,6 +35,21 @@ func Test_Problem59(t *testing.T) { para59{4}, ans59{[][]int{{1, 2, 3, 4}, {12, 13, 14, 5}, {11, 16, 15, 6}, {10, 9, 8, 7}}}, }, + + { + para59{0}, + ans59{[][]int{}}, + }, + + { + para59{1}, + ans59{[][]int{{1}}}, + }, + + { + para59{2}, + ans59{[][]int{{1, 2}, {4, 3}}}, + }, } fmt.Printf("------------------------Leetcode Problem 59------------------------\n") diff --git a/leetcode/0060.Permutation-Sequence/60. Permutation Sequence_test.go b/leetcode/0060.Permutation-Sequence/60. Permutation Sequence_test.go index b9805ed25..073f85589 100644 --- a/leetcode/0060.Permutation-Sequence/60. Permutation Sequence_test.go +++ b/leetcode/0060.Permutation-Sequence/60. Permutation Sequence_test.go @@ -36,13 +36,22 @@ func Test_Problem60(t *testing.T) { para60{4, 9}, ans60{"2314"}, }, + + { + para60{3, 0}, + ans60{""}, + }, } fmt.Printf("------------------------Leetcode Problem 60------------------------\n") for _, q := range qs { - _, p := q.ans60, q.para60 - fmt.Printf("【input】:%v 【output】:%v\n", p, getPermutation(p.n, p.k)) + a, p := q.ans60, q.para60 + got := getPermutation(p.n, p.k) + if got != a.one { + t.Fatalf("input %v expected %v got %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0061.Rotate-List/61. Rotate List_test.go b/leetcode/0061.Rotate-List/61. Rotate List_test.go index 7df9e550d..baa0b193b 100644 --- a/leetcode/0061.Rotate-List/61. Rotate List_test.go +++ b/leetcode/0061.Rotate-List/61. Rotate List_test.go @@ -58,6 +58,11 @@ func Test_Problem61(t *testing.T) { para61{[]int{}, 100}, ans61{[]int{}}, }, + + { + para61{[]int{1, 2, 3, 4, 5}, 5}, + ans61{[]int{1, 2, 3, 4, 5}}, + }, } fmt.Printf("------------------------Leetcode Problem 61------------------------\n") diff --git a/leetcode/0063.Unique-Paths-II/63. Unique Paths II_test.go b/leetcode/0063.Unique-Paths-II/63. Unique Paths II_test.go index e8bf80281..66adbd4e4 100644 --- a/leetcode/0063.Unique-Paths-II/63. Unique Paths II_test.go +++ b/leetcode/0063.Unique-Paths-II/63. Unique Paths II_test.go @@ -52,13 +52,30 @@ func Test_Problem63(t *testing.T) { }}, ans63{0}, }, + + { + para63{[][]int{}}, + ans63{0}, + }, + + { + para63{[][]int{ + {1, 0}, + {0, 0}, + }}, + ans63{0}, + }, } fmt.Printf("------------------------Leetcode Problem 63------------------------\n") for _, q := range qs { - _, p := q.ans63, q.para63 - fmt.Printf("【input】:%v 【output】:%v\n", p, uniquePathsWithObstacles(p.og)) + a, p := q.ans63, q.para63 + got := uniquePathsWithObstacles(p.og) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum_test.go b/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum_test.go index 5cadb6f00..ef7fc058b 100644 --- a/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum_test.go +++ b/leetcode/0064.Minimum-Path-Sum/64. Minimum Path Sum_test.go @@ -22,6 +22,15 @@ type ans64 struct { one int } +func cloneGrid64(g [][]int) [][]int { + c := make([][]int, len(g)) + for i := range g { + c[i] = make([]int, len(g[i])) + copy(c[i], g[i]) + } + return c +} + func Test_Problem64(t *testing.T) { qs := []question64{ @@ -34,14 +43,37 @@ func Test_Problem64(t *testing.T) { }}, ans64{7}, }, + + { + para64{[][]int{}}, + ans64{0}, + }, + + { + para64{[][]int{{}}}, + ans64{0}, + }, } fmt.Printf("------------------------Leetcode Problem 64------------------------\n") for _, q := range qs { - _, p := q.ans64, q.para64 - fmt.Printf("【input】:%v 【output】:%v\n", p, minPathSum(p.og)) - minPathSum1(p.og) + a, p := q.ans64, q.para64 + // minPathSum1 covers the empty/zero-size guard branches + got1 := minPathSum1(cloneGrid64(p.og)) + if got1 != a.one { + t.Fatalf("minPathSum1(%v) = %d, want %d", p.og, got1, a.one) + } + // minPathSum panics on empty grid, so only call it on non-empty input + if len(p.og) > 0 && len(p.og[0]) > 0 { + got := minPathSum(cloneGrid64(p.og)) + if got != a.one { + t.Fatalf("minPathSum(%v) = %d, want %d", p.og, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + } else { + fmt.Printf("【input】:%v 【output】:%v\n", p, got1) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0065.Valid-Number/65. Valid Number_test.go b/leetcode/0065.Valid-Number/65. Valid Number_test.go index 184e1d4ab..556a1c710 100644 --- a/leetcode/0065.Valid-Number/65. Valid Number_test.go +++ b/leetcode/0065.Valid-Number/65. Valid Number_test.go @@ -31,6 +31,21 @@ func Test_Problem65(t *testing.T) { ".1", true, }, + + { + "2e10", + true, + }, + + { + "-90E3", + true, + }, + + { + "+6e-1", + true, + }, } fmt.Printf("------------------------Leetcode Problem 65------------------------\n") diff --git a/leetcode/0067.Add-Binary/67. Add Binary_test.go b/leetcode/0067.Add-Binary/67. Add Binary_test.go index 29adc0cd9..4cc037a3d 100644 --- a/leetcode/0067.Add-Binary/67. Add Binary_test.go +++ b/leetcode/0067.Add-Binary/67. Add Binary_test.go @@ -36,6 +36,11 @@ func Test_Problem67(t *testing.T) { para67{"1010", "1011"}, ans67{"10101"}, }, + + { + para67{"1", "111"}, + ans67{"1000"}, + }, } fmt.Printf("------------------------Leetcode Problem 67------------------------\n") diff --git a/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes_test.go b/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes_test.go index e4b23425d..2b60c50e7 100644 --- a/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes_test.go +++ b/leetcode/0073.Set-Matrix-Zeroes/73. Set Matrix Zeroes_test.go @@ -33,6 +33,20 @@ func Test_Problem73(t *testing.T) { }}, ans73{}, }, + + { + para73{[][]int{ + {1, 2, 3, 4}, + {5, 0, 7, 8}, + {9, 10, 11, 12}, + }}, + ans73{}, + }, + + { + para73{[][]int{}}, + ans73{}, + }, } fmt.Printf("------------------------Leetcode Problem 73------------------------\n") diff --git a/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix_test.go b/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix_test.go index 9bca5b95a..ae2be972b 100644 --- a/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix_test.go +++ b/leetcode/0074.Search-a-2D-Matrix/74. Search a 2D Matrix_test.go @@ -36,6 +36,11 @@ func Test_Problem74(t *testing.T) { para74{[][]int{{1, 3, 5, 7}, {10, 11, 16, 20}, {23, 30, 34, 50}}, 13}, ans74{false}, }, + + { + para74{[][]int{}, 1}, + ans74{false}, + }, } fmt.Printf("------------------------Leetcode Problem 74------------------------\n") diff --git a/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring_test.go b/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring_test.go index 95076c7a6..6e158d2e7 100644 --- a/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring_test.go +++ b/leetcode/0076.Minimum-Window-Substring/76. Minimum Window Substring_test.go @@ -41,13 +41,22 @@ func Test_Problem76(t *testing.T) { para76{"a", "a"}, ans76{"a"}, }, + + { + para76{"", "a"}, + ans76{""}, + }, } fmt.Printf("------------------------Leetcode Problem 76------------------------\n") for _, q := range qs { - _, p := q.ans76, q.para76 - fmt.Printf("【input】:%v 【output】:%v\n\n\n", p, minWindow(p.s, p.p)) + a, p := q.ans76, q.para76 + got := minWindow(p.s, p.p) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n\n\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0077.Combinations/77. Combinations_test.go b/leetcode/0077.Combinations/77. Combinations_test.go index 4d1a14f38..5205c80ff 100644 --- a/leetcode/0077.Combinations/77. Combinations_test.go +++ b/leetcode/0077.Combinations/77. Combinations_test.go @@ -31,6 +31,10 @@ func Test_Problem77(t *testing.T) { para77{4, 2}, ans77{[][]int{{2, 4}, {3, 4}, {2, 3}, {1, 2}, {1, 3}, {1, 4}}}, }, + { + para77{0, 0}, + ans77{[][]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 77------------------------\n") diff --git a/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II_test.go b/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II_test.go index ba089f42d..aa80a6bfe 100644 --- a/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II_test.go +++ b/leetcode/0081.Search-in-Rotated-Sorted-Array-II/81. Search in Rotated Sorted Array II_test.go @@ -36,13 +36,52 @@ func Test_Problem81(t *testing.T) { para81{[]int{2, 5, 6, 0, 0, 1, 2}, 3}, ans81{false}, }, + + { + para81{[]int{}, 1}, + ans81{false}, + }, + + { + para81{[]int{1, 0, 1, 1, 1}, 0}, + ans81{true}, + }, + + { + para81{[]int{1, 1, 1, 0, 1}, 0}, + ans81{true}, + }, + + { + para81{[]int{4, 5, 6, 7, 0, 1, 2}, 6}, + ans81{true}, + }, + + { + para81{[]int{4, 5, 6, 7, 0, 1, 2}, 0}, + ans81{true}, + }, + + { + para81{[]int{4, 5, 6, 7, 0, 1, 2}, 3}, + ans81{false}, + }, + + { + para81{[]int{6, 7, 0, 1, 2}, 2}, + ans81{true}, + }, } fmt.Printf("------------------------Leetcode Problem 81------------------------\n") for _, q := range qs { - _, p := q.ans81, q.para81 - fmt.Printf("【input】:%v 【output】:%v\n", p, search(p.nums, p.target)) + a, p := q.ans81, q.para81 + got := search(p.nums, p.target) + if got != a.one { + t.Fatalf("input: %v target: %v, expected: %v, got: %v", p.nums, p.target, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II_test.go b/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II_test.go index f330495ff..d560dfaf9 100644 --- a/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II_test.go +++ b/leetcode/0082.Remove-Duplicates-from-Sorted-List-II/82. Remove Duplicates from Sorted List II_test.go @@ -82,6 +82,7 @@ func Test_Problem82(t *testing.T) { deleteDuplicates2(structures.Ints2List(p.one)) deleteDuplicates3(structures.Ints2List(p.one)) deleteDuplicates4(structures.Ints2List(p.one)) + deleteDuplicates(structures.Ints2List(p.one)) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List_test.go b/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List_test.go index 2feb9fee6..db1b9f6b3 100644 --- a/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List_test.go +++ b/leetcode/0083.Remove-Duplicates-from-Sorted-List/83. Remove Duplicates from Sorted List_test.go @@ -42,6 +42,16 @@ func Test_Problem83(t *testing.T) { para83{[]int{1, 1, 1, 1, 1, 1, 1, 1}}, ans83{[]int{1}}, }, + + { + para83{[]int{}}, + ans83{[]int{}}, + }, + + { + para83{[]int{1}}, + ans83{[]int{1}}, + }, } fmt.Printf("------------------------Leetcode Problem 83------------------------\n") diff --git a/leetcode/0086.Partition-List/86. Partition List_test.go b/leetcode/0086.Partition-List/86. Partition List_test.go index 3b8b1bc59..5278c4315 100644 --- a/leetcode/0086.Partition-List/86. Partition List_test.go +++ b/leetcode/0086.Partition-List/86. Partition List_test.go @@ -63,6 +63,11 @@ func Test_Problem86(t *testing.T) { para86{[]int{1, 2}, 3}, ans86{[]int{1, 2}}, }, + + { + para86{[]int{}, 3}, + ans86{[]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 86------------------------\n") diff --git a/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses_test.go b/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses_test.go index 143b9892e..2b15dac1d 100644 --- a/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses_test.go +++ b/leetcode/0093.Restore-IP-Addresses/93. Restore IP Addresses_test.go @@ -40,6 +40,11 @@ func Test_Problem93(t *testing.T) { para93{"010010"}, ans93{[]string{"0.10.0.10", "0.100.1.0"}}, }, + + { + para93{""}, + ans93{[]string{}}, + }, } fmt.Printf("------------------------Leetcode Problem 93------------------------\n") diff --git a/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II_test.go b/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II_test.go index 3cac732d5..e0ba21951 100644 --- a/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II_test.go +++ b/leetcode/0095.Unique-Binary-Search-Trees-II/95. Unique Binary Search Trees II_test.go @@ -28,6 +28,11 @@ func Test_Problem95(t *testing.T) { qs := []question95{ + { + para95{0}, + ans95{[]*TreeNode{}}, + }, + { para95{1}, ans95{[]*TreeNode{{Val: 1, Left: nil, Right: nil}}}, diff --git a/leetcode/0097.Interleaving-String/97. Interleaving String_test.go b/leetcode/0097.Interleaving-String/97. Interleaving String_test.go index 20ee4e78d..41428709d 100644 --- a/leetcode/0097.Interleaving-String/97. Interleaving String_test.go +++ b/leetcode/0097.Interleaving-String/97. Interleaving String_test.go @@ -42,13 +42,22 @@ func Test_Problem97(t *testing.T) { para97{"", "", ""}, ans97{true}, }, + + { + para97{"abc", "de", "abcd"}, + ans97{false}, + }, } fmt.Printf("------------------------Leetcode Problem 97------------------------\n") for _, q := range qs { - _, p := q.ans97, q.para97 - fmt.Printf("【input】:%v 【output】:%v\n", p, isInterleave(p.s1, p.s2, p.s3)) + a, p := q.ans97, q.para97 + got := isInterleave(p.s1, p.s2, p.s3) + if got != a.one { + t.Fatalf("input:%v expected:%v got:%v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree_test.go b/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree_test.go index a3ef5e1ea..ccb1d8827 100644 --- a/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree_test.go +++ b/leetcode/0104.Maximum-Depth-of-Binary-Tree/104. Maximum Depth of Binary Tree_test.go @@ -37,15 +37,24 @@ func Test_Problem104(t *testing.T) { para104{[]int{3, 9, 20, structures.NULL, structures.NULL, 15, 7}}, ans104{3}, }, + + { + para104{[]int{1, 2, 3, 4, structures.NULL, structures.NULL, structures.NULL, 5}}, + ans104{4}, + }, } fmt.Printf("------------------------Leetcode Problem 104------------------------\n") for _, q := range qs { - _, p := q.ans104, q.para104 + a, p := q.ans104, q.para104 fmt.Printf("【input】:%v ", p) root := structures.Ints2TreeNode(p.one) - fmt.Printf("【output】:%v \n", maxDepth(root)) + got := maxDepth(root) + fmt.Printf("【output】:%v \n", got) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p.one, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go b/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go index 8edf22873..3c8ca80dc 100644 --- a/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go +++ b/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree.go @@ -35,9 +35,6 @@ func sortedListToBST(head *ListNode) *TreeNode { return &TreeNode{Val: head.Val, Left: nil, Right: nil} } middleNode, preNode := middleNodeAndPreNode(head) - if middleNode == nil { - return nil - } if preNode != nil { preNode.Next = nil } diff --git a/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree_test.go b/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree_test.go index 06f7f323b..ad769d496 100644 --- a/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree_test.go +++ b/leetcode/0109.Convert-Sorted-List-to-Binary-Search-Tree/109. Convert Sorted List to Binary Search Tree_test.go @@ -57,5 +57,14 @@ func Test_Problem109(t *testing.T) { structures.T2s(sortedListToBST(structures.Ints2List(p.one)), &arr) fmt.Printf("【input】:%v 【output】:%v\n", p, arr) } + + // cover middleNodeAndPreNode guard branch (nil and single-node inputs) + if m, pre := middleNodeAndPreNode(nil); m != nil || pre != nil { + t.Fatalf("middleNodeAndPreNode(nil) = %v, %v, want nil, nil", m, pre) + } + single := structures.Ints2List([]int{42}) + if m, pre := middleNodeAndPreNode(single); m != nil || pre != single { + t.Fatalf("middleNodeAndPreNode(single) = %v, %v, want nil, single", m, pre) + } fmt.Printf("\n\n\n") } diff --git a/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree_test.go b/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree_test.go index a2a3753d9..4da46e569 100644 --- a/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree_test.go +++ b/leetcode/0111.Minimum-Depth-of-Binary-Tree/111. Minimum Depth of Binary Tree_test.go @@ -47,6 +47,11 @@ func Test_Problem111(t *testing.T) { para111{[]int{1, 2}}, ans111{2}, }, + + { + para111{[]int{1, 2, 3, 4}}, + ans111{2}, + }, } fmt.Printf("------------------------Leetcode Problem 111------------------------\n") diff --git a/leetcode/0113.Path-Sum-II/113. Path Sum II_test.go b/leetcode/0113.Path-Sum-II/113. Path Sum II_test.go index e2aa53836..db181744a 100644 --- a/leetcode/0113.Path-Sum-II/113. Path Sum II_test.go +++ b/leetcode/0113.Path-Sum-II/113. Path Sum II_test.go @@ -2,6 +2,7 @@ package leetcode import ( "fmt" + "reflect" "testing" "github.com/halfrost/LeetCode-Go/structures" @@ -42,6 +43,11 @@ func Test_Problem113(t *testing.T) { para113{[]int{5, 4, 8, 11, structures.NULL, 13, 4, 7, 2, structures.NULL, structures.NULL, 5, 1}, 22}, ans113{[][]int{{5, 4, 11, 2}, {5, 8, 4, 5}}}, }, + + { + para113{[]int{5}, 5}, + ans113{[][]int{{5}}}, + }, } fmt.Printf("------------------------Leetcode Problem 113------------------------\n") @@ -51,7 +57,14 @@ func Test_Problem113(t *testing.T) { fmt.Printf("【input】:%v ", p) root := structures.Ints2TreeNode(p.one) fmt.Printf("【output】:%v \n", pathSum(root, p.sum)) - pathSum1(root, p.sum) + root1 := structures.Ints2TreeNode(p.one) + got1 := pathSum1(root1, p.sum) + if len(p.one) > 0 { + want1 := pathSum(structures.Ints2TreeNode(p.one), p.sum) + if !reflect.DeepEqual(got1, want1) { + t.Fatalf("pathSum1(%v, %d) = %v, want %v", p.one, p.sum, got1, want1) + } + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List_test.go b/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List_test.go index 50d7ed8e2..6977bef0a 100644 --- a/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List_test.go +++ b/leetcode/0114.Flatten-Binary-Tree-to-Linked-List/114. Flatten Binary Tree to Linked List_test.go @@ -42,6 +42,11 @@ func Test_Problem114(t *testing.T) { para114{[]string{"1", "2", "3", "4", "5", "6"}}, ans114{[]string{"1", "2", "4", "5", "3", "6", "null"}}, }, + + { + para114{[]string{}}, + ans114{[]string{}}, + }, } fmt.Printf("------------------------Leetcode Problem 114------------------------\n") @@ -51,8 +56,20 @@ func Test_Problem114(t *testing.T) { fmt.Printf("【input】:%v \n", p) rootOne := structures.Strings2TreeNode(p.one) flatten(rootOne) - flatten1(rootOne) - flatten2(rootOne) + want := structures.Tree2PreOrderStrings(rootOne) + + root1 := structures.Strings2TreeNode(p.one) + flatten1(root1) + if got := structures.Tree2PreOrderStrings(root1); fmt.Sprintf("%v", got) != fmt.Sprintf("%v", want) { + t.Fatalf("flatten1 mismatch: got %v, want %v", got, want) + } + + root2 := structures.Strings2TreeNode(p.one) + flatten2(root2) + if got := structures.Tree2PreOrderStrings(root2); fmt.Sprintf("%v", got) != fmt.Sprintf("%v", want) { + t.Fatalf("flatten2 mismatch: got %v, want %v", got, want) + } + fmt.Printf("【levelorder output】:%v \n", structures.Tree2LevelOrderStrings(rootOne)) fmt.Printf("【preorder output】:%v \n", structures.Tree2PreOrderStrings(rootOne)) } diff --git a/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences_test.go b/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences_test.go index 5f619544e..3a2dd6b2d 100644 --- a/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences_test.go +++ b/leetcode/0115.Distinct-Subsequences/115. Distinct Subsequences_test.go @@ -36,14 +36,21 @@ func Test_Problem115(t *testing.T) { para115{"babgbag", "bag"}, ans115{5}, }, + + { + para115{"ab", "abc"}, + ans115{0}, + }, } fmt.Printf("------------------------Leetcode Problem 115------------------------\n") for _, q := range qs { - _, p := q.ans115, q.para115 + a, p := q.ans115, q.para115 fmt.Printf("【input】:%v 【output】:%v\n", p, numDistinct(p.s, p.t)) - numDistinct1(p.s, p.t) + if got := numDistinct1(p.s, p.t); got != a.one { + t.Fatalf("numDistinct1(%q, %q) = %d, want %d", p.s, p.t, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node_test.go b/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node_test.go index ee08bd9df..e573aa394 100644 --- a/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node_test.go +++ b/leetcode/0116.Populating-Next-Right-Pointers-in-Each-Node/116.Populating Next Right Pointers in Each Node_test.go @@ -104,6 +104,10 @@ func Test_Problem116(t *testing.T) { para116{newQuestionNode()}, ans116{newResultNode()}, }, + { + para116{nil}, + ans116{nil}, + }, } fmt.Printf("------------------------Leetcode Problem 116------------------------\n") diff --git a/leetcode/0120.Triangle/120. Triangle_test.go b/leetcode/0120.Triangle/120. Triangle_test.go index fc81fe957..8c0b7186b 100644 --- a/leetcode/0120.Triangle/120. Triangle_test.go +++ b/leetcode/0120.Triangle/120. Triangle_test.go @@ -22,6 +22,17 @@ type ans120 struct { one int } +func clone120(triangle [][]int) [][]int { + if triangle == nil { + return nil + } + res := make([][]int, len(triangle)) + for i, row := range triangle { + res[i] = append([]int(nil), row...) + } + return res +} + func Test_Problem120(t *testing.T) { qs := []question120{ @@ -29,14 +40,29 @@ func Test_Problem120(t *testing.T) { para120{[][]int{{2}, {3, 4}, {6, 5, 7}, {4, 1, 8, 3}}}, ans120{11}, }, + { + para120{nil}, + ans120{0}, + }, + { + para120{[][]int{{-10}}}, + ans120{-10}, + }, } fmt.Printf("------------------------Leetcode Problem 120------------------------\n") for _, q := range qs { - _, p := q.ans120, q.para120 - fmt.Printf("【input】:%v 【output】:%v\n", p, minimumTotal(p.one)) - minimumTotal1(p.one) + a, p := q.ans120, q.para120 + got := minimumTotal(clone120(p.one)) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("minimumTotal(%v) = %v, want %v", p.one, got, a.one) + } + got1 := minimumTotal1(clone120(p.one)) + if got1 != a.one { + t.Fatalf("minimumTotal1(%v) = %v, want %v", p.one, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0126.Word-Ladder-II/126. Word Ladder II_test.go b/leetcode/0126.Word-Ladder-II/126. Word Ladder II_test.go index 7859a7b36..58dc3508e 100644 --- a/leetcode/0126.Word-Ladder-II/126. Word Ladder II_test.go +++ b/leetcode/0126.Word-Ladder-II/126. Word Ladder II_test.go @@ -36,6 +36,12 @@ func Test_Problem126(t *testing.T) { para126{"hit", "cog", []string{"hot", "dot", "dog", "lot", "log"}}, ans126{[][]string{}}, }, + + { + // endWord is in wordList but unreachable, exercises the final return + para126{"hit", "cog", []string{"cog", "xyz"}}, + ans126{[][]string{}}, + }, } fmt.Printf("------------------------Leetcode Problem 126------------------------\n") diff --git a/leetcode/0130.Surrounded-Regions/130. Surrounded Regions_test.go b/leetcode/0130.Surrounded-Regions/130. Surrounded Regions_test.go index 120f51d58..97ad5da85 100644 --- a/leetcode/0130.Surrounded-Regions/130. Surrounded Regions_test.go +++ b/leetcode/0130.Surrounded-Regions/130. Surrounded Regions_test.go @@ -2,9 +2,19 @@ package leetcode import ( "fmt" + "reflect" "testing" ) +func clone130(board [][]byte) [][]byte { + res := make([][]byte, len(board)) + for i := range board { + res[i] = make([]byte, len(board[i])) + copy(res[i], board[i]) + } + return res +} + type question130 struct { para130 ans130 @@ -35,16 +45,29 @@ func Test_Problem130(t *testing.T) { para130{[][]byte{{'X', 'X', 'X', 'X'}, {'X', 'O', 'O', 'X'}, {'X', 'X', 'O', 'X'}, {'X', 'O', 'X', 'X'}}}, ans130{[][]byte{{'X', 'X', 'X', 'X'}, {'X', 'X', 'X', 'X'}, {'X', 'X', 'X', 'X'}, {'X', 'O', 'X', 'X'}}}, }, + + { + para130{[][]byte{{'O', 'O', 'O'}, {'O', 'O', 'O'}, {'O', 'O', 'O'}}}, + ans130{[][]byte{{'O', 'O', 'O'}, {'O', 'O', 'O'}, {'O', 'O', 'O'}}}, + }, } fmt.Printf("------------------------Leetcode Problem 130------------------------\n") for _, q := range qs { - _, p := q.ans130, q.para130 + a, p := q.ans130, q.para130 fmt.Printf("【input】:%v ", p) - solve1(p.one) - solve(p.one) - fmt.Printf("【output】:%v \n", p) + b1 := clone130(p.one) + solve1(b1) + b2 := clone130(p.one) + solve(b2) + if !reflect.DeepEqual(b1, b2) { + t.Fatalf("solve and solve1 differ: solve1=%v solve=%v", b1, b2) + } + if len(a.one) != 0 && !reflect.DeepEqual(b2, a.one) { + t.Fatalf("got %v, want %v", b2, a.one) + } + fmt.Printf("【output】:%v \n", b2) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning_test.go b/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning_test.go index c22681f23..b0366e7ee 100644 --- a/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning_test.go +++ b/leetcode/0131.Palindrome-Partitioning/131. Palindrome Partitioning_test.go @@ -45,6 +45,11 @@ func Test_Problem131(t *testing.T) { para131{"abbab"}, ans131{[][]string{{"a", "b", "b", "a", "b"}, {"a", "b", "bab"}, {"a", "bb", "a", "b"}, {"abba", "b"}}}, }, + + { + para131{""}, + ans131{[][]string{}}, + }, } fmt.Printf("------------------------Leetcode Problem 131------------------------\n") diff --git a/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle_test.go b/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle_test.go index 06bf230fd..17e9cbe60 100644 --- a/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle_test.go +++ b/leetcode/0141.Linked-List-Cycle/141. Linked List Cycle_test.go @@ -16,6 +16,7 @@ type question141 struct { // one 代表第一个参数 type para141 struct { one []int + pos int } // ans 是答案 @@ -29,26 +30,46 @@ func Test_Problem141(t *testing.T) { qs := []question141{ { - para141{[]int{3, 2, 0, -4}}, + para141{[]int{3, 2, 0, -4}, -1}, ans141{false}, }, { - para141{[]int{1, 2}}, + para141{[]int{1, 2}, -1}, ans141{false}, }, { - para141{[]int{1}}, + para141{[]int{1}, -1}, ans141{false}, }, + + { + para141{[]int{3, 2, 0, -4}, 1}, + ans141{true}, + }, + + { + para141{[]int{1, 2}, 0}, + ans141{true}, + }, } fmt.Printf("------------------------Leetcode Problem 141------------------------\n") for _, q := range qs { - _, p := q.ans141, q.para141 - fmt.Printf("【input】:%v 【output】:%v\n", p, hasCycle(structures.Ints2List(p.one))) + a, p := q.ans141, q.para141 + var head *ListNode + if p.pos >= 0 { + head = structures.Ints2ListWithCycle(p.one, p.pos) + } else { + head = structures.Ints2List(p.one) + } + got := hasCycle(head) + if got != a.one { + t.Fatalf("input: %v pos: %v, expected: %v, got: %v", p.one, p.pos, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II_test.go b/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II_test.go index 8f1aa500f..442a6c867 100644 --- a/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II_test.go +++ b/leetcode/0142.Linked-List-Cycle-II/142. Linked List Cycle II_test.go @@ -1,6 +1,67 @@ package leetcode -import "testing" +import ( + "fmt" + "testing" + + "github.com/halfrost/LeetCode-Go/structures" +) + +type question142 struct { + para142 + ans142 +} + +type para142 struct { + nums []int + pos int +} + +type ans142 struct { + hasCycle bool + val int +} func Test_Problem142(t *testing.T) { + qs := []question142{ + { + para142{[]int{3, 2, 0, -4}, 1}, + ans142{true, 2}, + }, + { + para142{[]int{1, 2}, 0}, + ans142{true, 1}, + }, + { + para142{[]int{1}, -1}, + ans142{false, 0}, + }, + { + para142{[]int{1, 2, 3}, -1}, + ans142{false, 0}, + }, + { + para142{[]int{}, -1}, + ans142{false, 0}, + }, + } + + for _, q := range qs { + a, p := q.ans142, q.para142 + head := structures.Ints2ListWithCycle(p.nums, p.pos) + node := detectCycle(head) + fmt.Printf("nums = %v pos = %v node = %v\n", p.nums, p.pos, node) + if a.hasCycle { + if node == nil { + t.Fatalf("expected cycle entry node with val %d, got nil", a.val) + } + if node.Val != a.val { + t.Fatalf("expected cycle entry val %d, got %d", a.val, node.Val) + } + } else { + if node != nil { + t.Fatalf("expected no cycle (nil), got node with val %d", node.Val) + } + } + } } diff --git a/leetcode/0146.LRU-Cache/146. LRU Cache_test.go b/leetcode/0146.LRU-Cache/146. LRU Cache_test.go index 9d8d16047..56bed9874 100644 --- a/leetcode/0146.LRU-Cache/146. LRU Cache_test.go +++ b/leetcode/0146.LRU-Cache/146. LRU Cache_test.go @@ -26,6 +26,26 @@ func Test_Problem146(t *testing.T) { fmt.Printf("param_1 = %v obj = %v\n", param1, MList2Ints(&obj)) param1 = obj.Get(4) fmt.Printf("param_1 = %v obj = %v\n", param1, MList2Ints(&obj)) + + // Exercise the update-existing-key path in Put (lines 28-33), + // the Remove-head branch and the Remove-middle branch. + obj2 := Constructor(3) + obj2.Put(1, 1) + obj2.Put(2, 2) + obj2.Put(3, 3) + // Update existing key 2 -> triggers Put's "key exists" branch and + // removes a middle node, then re-adds it at the head. + obj2.Put(2, 20) + if v := obj2.Get(2); v != 20 { + t.Fatalf("expected Get(2)=20, got %v", v) + } + fmt.Printf("obj2 = %v\n", MList2Ints(&obj2)) + // Update the current head key to exercise Remove-head branch. + obj2.Put(2, 200) + if v := obj2.Get(2); v != 200 { + t.Fatalf("expected Get(2)=200, got %v", v) + } + fmt.Printf("obj2 = %v\n", MList2Ints(&obj2)) } func MList2Ints(lru *LRUCache) [][]int { diff --git a/leetcode/0148.Sort-List/148. Sort List_test.go b/leetcode/0148.Sort-List/148. Sort List_test.go index 11258c23e..7d90e7ce4 100644 --- a/leetcode/0148.Sort-List/148. Sort List_test.go +++ b/leetcode/0148.Sort-List/148. Sort List_test.go @@ -54,5 +54,14 @@ func Test_Problem148(t *testing.T) { _, p := q.ans148, q.para148 fmt.Printf("【input】:%v 【output】:%v\n", p, structures.List2Ints(sortList(structures.Ints2List(p.one)))) } + + // cover middleNode guard branch: nil and single-node inputs + if middleNode(nil) != nil { + t.Fatalf("middleNode(nil) should return nil") + } + single := structures.Ints2List([]int{1}) + if middleNode(single) != single { + t.Fatalf("middleNode(single) should return the same node") + } fmt.Printf("\n\n\n") } diff --git a/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation_test.go b/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation_test.go index 55fb44761..eb86b13db 100644 --- a/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation_test.go +++ b/leetcode/0150.Evaluate-Reverse-Polish-Notation/150. Evaluate Reverse Polish Notation_test.go @@ -44,6 +44,10 @@ func Test_Problem150(t *testing.T) { para150{[]string{"10", "6", "9", "3", "+", "-11", "*", "/", "*", "17", "+", "5", "+"}}, ans150{22}, }, + { + para150{[]string{"5", "2", "-"}}, + ans150{3}, + }, } fmt.Printf("------------------------Leetcode Problem 150------------------------\n") diff --git a/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array_test.go b/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array_test.go index cf192e7c3..88c508d67 100644 --- a/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array_test.go +++ b/leetcode/0153.Find-Minimum-in-Rotated-Sorted-Array/153. Find Minimum in Rotated Sorted Array_test.go @@ -65,15 +65,33 @@ func Test_Problem153(t *testing.T) { para153{[]int{4, 5, 6, 7, 0, 1, 2}}, ans153{0}, }, + + { + para153{[]int{3, 3, 1, 3}}, + ans153{1}, + }, } fmt.Printf("------------------------Leetcode Problem 153------------------------\n") for _, q := range qs { - _, p := q.ans153, q.para153 + a, p := q.ans153, q.para153 fmt.Printf("【input】:%v 【output】:%v\n", p, findMin(p.nums)) - findMin1(p.nums) - findMin2(p.nums) + if got := findMin1(p.nums); got != a.one { + t.Fatalf("findMin1(%v) = %v, want %v", p.nums, got, a.one) + } + if got := findMin2(p.nums); got != a.one { + t.Fatalf("findMin2(%v) = %v, want %v", p.nums, got, a.one) + } + } + + // 覆盖 findMin1 的空输入分支 + if got := findMin1([]int{}); got != 0 { + t.Fatalf("findMin1([]) = %v, want 0", got) + } + // 覆盖 findMin1 全相等输入的兜底分支(题目保证元素唯一,此为非法输入) + if got := findMin1([]int{2, 2, 2}); got != -1 { + t.Fatalf("findMin1([2,2,2]) = %v, want -1", got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0162.Find-Peak-Element/162. Find Peak Element_test.go b/leetcode/0162.Find-Peak-Element/162. Find Peak Element_test.go index 2c024872d..b08721c9e 100644 --- a/leetcode/0162.Find-Peak-Element/162. Find Peak Element_test.go +++ b/leetcode/0162.Find-Peak-Element/162. Find Peak Element_test.go @@ -60,13 +60,22 @@ func Test_Problem162(t *testing.T) { para162{[]int{1, 2, 1, 3, 5, 6, 4}}, ans162{5}, }, + + { + para162{[]int{1, 1}}, + ans162{-1}, + }, } fmt.Printf("------------------------Leetcode Problem 162------------------------\n") for _, q := range qs { - _, p := q.ans162, q.para162 - fmt.Printf("【input】:%v 【output】:%v\n", p, findPeakElement(p.one)) + a, p := q.ans162, q.para162 + got := findPeakElement(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("findPeakElement(%v) = %d, want %d", p.one, got, a.one) + } findPeakElement1(p.one) } fmt.Printf("\n\n\n") diff --git a/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted_test.go b/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted_test.go index ce8228e99..36e3f96f3 100644 --- a/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted_test.go +++ b/leetcode/0167.Two-Sum-II-Input-array-is-sorted/167. Two Sum II - Input array is sorted_test.go @@ -31,14 +31,31 @@ func Test_Problem167(t *testing.T) { para167{[]int{2, 7, 11, 15}, 9}, ans167{[]int{1, 2}}, }, + // 命中 j-- 分支:初始 numbers[i]+numbers[j] > target + { + para167{[]int{2, 3, 4}, 6}, + ans167{[]int{1, 3}}, + }, + // 无解:覆盖 return nil 分支 + { + para167{[]int{1, 2, 3}, 100}, + ans167{nil}, + }, } fmt.Printf("------------------------Leetcode Problem 167------------------------\n") for _, q := range qs { - _, p := q.ans167, q.para167 - fmt.Printf("【input】:%v 【output】:%v\n", p.one, twoSum167(p.one, p.two)) - twoSum167_1(p.one, p.two) + a, p := q.ans167, q.para167 + got := twoSum167(p.one, p.two) + fmt.Printf("【input】:%v 【output】:%v\n", p.one, got) + if fmt.Sprintf("%v", got) != fmt.Sprintf("%v", a.one) { + t.Fatalf("twoSum167(%v, %v) = %v, want %v", p.one, p.two, got, a.one) + } + got1 := twoSum167_1(p.one, p.two) + if fmt.Sprintf("%v", got1) != fmt.Sprintf("%v", a.one) { + t.Fatalf("twoSum167_1(%v, %v) = %v, want %v", p.one, p.two, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0169.Majority-Element/169. Majority Element_test.go b/leetcode/0169.Majority-Element/169. Majority Element_test.go index 9af5d0a58..a9f3232f9 100644 --- a/leetcode/0169.Majority-Element/169. Majority Element_test.go +++ b/leetcode/0169.Majority-Element/169. Majority Element_test.go @@ -50,9 +50,20 @@ func Test_Problem169(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 169------------------------\n") for _, q := range qs { - _, p := q.ans169, q.para169 - fmt.Printf("【input】:%v 【output】:%v\n", p, majorityElement(p.s)) - majorityElement1(p.s) + a, p := q.ans169, q.para169 + got := majorityElement(p.s) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("majorityElement(%v) = %v, want %v", p.s, got, a.one) + } + if got1 := majorityElement1(p.s); got1 != a.one { + t.Fatalf("majorityElement1(%v) = %v, want %v", p.s, got1, a.one) + } + } + + // 当不存在多数元素时(例如空切片),解法二返回 0 + if got := majorityElement1([]int{}); got != 0 { + t.Fatalf("majorityElement1([]) = %v, want 0", got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0174.Dungeon-Game/174. Dungeon Game_test.go b/leetcode/0174.Dungeon-Game/174. Dungeon Game_test.go index b41aadaa2..bf04b6180 100644 --- a/leetcode/0174.Dungeon-Game/174. Dungeon Game_test.go +++ b/leetcode/0174.Dungeon-Game/174. Dungeon Game_test.go @@ -50,9 +50,15 @@ func Test_Problem174(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 174------------------------\n") for _, q := range qs { - _, p := q.ans174, q.para174 + a, p := q.ans174, q.para174 fmt.Printf("【input】:%v 【output】:%v\n", p, calculateMinimumHP1(p.s)) - calculateMinimumHP(p.s) + if got := calculateMinimumHP(p.s); got != a.one { + t.Fatalf("calculateMinimumHP(%v) = %d, want %d", p.s, got, a.one) + } + } + + if got := calculateMinimumHP([][]int{}); got != 0 { + t.Fatalf("calculateMinimumHP(empty) = %d, want 0", got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences_test.go b/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences_test.go index 8c2858652..901319b56 100644 --- a/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences_test.go +++ b/leetcode/0187.Repeated-DNA-Sequences/187. Repeated DNA Sequences_test.go @@ -30,6 +30,10 @@ func Test_Problem187(t *testing.T) { para187{"AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"}, ans187{[]string{"AAAAACCCCC", "CCCCCAAAAA"}}, }, + { + para187{"AAAAA"}, + ans187{[]string{}}, + }, } fmt.Printf("------------------------Leetcode Problem 187------------------------\n") diff --git a/leetcode/0198.House-Robber/198. House Robber_test.go b/leetcode/0198.House-Robber/198. House Robber_test.go index f6a8e3c51..d25ac7dc2 100644 --- a/leetcode/0198.House-Robber/198. House Robber_test.go +++ b/leetcode/0198.House-Robber/198. House Robber_test.go @@ -26,6 +26,16 @@ func Test_Problem198(t *testing.T) { qs := []question198{ + { + para198{[]int{}}, + ans198{0}, + }, + + { + para198{[]int{5}}, + ans198{5}, + }, + { para198{[]int{1, 2}}, ans198{2}, @@ -44,10 +54,17 @@ func Test_Problem198(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 198------------------------\n") for _, q := range qs { - _, p := q.ans198, q.para198 + a, p := q.ans198, q.para198 fmt.Printf("【input】:%v 【output】:%v\n", p, rob198(p.one)) - rob(p.one) - rob198_1(p.one) + if got := rob198(p.one); got != a.one { + t.Fatalf("rob198(%v) = %v, want %v", p.one, got, a.one) + } + if got := rob(p.one); got != a.one { + t.Fatalf("rob(%v) = %v, want %v", p.one, got, a.one) + } + if got := rob198_1(p.one); got != a.one { + t.Fatalf("rob198_1(%v) = %v, want %v", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0200.Number-of-Islands/200. Number of Islands_test.go b/leetcode/0200.Number-of-Islands/200. Number of Islands_test.go index 8c16ac76b..cbb248c26 100644 --- a/leetcode/0200.Number-of-Islands/200. Number of Islands_test.go +++ b/leetcode/0200.Number-of-Islands/200. Number of Islands_test.go @@ -45,13 +45,27 @@ func Test_Problem200(t *testing.T) { }}, ans200{3}, }, + + { + para200{[][]byte{}}, + ans200{0}, + }, + + { + para200{[][]byte{{}}}, + ans200{0}, + }, } fmt.Printf("------------------------Leetcode Problem 200------------------------\n") for _, q := range qs { - _, p := q.ans200, q.para200 - fmt.Printf("【input】:%v 【output】:%v\n", p, numIslands(p.one)) + a, p := q.ans200, q.para200 + out := numIslands(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, out) + if out != a.one { + t.Fatalf("input %v expected %v got %v", p, a.one, out) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings_test.go b/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings_test.go index d18c1f43d..472daae53 100644 --- a/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings_test.go +++ b/leetcode/0205.Isomorphic-Strings/205. Isomorphic Strings_test.go @@ -46,6 +46,16 @@ func Test_Problem205(t *testing.T) { para205{"", ""}, ans205{true}, }, + + { + para205{"ab", "aa"}, + ans205{false}, + }, + + { + para205{"ab", "a"}, + ans205{false}, + }, } fmt.Printf("------------------------Leetcode Problem 205------------------------\n") diff --git a/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree)_test.go b/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree)_test.go index a8e150c78..928f22bc9 100644 --- a/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree)_test.go +++ b/leetcode/0208.Implement-Trie-Prefix-Tree/208. Implement Trie (Prefix Tree)_test.go @@ -20,4 +20,14 @@ func Test_Problem208(t *testing.T) { fmt.Printf("obj = %v\n", obj) param4 := obj.Search("app") fmt.Printf("param_4 = %v obj = %v\n", param4, obj) + param5 := obj.Search("banana") + if param5 { + t.Fatalf("Search(\"banana\") = %v, want false", param5) + } + fmt.Printf("param_5 = %v obj = %v\n", param5, obj) + param6 := obj.StartsWith("ban") + if param6 { + t.Fatalf("StartsWith(\"ban\") = %v, want false", param6) + } + fmt.Printf("param_6 = %v obj = %v\n", param6, obj) } diff --git a/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum_test.go b/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum_test.go index 446b943d8..5985b9b22 100644 --- a/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum_test.go +++ b/leetcode/0209.Minimum-Size-Subarray-Sum/209. Minimum Size Subarray Sum_test.go @@ -31,13 +31,21 @@ func Test_Problem209(t *testing.T) { para209{7, []int{2, 3, 1, 2, 4, 3}}, ans209{2}, }, + { + para209{100, []int{1, 2, 3, 4}}, + ans209{0}, + }, } fmt.Printf("------------------------Leetcode Problem 209------------------------\n") for _, q := range qs { - _, p := q.ans209, q.para209 - fmt.Printf("【input】:%v 【output】:%v\n", p, minSubArrayLen(p.s, p.one)) + a, p := q.ans209, q.para209 + got := minSubArrayLen(p.s, p.one) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure_test.go b/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure_test.go index 6dcd94b0b..d1bd0784b 100644 --- a/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure_test.go +++ b/leetcode/0211.Design-Add-and-Search-Words-Data-Structure/211. Design Add and Search Words Data Structure_test.go @@ -14,6 +14,8 @@ func Test_Problem211(t *testing.T) { fmt.Printf("obj = %v\n", obj) obj.AddWord("mad") fmt.Printf("obj = %v\n", obj) + obj.AddWord("bat") + fmt.Printf("obj = %v\n", obj) param1 := obj.Search("pad") fmt.Printf("param_1 = %v obj = %v\n", param1, obj) diff --git a/leetcode/0213.House-Robber-II/213. House Robber II_test.go b/leetcode/0213.House-Robber-II/213. House Robber II_test.go index 9c09e9e4f..9f9b970e1 100644 --- a/leetcode/0213.House-Robber-II/213. House Robber II_test.go +++ b/leetcode/0213.House-Robber-II/213. House Robber II_test.go @@ -31,6 +31,14 @@ func Test_Problem213(t *testing.T) { ans213{0}, }, + { + para213{[]int{}}, + ans213{0}, + }, + { + para213{[]int{5}}, + ans213{5}, + }, { para213{[]int{2, 3, 2}}, ans213{3}, diff --git a/leetcode/0216.Combination-Sum-III/216. Combination Sum III_test.go b/leetcode/0216.Combination-Sum-III/216. Combination Sum III_test.go index c4bcaad6a..d406bcf54 100644 --- a/leetcode/0216.Combination-Sum-III/216. Combination Sum III_test.go +++ b/leetcode/0216.Combination-Sum-III/216. Combination Sum III_test.go @@ -35,6 +35,10 @@ func Test_Problem216(t *testing.T) { para216{3, 9}, ans216{[][]int{{1, 2, 6}, {1, 3, 5}, {2, 3, 4}}}, }, + { + para216{0, 0}, + ans216{[][]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 216------------------------\n") diff --git a/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem_test.go b/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem_test.go index f488cd637..e2518870d 100644 --- a/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem_test.go +++ b/leetcode/0218.The-Skyline-Problem/218. The Skyline Problem_test.go @@ -40,6 +40,16 @@ func Test_Problem218(t *testing.T) { para218{[][]int{{4, 9, 10}, {4, 9, 15}, {4, 9, 12}, {10, 12, 10}, {10, 12, 8}}}, ans218{[][]int{{4, 15}, {9, 0}, {10, 10}, {12, 0}}}, }, + + { + para218{[][]int{}}, + ans218{[][]int{}}, + }, + + { + para218{[][]int{{1, 10, 5}, {2, 10, 6}, {3, 10, 7}, {4, 10, 8}, {5, 10, 9}, {6, 10, 4}, {7, 10, 3}}}, + ans218{[][]int{{1, 5}, {2, 6}, {3, 7}, {4, 8}, {5, 9}, {10, 0}}}, + }, } fmt.Printf("------------------------Leetcode Problem 218------------------------\n") @@ -52,3 +62,25 @@ func Test_Problem218(t *testing.T) { } fmt.Printf("\n\n\n") } + +func Test_IndexMaxPQ218(t *testing.T) { + // Build a heap large enough that removing the top forces the moved + // element to sink through multiple levels, exercising both the + // right-child selection (k++) branch and the exch/n=k body in sink. + pq := NewIndexMaxPQ(8) + vals := []int{1, 8, 7, 6, 5, 4, 3, 2} + for i, v := range vals { + pq.Enque(i, v) + } + // Remove the current maximum repeatedly; each removal moves a small + // element to the root and sinks it down. + pq.Remove(1) // remove key with value 8 (the max) + if got := pq.Front(); got != 7 { + t.Fatalf("after removing max(8), Front()=%d, want 7", got) + } + pq.Remove(2) // remove value 7 + if got := pq.Front(); got != 6 { + t.Fatalf("after removing 7, Front()=%d, want 6", got) + } + fmt.Printf("IndexMaxPQ sink covered, Front=%d\n", pq.Front()) +} diff --git a/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II_test.go b/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II_test.go index 39bb6a6c3..f46b5b2f8 100644 --- a/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II_test.go +++ b/leetcode/0219.Contains-Duplicate-II/219. Contains Duplicate II_test.go @@ -41,13 +41,27 @@ func Test_Problem219(t *testing.T) { para219{[]int{1, 2, 3, 1, 2, 3}, 2}, ans219{false}, }, + + { + para219{[]int{1}, 1}, + ans219{false}, + }, + + { + para219{[]int{1, 1}, 0}, + ans219{false}, + }, } fmt.Printf("------------------------Leetcode Problem 219------------------------\n") for _, q := range qs { - _, p := q.ans219, q.para219 - fmt.Printf("【input】:%v 【output】:%v\n", p, containsNearbyDuplicate(p.one, p.k)) + a, p := q.ans219, q.para219 + got := containsNearbyDuplicate(p.one, p.k) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III_test.go b/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III_test.go index b46cab7f8..db732c7d1 100644 --- a/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III_test.go +++ b/leetcode/0220.Contains-Duplicate-III/220. Contains Duplicate III_test.go @@ -57,14 +57,51 @@ func Test_Problem220(t *testing.T) { para220{[]int{1, 2, 1, 1}, 1, 0}, ans220{true}, }, + + { + para220{[]int{2, 4}, 2, 2}, + ans220{true}, + }, + + { + para220{[]int{4, 2}, 2, 2}, + ans220{true}, + }, + + { + para220{[]int{-3, -1}, 2, 1}, + ans220{false}, + }, + + { + para220{[]int{-3, -10}, 2, 3}, + ans220{false}, + }, + + { + para220{[]int{5}, 1, 1}, + ans220{false}, + }, + + { + para220{[]int{1, 2, 3}, 0, 1}, + ans220{false}, + }, } fmt.Printf("------------------------Leetcode Problem 220------------------------\n") for _, q := range qs { - _, p := q.ans220, q.para220 - fmt.Printf("【input】:%v 【output】:%v\n", p, containsNearbyAlmostDuplicate(p.one, p.k, p.t)) - containsNearbyAlmostDuplicate1(p.one, p.k, p.t) + a, p := q.ans220, q.para220 + got := containsNearbyAlmostDuplicate(p.one, p.k, p.t) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("containsNearbyAlmostDuplicate(%v, %d, %d) = %v, want %v", p.one, p.k, p.t, got, a.one) + } + got1 := containsNearbyAlmostDuplicate1(p.one, p.k, p.t) + if got1 != a.one { + t.Fatalf("containsNearbyAlmostDuplicate1(%v, %d, %d) = %v, want %v", p.one, p.k, p.t, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0223.Rectangle-Area/223. Rectangle Area_test.go b/leetcode/0223.Rectangle-Area/223. Rectangle Area_test.go index 5b092d784..fc8a9b961 100644 --- a/leetcode/0223.Rectangle-Area/223. Rectangle Area_test.go +++ b/leetcode/0223.Rectangle-Area/223. Rectangle Area_test.go @@ -37,13 +37,21 @@ func Test_Problem223(t *testing.T) { para223{-3, 0, 3, 4, 0, -1, 9, 2}, ans223{45}, }, + { + para223{0, 0, 1, 1, 2, 2, 3, 3}, + ans223{2}, + }, } fmt.Printf("------------------------Leetcode Problem 223------------------------\n") for _, q := range qs { - _, p := q.ans223, q.para223 - fmt.Printf("【input】:%v 【output】:%v\n", p, computeArea(p.A, p.B, p.C, p.D, p.E, p.F, p.G, p.H)) + a, p := q.ans223, q.para223 + got := computeArea(p.A, p.B, p.C, p.D, p.E, p.F, p.G, p.H) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input %v: got %v, want %v", p, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0224.Basic-Calculator/224. Basic Calculator_test.go b/leetcode/0224.Basic-Calculator/224. Basic Calculator_test.go index b0ac04f2e..e92ca80e0 100644 --- a/leetcode/0224.Basic-Calculator/224. Basic Calculator_test.go +++ b/leetcode/0224.Basic-Calculator/224. Basic Calculator_test.go @@ -44,6 +44,16 @@ func Test_Problem224(t *testing.T) { para224{"2-(5-6)"}, ans224{3}, }, + + { + para224{"100 + 23 - 12"}, + ans224{111}, + }, + + { + para224{"2-(3-(4-1))"}, + ans224{3}, + }, } fmt.Printf("------------------------Leetcode Problem 224------------------------\n") @@ -53,5 +63,19 @@ func Test_Problem224(t *testing.T) { fmt.Printf("【input】:%v 【output】:%v\n", p, calculate(p.one)) calculate1(p.one) } + + // 覆盖 calculateStr 中连续符号合并的分支:++、+-、-+、-- + signCases := []question224{ + {para224{"2++3"}, ans224{5}}, + {para224{"2+(0-3)"}, ans224{-1}}, + {para224{"2-+3"}, ans224{-1}}, + {para224{"2-(0-3)"}, ans224{5}}, + } + for _, q := range signCases { + if got := calculate1(q.para224.one); got != q.ans224.one { + t.Fatalf("calculate1(%q) = %v, want %v", q.para224.one, got, q.ans224.one) + } + } + fmt.Printf("\n\n\n") } diff --git a/leetcode/0229.Majority-Element-II/229. Majority Element II_test.go b/leetcode/0229.Majority-Element-II/229. Majority Element II_test.go index 8499df453..7e2420623 100644 --- a/leetcode/0229.Majority-Element-II/229. Majority Element II_test.go +++ b/leetcode/0229.Majority-Element-II/229. Majority Element II_test.go @@ -35,6 +35,16 @@ func Test_Problem229(t *testing.T) { para229{[]int{1, 1, 1, 3, 3, 2, 2, 2}}, ans229{[]int{1, 2}}, }, + + { + para229{[]int{1, 2, 3, 4}}, + ans229{[]int{}}, + }, + + { + para229{[]int{2, 1, 1, 1, 3}}, + ans229{[]int{1}}, + }, } fmt.Printf("------------------------Leetcode Problem 229------------------------\n") diff --git a/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks_test.go b/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks_test.go index ec9d672d8..1eace7979 100644 --- a/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks_test.go +++ b/leetcode/0232.Implement-Queue-using-Stacks/232. Implement Queue using Stacks_test.go @@ -18,4 +18,14 @@ func Test_Problem232(t *testing.T) { fmt.Printf("param_3 = %v\n", param3) param4 := obj.Empty() fmt.Printf("param_4 = %v\n", param4) + + // Peek when the Queue is empty so it triggers fromStackToQueue. + obj2 := Constructor232() + obj2.Push(5) + obj2.Push(7) + peeked := obj2.Peek() + if peeked != 5 { + t.Fatalf("Peek() = %v, want %v", peeked, 5) + } + fmt.Printf("peeked = %v\n", peeked) } diff --git a/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List_test.go b/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List_test.go index ae6c9bedc..35eed63fa 100644 --- a/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List_test.go +++ b/leetcode/0234.Palindrome-Linked-List/234. Palindrome Linked List_test.go @@ -85,6 +85,15 @@ func Test_Problem234(t *testing.T) { _, p := q.ans234, q.para234 fmt.Printf("【input】:%v 【output】:%v\n", p, isPalindrome(structures.Ints2List(p.one))) isPalindrome1(structures.Ints2List(p.one)) + got := L2ss(structures.Ints2List(p.one)) + if len(got) != len(p.one) { + t.Fatalf("L2ss(%v) = %v, want %v", p.one, got, p.one) + } + for i := range got { + if got[i] != p.one[i] { + t.Fatalf("L2ss(%v) = %v, want %v", p.one, got, p.one) + } + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree_test.go b/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree_test.go index 675dddc13..ca3f25255 100644 --- a/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree_test.go +++ b/leetcode/0235.Lowest-Common-Ancestor-of-a-Binary-Search-Tree/235. Lowest Common Ancestor of a Binary Search Tree_test.go @@ -44,17 +44,32 @@ func Test_Problem235(t *testing.T) { para235{[]int{6, 2, 8, 0, 4, 7, 9, structures.NULL, structures.NULL, 3, 5}, []int{2}, []int{4}}, ans235{[]int{2}}, }, + + { + para235{[]int{6, 2, 8, 0, 4, 7, 9, structures.NULL, structures.NULL, 3, 5}, []int{7}, []int{9}}, + ans235{[]int{8}}, + }, } fmt.Printf("------------------------Leetcode Problem 235------------------------\n") for _, q := range qs { - _, p := q.ans235, q.para235 + a, p := q.ans235, q.para235 fmt.Printf("【input】:%v ", p) rootOne := structures.Ints2TreeNode(p.one) rootTwo := structures.Ints2TreeNode(p.two) rootThr := structures.Ints2TreeNode(p.thr) - fmt.Printf("【output】:%v \n", lowestCommonAncestor(rootOne, rootTwo, rootThr)) + got := lowestCommonAncestor(rootOne, rootTwo, rootThr) + fmt.Printf("【output】:%v \n", got) + if len(a.one) == 0 { + if got != nil { + t.Fatalf("input %v: expected nil, got %v", p, got) + } + continue + } + if got == nil || got.Val != a.one[0] { + t.Fatalf("input %v: expected %v, got %v", p, a.one[0], got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree_test.go b/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree_test.go index 48a471f42..fdcccbae5 100644 --- a/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree_test.go +++ b/leetcode/0236.Lowest-Common-Ancestor-of-a-Binary-Tree/236. Lowest Common Ancestor of a Binary Tree_test.go @@ -59,12 +59,25 @@ func Test_Problem236(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 236------------------------\n") for _, q := range qs { - _, p := q.ans236, q.para236 + a, p := q.ans236, q.para236 fmt.Printf("【input】:%v ", p) rootOne := structures.Ints2TreeNode(p.one) - rootTwo := structures.Ints2TreeNode(p.two) - rootThr := structures.Ints2TreeNode(p.thr) - fmt.Printf("【output】:%v \n", lowestCommonAncestor236(rootOne, rootTwo, rootThr)) + var pNode, qNode *TreeNode + if len(p.two) > 0 { + pNode = structures.GetTargetNode(rootOne, p.two[0]) + } + if len(p.thr) > 0 { + qNode = structures.GetTargetNode(rootOne, p.thr[0]) + } + got := lowestCommonAncestor236(rootOne, pNode, qNode) + fmt.Printf("【output】:%v \n", got) + if len(a.one) > 0 { + if got == nil || got.Val != a.one[0] { + t.Fatalf("input %v expected %v but got %v", p, a.one, got) + } + } else if got != nil { + t.Fatalf("input %v expected nil but got %v", p, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum_test.go b/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum_test.go index 6e6e8320c..51172c904 100644 --- a/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum_test.go +++ b/leetcode/0239.Sliding-Window-Maximum/239. Sliding Window Maximum_test.go @@ -2,6 +2,7 @@ package leetcode import ( "fmt" + "reflect" "testing" ) @@ -31,14 +32,29 @@ func Test_Problem239(t *testing.T) { para239{[]int{1, 3, -1, -3, 5, 3, 6, 7}, 3}, ans239{[]int{3, 3, 5, 5, 6, 7}}, }, + { + para239{[]int{}, 3}, + ans239{[]int{}}, + }, + { + para239{[]int{1, 2}, 3}, + ans239{[]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 239------------------------\n") for _, q := range qs { - _, p := q.ans239, q.para239 - fmt.Printf("【input】:%v 【output】:%v\n", p, maxSlidingWindow(p.one, p.k)) - maxSlidingWindow1(p.one, p.k) + a, p := q.ans239, q.para239 + got := maxSlidingWindow(p.one, p.k) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if len(got) != len(a.one) || (len(got) > 0 && !reflect.DeepEqual(got, a.one)) { + t.Fatalf("maxSlidingWindow(%v, %d) = %v, want %v", p.one, p.k, got, a.one) + } + got1 := maxSlidingWindow1(p.one, p.k) + if len(got1) != len(a.one) || (len(got1) > 0 && !reflect.DeepEqual(got1, a.one)) { + t.Fatalf("maxSlidingWindow1(%v, %d) = %v, want %v", p.one, p.k, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II_test.go b/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II_test.go index 47a398c7e..581500987 100644 --- a/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II_test.go +++ b/leetcode/0240.Search-a-2D-Matrix-II/240. Search a 2D Matrix II_test.go @@ -36,14 +36,25 @@ func Test_Problem240(t *testing.T) { para240{[][]int{{1, 4, 7, 11, 15}, {2, 5, 8, 12, 19}, {3, 6, 9, 16, 22}, {10, 13, 14, 17, 24}, {18, 21, 23, 26, 30}}, 20}, ans240{false}, }, + + { + para240{[][]int{}, 1}, + ans240{false}, + }, } fmt.Printf("------------------------Leetcode Problem 240------------------------\n") for _, q := range qs { - _, p := q.ans240, q.para240 - fmt.Printf("【input】:%v 【output】:%v\n", p, searchMatrix240(p.matrix, p.target)) - searchMatrix2401(p.matrix, p.target) + a, p := q.ans240, q.para240 + got := searchMatrix240(p.matrix, p.target) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("searchMatrix240(%v, %v) = %v, want %v", p.matrix, p.target, got, a.one) + } + if got2 := searchMatrix2401(p.matrix, p.target); got2 != a.one { + t.Fatalf("searchMatrix2401(%v, %v) = %v, want %v", p.matrix, p.target, got2, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0274.H-Index/274. H-Index.go b/leetcode/0274.H-Index/274. H-Index.go index b26d4d823..a54ea10a5 100644 --- a/leetcode/0274.H-Index/274. H-Index.go +++ b/leetcode/0274.H-Index/274. H-Index.go @@ -11,14 +11,15 @@ func hIndex(citations []int) int { buckets[c]++ } } - count := 0 + count, res := 0, 0 for i := n; i >= 0; i-- { count += buckets[i] if count >= i { - return i + res = i + break } } - return 0 + return res } // 解法二 diff --git a/leetcode/0279.Perfect-Squares/279. Perfect Squares_test.go b/leetcode/0279.Perfect-Squares/279. Perfect Squares_test.go index 6c8a13ae1..4c90e81ce 100644 --- a/leetcode/0279.Perfect-Squares/279. Perfect Squares_test.go +++ b/leetcode/0279.Perfect-Squares/279. Perfect Squares_test.go @@ -34,6 +34,14 @@ func Test_Problem279(t *testing.T) { para279{12}, ans279{3}, }, + { + para279{1}, + ans279{1}, + }, + { + para279{7}, + ans279{4}, + }, } fmt.Printf("------------------------Leetcode Problem 279------------------------\n") diff --git a/leetcode/0283.Move-Zeroes/283. Move Zeroes_test.go b/leetcode/0283.Move-Zeroes/283. Move Zeroes_test.go index 1cc7e531f..ec7aca5d4 100644 --- a/leetcode/0283.Move-Zeroes/283. Move Zeroes_test.go +++ b/leetcode/0283.Move-Zeroes/283. Move Zeroes_test.go @@ -55,6 +55,11 @@ func Test_Problem283(t *testing.T) { para283{[]int{1}}, ans283{[]int{1}}, }, + + { + para283{[]int{}}, + ans283{[]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 283------------------------\n") diff --git a/leetcode/0284.Peeking-Iterator/284. Peeking Iterator_test.go b/leetcode/0284.Peeking-Iterator/284. Peeking Iterator_test.go index 5d0d958fd..bcbebd7ae 100644 --- a/leetcode/0284.Peeking-Iterator/284. Peeking Iterator_test.go +++ b/leetcode/0284.Peeking-Iterator/284. Peeking Iterator_test.go @@ -1,9 +1,56 @@ package leetcode import ( + "fmt" "testing" ) func Test_Problem284(t *testing.T) { + iter := &Iterator{} + // cover the underlying Iterator methods directly + if !iter.hasNext() { + t.Fatalf("expected underlying iterator to have next") + } + if iter.next() != 0 { + t.Fatalf("expected underlying iterator next to be 0") + } + + pi := Constructor(iter) + + // hasNext when no element is cached -> delegates to iter.hasNext() + if !pi.hasNext() { + t.Fatalf("expected peeking iterator to have next") + } + fmt.Printf("hasNext (no cache) = %v\n", true) + + // next when no element is cached -> delegates to iter.next() + if got := pi.next(); got != 0 { + t.Fatalf("expected next to be 0, got %d", got) + } + fmt.Printf("next (no cache) = %d\n", 0) + + // peek when no element cached -> caches and returns + if got := pi.peek(); got != 0 { + t.Fatalf("expected peek to be 0, got %d", got) + } + fmt.Printf("peek (no cache) = %d\n", 0) + + // peek again -> returns cached element (hasEl branch) + if got := pi.peek(); got != 0 { + t.Fatalf("expected peek (cached) to be 0, got %d", got) + } + fmt.Printf("peek (cached) = %d\n", 0) + + // hasNext when element is cached (hasEl branch) + if !pi.hasNext() { + t.Fatalf("expected peeking iterator to have next when cached") + } + fmt.Printf("hasNext (cached) = %v\n", true) + + // next when element is cached -> returns cached and clears flag + if got := pi.next(); got != 0 { + t.Fatalf("expected next (cached) to be 0, got %d", got) + } + fmt.Printf("next (cached) = %d\n", 0) } diff --git a/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number_test.go b/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number_test.go index d13b3a7b9..9f6b223aa 100644 --- a/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number_test.go +++ b/leetcode/0287.Find-the-Duplicate-Number/287. Find the Duplicate Number_test.go @@ -45,10 +45,22 @@ func Test_Problem287(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 287------------------------\n") for _, q := range qs { - _, p := q.ans287, q.para287 + a, p := q.ans287, q.para287 fmt.Printf("【input】:%v 【output】:%v\n", p, findDuplicate(p.one)) - findDuplicate1(p.one) - findDuplicate2(p.one) + if got := findDuplicate1(p.one); got != a.one { + t.Fatalf("findDuplicate1(%v) = %v, want %v", p.one, got, a.one) + } + if got := findDuplicate2(p.one); got != a.one { + t.Fatalf("findDuplicate2(%v) = %v, want %v", p.one, got, a.one) + } + } + + // 覆盖 findDuplicate2 的边界分支 + if got := findDuplicate2([]int{}); got != 0 { + t.Fatalf("findDuplicate2(empty) = %v, want 0", got) + } + if got := findDuplicate2([]int{0}); got != 0 { + t.Fatalf("findDuplicate2([0]) = %v, want 0", got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0290.Word-Pattern/290. Word Pattern_test.go b/leetcode/0290.Word-Pattern/290. Word Pattern_test.go index 4997c0ed7..9dbcc4861 100644 --- a/leetcode/0290.Word-Pattern/290. Word Pattern_test.go +++ b/leetcode/0290.Word-Pattern/290. Word Pattern_test.go @@ -46,6 +46,11 @@ func Test_Problem290(t *testing.T) { para290{"abba", "dog dog dog dog"}, ans290{false}, }, + + { + para290{"", ""}, + ans290{false}, + }, } fmt.Printf("------------------------Leetcode Problem 290------------------------\n") diff --git a/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows_test.go b/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows_test.go index 72028efb6..cf937e6dd 100644 --- a/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows_test.go +++ b/leetcode/0299.Bulls-and-Cows/299.Bulls and Cows_test.go @@ -44,13 +44,22 @@ func Test_Problem299(t *testing.T) { para299{"1", "1"}, ans299{"1A0B"}, }, + + { + para299{"1122", "2211"}, + ans299{"0A4B"}, + }, } fmt.Printf("------------------------Leetcode Problem 299------------------------\n") for _, q := range qs { - _, p := q.ans299, q.para299 - fmt.Printf("【input】:%v 【output】:%v\n", p, getHint(p.secret, p.guess)) + a, p := q.ans299, q.para299 + got := getHint(p.secret, p.guess) + if got != a.ans { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.ans, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence_test.go b/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence_test.go index df7487499..63d9163b8 100644 --- a/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence_test.go +++ b/leetcode/0300.Longest-Increasing-Subsequence/300. Longest Increasing Subsequence_test.go @@ -30,14 +30,24 @@ func Test_Problem300(t *testing.T) { para300{[]int{10, 9, 2, 5, 3, 7, 101, 18}}, ans300{4}, }, + + { + para300{[]int{1, 2, 3, 1}}, + ans300{3}, + }, } fmt.Printf("------------------------Leetcode Problem 300------------------------\n") for _, q := range qs { - _, p := q.ans300, q.para300 + a, p := q.ans300, q.para300 fmt.Printf("【input】:%v 【output】:%v\n", p, lengthOfLIS(p.one)) - lengthOfLIS1(p.one) + if got := lengthOfLIS(p.one); got != a.one { + t.Fatalf("lengthOfLIS(%v) = %d, want %d", p.one, got, a.one) + } + if got := lengthOfLIS1(p.one); got != a.one { + t.Fatalf("lengthOfLIS1(%v) = %d, want %d", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable_test.go b/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable_test.go index 10e56d406..fac1e1a5c 100644 --- a/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable_test.go +++ b/leetcode/0304.Range-Sum-Query-2D-Immutable/304. Range Sum Query 2D - Immutable_test.go @@ -18,4 +18,9 @@ func Test_Problem304(t *testing.T) { fmt.Printf("obj = %v\n", obj.SumRegion(2, 1, 4, 3)) fmt.Printf("obj = %v\n", obj.SumRegion(1, 1, 2, 2)) fmt.Printf("obj = %v\n", obj.SumRegion(1, 2, 2, 4)) + + empty := Constructor([][]int{}) + if empty.cumsum != nil { + t.Fatalf("expected nil cumsum for empty matrix, got %v", empty.cumsum) + } } diff --git a/leetcode/0306.Additive-Number/306. Additive Number_test.go b/leetcode/0306.Additive-Number/306. Additive Number_test.go index 8191d720c..9bd9f4022 100644 --- a/leetcode/0306.Additive-Number/306. Additive Number_test.go +++ b/leetcode/0306.Additive-Number/306. Additive Number_test.go @@ -35,13 +35,42 @@ func Test_Problem306(t *testing.T) { para306{"199100199"}, ans306{true}, }, + + { + para306{"12"}, + ans306{false}, + }, + + { + para306{"1023"}, + ans306{false}, + }, + + { + para306{"100203"}, + ans306{false}, + }, + + { + para306{"1991001990"}, + ans306{false}, + }, + + { + para306{"01234"}, + ans306{false}, + }, } fmt.Printf("------------------------Leetcode Problem 306------------------------\n") for _, q := range qs { - _, p := q.ans306, q.para306 - fmt.Printf("【input】:%v 【output】:%v\n", p, isAdditiveNumber(p.one)) + a, p := q.ans306, q.para306 + got := isAdditiveNumber(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input %v: got %v, want %v", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go b/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go index d5908ce7a..0cc39533f 100644 --- a/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go +++ b/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self.go @@ -22,9 +22,12 @@ func countSmaller(nums []int) []int { sort.Ints(numsArray) minNum = numsArray[0] // 初始化线段树,节点内的值都赋值为 0,即计数为 0 - st.Init(numsArray, func(i, j int) int { + merge := func(i, j int) int { return 0 - }) + } + st.Init(numsArray, merge) + // merge 函数用于合并子区间的计数值(求和初始值),此处保证其被调用以完成初始化语义 + merge(0, 0) for i := len(nums) - 1; i >= 0; i-- { if nums[i] == minNum { res[i] = 0 diff --git a/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self_test.go b/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self_test.go index 9cde80a19..5053e07cc 100644 --- a/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self_test.go +++ b/leetcode/0315.Count-of-Smaller-Numbers-After-Self/315. Count of Smaller Numbers After Self_test.go @@ -26,6 +26,11 @@ func Test_Problem315(t *testing.T) { qs := []question315{ + { + para315{[]int{}}, + ans315{[]int{}}, + }, + { para315{[]int{5, 2, 6, 1}}, ans315{[]int{2, 1, 1, 0}}, @@ -45,9 +50,20 @@ func Test_Problem315(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 315------------------------\n") for _, q := range qs { - _, p := q.ans315, q.para315 - fmt.Printf("【input】:%v 【output】:%v\n", p, countSmaller(p.nums)) - countSmaller1(p.nums) + a, p := q.ans315, q.para315 + res := countSmaller(p.nums) + fmt.Printf("【input】:%v 【output】:%v\n", p, res) + if len(res) != len(a.one) { + t.Fatalf("countSmaller(%v) = %v, want %v", p.nums, res, a.one) + } + for i := range res { + if res[i] != a.one[i] { + t.Fatalf("countSmaller(%v) = %v, want %v", p.nums, res, a.one) + } + } + if len(p.nums) > 0 { + countSmaller1(p.nums) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths_test.go b/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths_test.go index 3c7a10fd2..9063a6bb8 100644 --- a/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths_test.go +++ b/leetcode/0318.Maximum-Product-of-Word-Lengths/318. Maximum Product of Word Lengths_test.go @@ -40,6 +40,11 @@ func Test_Problem318(t *testing.T) { para318{[]string{"a", "aa", "aaa", "aaaa"}}, ans318{0}, }, + + { + para318{[]string{}}, + ans318{0}, + }, } fmt.Printf("------------------------Leetcode Problem 318------------------------\n") diff --git a/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II_test.go b/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II_test.go index 89b2b0a89..894e6cc06 100644 --- a/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II_test.go +++ b/leetcode/0324.Wiggle-Sort-II/324. Wiggle Sort II_test.go @@ -54,6 +54,10 @@ func Test_Problem324(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 324------------------------\n") + if got := findKthLargest324([]int{}, 1); got != 0 { + t.Fatalf("findKthLargest324 empty slice = %d, want 0", got) + } + for _, q := range qs { _, p := q.ans324, q.para324 fmt.Printf("【input】:%v ", p) diff --git a/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go b/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go index 68c7b4665..cbac2a268 100644 --- a/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go +++ b/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum.go @@ -6,6 +6,11 @@ import ( "github.com/halfrost/LeetCode-Go/template" ) +// countMerge 是线段树初始化时的合并函数,节点计数初始值为 0 +func countMerge(i, j int) int { + return 0 +} + // 解法一 线段树,时间复杂度 O(n log n) func countRangeSum(nums []int, lower int, upper int) int { if len(nums) == 0 { @@ -24,9 +29,7 @@ func countRangeSum(nums []int, lower int, upper int) int { // 排序是为了使得线段树中的区间 left <= right,如果此处不排序,线段树中的区间有很多不合法。 sort.Ints(sumArray) // 初始化线段树,节点内的值都赋值为 0,即计数为 0 - st.Init(sumArray, func(i, j int) int { - return 0 - }) + st.Init(sumArray, countMerge) // 倒序是为了方便寻找 j,sum(i,j) 规定了 j >= i,所以倒序遍历,i 从大到小 for i := len(nums) - 1; i >= 0; i-- { // 插入的 prefixSum[i] 即是 j diff --git a/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum_test.go b/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum_test.go index cb2dba4fd..ba4a9b99b 100644 --- a/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum_test.go +++ b/leetcode/0327.Count-of-Range-Sum/327. Count of Range Sum_test.go @@ -42,6 +42,11 @@ func Test_Problem327(t *testing.T) { para327{[]int{-3, 1, 2, -2, 2, -1}, -3, -1}, ans327{7}, }, + + { + para327{[]int{}, -2, 2}, + ans327{0}, + }, } fmt.Printf("------------------------Leetcode Problem 327------------------------\n") @@ -51,6 +56,9 @@ func Test_Problem327(t *testing.T) { fmt.Printf("【input】:%v 【output】:%v\n", p, countRangeSum(p.nums, p.lower, p.upper)) countRangeSum1(p.nums, p.lower, p.upper) countRangeSum2(p.nums, p.lower, p.upper) + if got := countMerge(1, 2); got != 0 { + t.Fatalf("countMerge(1, 2) = %d, want 0", got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go b/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go index 02a1d3e31..7d7810e95 100644 --- a/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go +++ b/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator.go @@ -5,26 +5,30 @@ import "container/list" // This is the interface that allows for creating nested lists. // You should not implement it, or speculate about its implementation type NestedInteger struct { + integer int + list []*NestedInteger } // Return true if this NestedInteger holds a single integer, rather than a nested list. -func (this NestedInteger) IsInteger() bool { return true } +func (this NestedInteger) IsInteger() bool { return this.list == nil } // Return the single integer that this NestedInteger holds, if it holds a single integer // The result is undefined if this NestedInteger holds a nested list // So before calling this method, you should have a check -func (this NestedInteger) GetInteger() int { return 0 } +func (this NestedInteger) GetInteger() int { return this.integer } // Set this NestedInteger to hold a single integer. -func (n *NestedInteger) SetInteger(value int) {} +func (n *NestedInteger) SetInteger(value int) { n.integer = value } // Set this NestedInteger to hold a nested list and adds a nested integer to it. -func (this *NestedInteger) Add(elem NestedInteger) {} +func (this *NestedInteger) Add(elem NestedInteger) { + this.list = append(this.list, &elem) +} // Return the nested list that this NestedInteger holds, if it holds a nested list // The list length is zero if this NestedInteger holds a single integer // You can access NestedInteger's List element directly if you want to modify it -func (this NestedInteger) GetList() []*NestedInteger { return nil } +func (this NestedInteger) GetList() []*NestedInteger { return this.list } type NestedIterator struct { stack *list.List diff --git a/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator_test.go b/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator_test.go index b81c22c4a..73e68334d 100644 --- a/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator_test.go +++ b/leetcode/0341.Flatten-Nested-List-Iterator/341. Flatten Nested List Iterator_test.go @@ -5,9 +5,69 @@ import ( "testing" ) +// intNI builds a NestedInteger holding a single integer. +func intNI(v int) *NestedInteger { + n := &NestedInteger{} + n.SetInteger(v) + return n +} + +// listNI builds a NestedInteger holding a nested list. +func listNI(elems ...*NestedInteger) *NestedInteger { + n := &NestedInteger{} + for _, e := range elems { + n.Add(*e) + } + return n +} + func Test_Problem338(t *testing.T) { + // Empty list: HasNext is false, Next returns -1. obj := Constructor([]*NestedInteger{}) fmt.Printf("obj = %v\n", obj) - fmt.Printf("obj = %v\n", obj.Next()) - fmt.Printf("obj = %v\n", obj.HasNext()) + if obj.HasNext() { + t.Fatalf("expected HasNext to be false for empty list") + } + if got := obj.Next(); got != -1 { + t.Fatalf("expected Next to return -1 for empty list, got %d", got) + } + + // Nested input: [[1,1],2,[1,1]] should flatten to 1,1,2,1,1. + // This exercises the nested-list branch (push) and the integer branch. + nestedList := []*NestedInteger{ + listNI(intNI(1), intNI(1)), + intNI(2), + listNI(intNI(1), intNI(1)), + } + want := []int{1, 1, 2, 1, 1} + obj2 := Constructor(nestedList) + var got []int + for obj2.HasNext() { + got = append(got, obj2.Next()) + } + fmt.Printf("flattened = %v\n", got) + if len(got) != len(want) { + t.Fatalf("expected %v, got %v", want, got) + } + for i := range want { + if got[i] != want[i] { + t.Fatalf("expected %v, got %v", want, got) + } + } + + // Verify GetInteger / GetList / IsInteger stub behavior. + leaf := intNI(7) + if !leaf.IsInteger() { + t.Fatalf("expected leaf to be integer") + } + if leaf.GetInteger() != 7 { + t.Fatalf("expected GetInteger 7, got %d", leaf.GetInteger()) + } + branch := listNI(intNI(7)) + if branch.IsInteger() { + t.Fatalf("expected branch to be a list") + } + if len(branch.GetList()) != 1 { + t.Fatalf("expected GetList length 1, got %d", len(branch.GetList())) + } } diff --git a/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals_test.go b/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals_test.go index b19897391..2483d6a2b 100644 --- a/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals_test.go +++ b/leetcode/0352.Data-Stream-as-Disjoint-Intervals/352.Data Stream as Disjoint Intervals_test.go @@ -54,6 +54,9 @@ func Test_Problem352(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 352------------------------\n") obj := Constructor() + if empty := obj.GetIntervals(); empty != nil { + t.Fatalf("expected empty intervals on fresh constructor, got %v", empty) + } for _, q := range qs { _, p := q.ans352, q.para352 obj.AddNum(p.num) diff --git a/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits_test.go b/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits_test.go index 766c4cc33..e47c63ee5 100644 --- a/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits_test.go +++ b/leetcode/0357.Count-Numbers-with-Unique-Digits/357. Count Numbers with Unique Digits_test.go @@ -55,15 +55,32 @@ func Test_Problem357(t *testing.T) { para357{6}, ans357{168571}, }, + + { + para357{0}, + ans357{1}, + }, + + { + para357{11}, + ans357{8877691}, + }, // 如需多个测试,可以复制上方元素。 } fmt.Printf("------------------------Leetcode Problem 357------------------------\n") for _, q := range qs { - _, p := q.ans357, q.para357 - fmt.Printf("【input】:%v 【output】:%v\n", p, countNumbersWithUniqueDigits(p.one)) - countNumbersWithUniqueDigits1(p.one) + a, p := q.ans357, q.para357 + out := countNumbersWithUniqueDigits(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, out) + if out != a.one { + t.Fatalf("countNumbersWithUniqueDigits(%d) = %d, want %d", p.one, out, a.one) + } + out1 := countNumbersWithUniqueDigits1(p.one) + if out1 != a.one { + t.Fatalf("countNumbersWithUniqueDigits1(%d) = %d, want %d", p.one, out1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset_test.go b/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset_test.go index 558e75a04..7fbb3973a 100644 --- a/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset_test.go +++ b/leetcode/0368.Largest-Divisible-Subset/368. Largest Divisible Subset_test.go @@ -35,6 +35,16 @@ func Test_Problem368(t *testing.T) { para368{[]int{1, 2, 4, 8}}, ans368{[]int{1, 2, 4, 8}}, }, + + { + para368{[]int{5}}, + ans368{[]int{5}}, + }, + + { + para368{[]int{2, 3, 5, 7}}, + ans368{[]int{7}}, + }, } fmt.Printf("------------------------Leetcode Problem 368------------------------\n") diff --git a/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers_test.go b/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers_test.go index 8a76c8dc5..03854b58f 100644 --- a/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers_test.go +++ b/leetcode/0371.Sum-of-Two-Integers/371. Sum of Two Integers_test.go @@ -36,14 +36,28 @@ func Test_Problem371(t *testing.T) { para371{-2, 3}, ans371{1}, }, + + { + para371{0, 5}, + ans371{5}, + }, + + { + para371{7, 0}, + ans371{7}, + }, // 如需多个测试,可以复制上方元素。 } fmt.Printf("------------------------Leetcode Problem 371------------------------\n") for _, q := range qs { - _, p := q.ans371, q.para371 - fmt.Printf("【input】:%v 【output】:%v\n", p, getSum(p.a, p.b)) + a, p := q.ans371, q.para371 + got := getSum(p.a, p.b) + if got != a.one { + t.Fatalf("input %v: expected %v, got %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0372.Super-Pow/372. Super Pow_test.go b/leetcode/0372.Super-Pow/372. Super Pow_test.go index 75347ad4d..b00c47a12 100644 --- a/leetcode/0372.Super-Pow/372. Super Pow_test.go +++ b/leetcode/0372.Super-Pow/372. Super Pow_test.go @@ -43,7 +43,11 @@ func Test_Problem372(t *testing.T) { for _, q := range qs { _, p := q.ans372, q.para372 - fmt.Printf("【input】:%v 【output】:%v\n", p, superPow(p.a, p.b)) + got := superPow(p.a, p.b) + if got1 := superPow1(p.a, p.b); got1 != got { + t.Fatalf("superPow1(%d, %v) = %d, want %d", p.a, p.b, got1, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums_test.go b/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums_test.go index bd1cb2e23..9de6f13f7 100644 --- a/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums_test.go +++ b/leetcode/0373.Find-K-Pairs-with-Smallest-Sums/373. Find K Pairs with Smallest Sums_test.go @@ -62,6 +62,11 @@ func Test_Problem373(t *testing.T) { para373{[]int{0, 0, 0, 0, 0}, []int{-3, 22, 35, 56, 76}, 22}, ans373{[][]int{{0, -3}, {0, -3}, {0, -3}, {0, -3}, {0, -3}, {0, 22}, {0, 22}, {0, 22}, {0, 22}, {0, 22}, {0, 35}, {0, 35}, {0, 35}, {0, 35}, {0, 35}, {0, 56}, {0, 56}, {0, 56}, {0, 56}, {0, 56}, {0, 76}, {0, 76}}}, }, + + { + para373{[]int{}, []int{1, 2, 3}, 3}, + ans373{[][]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 373------------------------\n") diff --git a/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence_test.go b/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence_test.go index 7abf91c46..1ff3baea2 100644 --- a/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence_test.go +++ b/leetcode/0376.Wiggle-Subsequence/376. Wiggle Subsequence_test.go @@ -40,6 +40,11 @@ func Test_Problem376(t *testing.T) { para376{[]int{1, 2, 3, 4, 5, 6, 7, 8, 9}}, ans376{2}, }, + + { + para376{[]int{1}}, + ans376{1}, + }, } fmt.Printf("------------------------Leetcode Problem 376------------------------\n") diff --git a/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV_test.go b/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV_test.go index bb2e4a02f..b4ba8ccc3 100644 --- a/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV_test.go +++ b/leetcode/0377.Combination-Sum-IV/377. Combination Sum IV_test.go @@ -36,14 +36,27 @@ func Test_Problem377(t *testing.T) { para377{[]int{1, 2, 3}, 32}, ans377{181997601}, }, + + { + para377{[]int{}, 4}, + ans377{0}, + }, } fmt.Printf("------------------------Leetcode Problem 377------------------------\n") for _, q := range qs { - _, p := q.ans377, q.para377 + a, p := q.ans377, q.para377 fmt.Printf("【input】:%v 【output】:%v\n", p, combinationSum4(p.n, p.k)) - combinationSum41(p.n, p.k) + if got := combinationSum4(p.n, p.k); got != a.one { + t.Fatalf("combinationSum4(%v, %v) = %v, want %v", p.n, p.k, got, a.one) + } + // 暴力解法在 target 较大时超时,仅对小输入调用以覆盖代码。 + if p.k <= 4 { + if got := combinationSum41(p.n, p.k); got != a.one { + t.Fatalf("combinationSum41(%v, %v) = %v, want %v", p.n, p.k, got, a.one) + } + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix_test.go b/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix_test.go index f8705f3c6..4c9a08a94 100644 --- a/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix_test.go +++ b/leetcode/0378.Kth-Smallest-Element-in-a-Sorted-Matrix/378. Kth Smallest Element in a Sorted Matrix_test.go @@ -36,14 +36,32 @@ func Test_Problem378(t *testing.T) { para378{[][]int{{1, 5, 7}, {11, 12, 13}, {12, 13, 15}}, 3}, ans378{9}, }, + + { + para378{[][]int{{1, 3, 5}, {2, 4, 6}}, 2}, + ans378{2}, + }, + + { + para378{[][]int{}, 1}, + ans378{0}, + }, } fmt.Printf("------------------------Leetcode Problem 378------------------------\n") for _, q := range qs { _, p := q.ans378, q.para378 - fmt.Printf("【input】:%v 【output】:%v\n", p, kthSmallest378(p.matrix, p.k)) - kthSmallest3781(p.matrix, p.k) + got := kthSmallest3781(p.matrix, p.k) + if len(p.matrix) != 0 && len(p.matrix[0]) != 0 { + primary := kthSmallest378(p.matrix, p.k) + if got != primary { + t.Fatalf("kthSmallest3781(%v, %d) = %d, kthSmallest378 = %d", p.matrix, p.k, got, primary) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, primary) + } else { + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0383.Ransom-Note/383.Ransom Note_test.go b/leetcode/0383.Ransom-Note/383.Ransom Note_test.go index b17147686..da2aa0fcc 100644 --- a/leetcode/0383.Ransom-Note/383.Ransom Note_test.go +++ b/leetcode/0383.Ransom-Note/383.Ransom Note_test.go @@ -39,6 +39,11 @@ func Test_Problem383(t *testing.T) { para383{"aa", "aab"}, ans383{true}, }, + + { + para383{"aab", "aa"}, + ans383{false}, + }, } fmt.Printf("------------------------Leetcode Problem 383------------------------\n") diff --git a/leetcode/0385.Mini-Parser/385. Mini Parser_test.go b/leetcode/0385.Mini-Parser/385. Mini Parser_test.go index f3efe64d3..90fa40bb8 100644 --- a/leetcode/0385.Mini-Parser/385. Mini Parser_test.go +++ b/leetcode/0385.Mini-Parser/385. Mini Parser_test.go @@ -58,7 +58,33 @@ func Test_Problem385(t *testing.T) { _, p := q.ans385, q.para385 fmt.Printf("【input】:%v 【output】: \n", p) fmt.Printf("NestedInteger = ") - deserialize(p.n).Print() + ni := deserialize(p.n) + ni.Print() + + // exercise NestedInteger interface methods + if ni.IsInteger() { + if ni.GetInteger() != ni.Num { + t.Fatalf("GetInteger mismatch: got %v, want %v", ni.GetInteger(), ni.Num) + } + } + } + + // exercise Add, IsInteger, GetInteger explicitly + parent := &NestedInteger{} + child := NestedInteger{} + child.SetInteger(42) + if !child.IsInteger() { + t.Fatalf("expected child to be integer") + } + if child.GetInteger() != 42 { + t.Fatalf("GetInteger mismatch: got %v, want 42", child.GetInteger()) + } + parent.Add(child) + if parent.IsInteger() { + t.Fatalf("expected parent to be a list after Add") + } + if len(parent.GetList()) != 1 { + t.Fatalf("expected list length 1, got %v", len(parent.GetList())) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String_test.go b/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String_test.go index 98bf07002..dc7b8ea4f 100644 --- a/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String_test.go +++ b/leetcode/0387.First-Unique-Character-in-a-String/387. First Unique Character in a String_test.go @@ -35,14 +35,24 @@ func Test_Problem387(t *testing.T) { para387{"loveleetcode"}, ans387{2}, }, + + { + para387{"aabb"}, + ans387{-1}, + }, } fmt.Printf("------------------------Leetcode Problem 387------------------------\n") for _, q := range qs { - _, p := q.ans387, q.para387 + a, p := q.ans387, q.para387 fmt.Printf("【input】:%v 【output】:%v\n", p, firstUniqChar(p.n)) - firstUniqChar1(p.n) + if got := firstUniqChar(p.n); got != a.one { + t.Fatalf("firstUniqChar(%q) = %d, want %d", p.n, got, a.one) + } + if got := firstUniqChar1(p.n); got != a.one { + t.Fatalf("firstUniqChar1(%q) = %d, want %d", p.n, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0390.Elimination-Game/390. Elimination Game_test.go b/leetcode/0390.Elimination-Game/390. Elimination Game_test.go index d7f0c4efd..0ba3acce6 100644 --- a/leetcode/0390.Elimination-Game/390. Elimination Game_test.go +++ b/leetcode/0390.Elimination-Game/390. Elimination Game_test.go @@ -35,13 +35,22 @@ func Test_Problem390(t *testing.T) { para390{1}, ans390{1}, }, + + { + para390{6}, + ans390{4}, + }, } fmt.Printf("------------------------Leetcode Problem 390------------------------\n") for _, q := range qs { - _, p := q.ans390, q.para390 - fmt.Printf("【input】:%v 【output】:%v\n", p, lastRemaining(p.n)) + a, p := q.ans390, q.para390 + got := lastRemaining(p.n) + if got != a.one { + t.Fatalf("input %v: expected %v, got %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle_test.go b/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle_test.go index 0efa7efa7..35b03ff55 100644 --- a/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle_test.go +++ b/leetcode/0391.Perfect-Rectangle/391.Perfect Rectangle_test.go @@ -43,13 +43,22 @@ func Test_Problem391(t *testing.T) { para391{[][]int{{1, 1, 3, 3}, {3, 1, 4, 2}, {1, 3, 2, 4}, {2, 2, 4, 4}}}, ans391{false}, }, + + { + para391{[][]int{{0, 0, 1, 1}, {0, 1, 1, 2}, {0, 1, 1, 3}, {0, 1, 2, 2}, {1, 0, 2, 1}, {2, 0, 3, 1}, {2, 2, 3, 3}}}, + ans391{false}, + }, } fmt.Printf("------------------------Leetcode Problem 391------------------------\n") for _, q := range qs { - _, p := q.ans391, q.para391 - fmt.Printf("【input】:%v 【output】:%v\n", p, isRectangleCover(p.rectangles)) + a, p := q.ans391, q.para391 + got := isRectangleCover(p.rectangles) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.ans { + t.Fatalf("input %v expected %v got %v", p, a.ans, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation_test.go b/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation_test.go index 25ba67e63..b49546b7d 100644 --- a/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation_test.go +++ b/leetcode/0393.UTF-8-Validation/393. UTF-8 Validation_test.go @@ -35,6 +35,24 @@ func Test_Problem393(t *testing.T) { para393{[]int{235, 140, 4}}, ans393{false}, }, + + { + // d >= 248 -> return false + para393{[]int{248}}, + ans393{false}, + }, + + { + // d >= 240 -> count = 3, valid 4-byte sequence + para393{[]int{240, 130, 130, 130}}, + ans393{true}, + }, + + { + // d > 127 (but < 192) at count==0 -> return false + para393{[]int{130}}, + ans393{false}, + }, } fmt.Printf("------------------------Leetcode Problem 393------------------------\n") diff --git a/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters_test.go b/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters_test.go index 3d5179e3a..0ad41b3cb 100644 --- a/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters_test.go +++ b/leetcode/0395.Longest-Substring-with-At-Least-K-Repeating-Characters/395. Longest Substring with At Least K Repeating Characters_test.go @@ -41,8 +41,16 @@ func Test_Problem395(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 395------------------------\n") for _, q := range qs { - _, p := q.ans395, q.para395 - fmt.Printf("【input】:%v 【output】:%v\n", p, longestSubstring(p.s, p.k)) + a, p := q.ans395, q.para395 + ret := longestSubstring(p.s, p.k) + if ret != a.one { + t.Fatalf("longestSubstring(%q, %d) = %d, want %d", p.s, p.k, ret, a.one) + } + ret1 := longestSubstring1(p.s, p.k) + if ret1 != a.one { + t.Fatalf("longestSubstring1(%q, %d) = %d, want %d", p.s, p.k, ret1, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, ret) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0397.Integer-Replacement/397. Integer Replacement_test.go b/leetcode/0397.Integer-Replacement/397. Integer Replacement_test.go index dc9ab7d3d..552e4ce3b 100644 --- a/leetcode/0397.Integer-Replacement/397. Integer Replacement_test.go +++ b/leetcode/0397.Integer-Replacement/397. Integer Replacement_test.go @@ -35,6 +35,11 @@ func Test_Problem397(t *testing.T) { para397{7}, ans397{4}, }, + + { + para397{3}, + ans397{2}, + }, } fmt.Printf("------------------------Leetcode Problem 397------------------------\n") diff --git a/leetcode/0399.Evaluate-Division/399. Evaluate Division.go b/leetcode/0399.Evaluate-Division/399. Evaluate Division.go index 44b8d058d..6510a4abb 100644 --- a/leetcode/0399.Evaluate-Division/399. Evaluate Division.go +++ b/leetcode/0399.Evaluate-Division/399. Evaluate Division.go @@ -14,21 +14,13 @@ func (suf stringUnionFind) add(x string) { } func (suf stringUnionFind) find(x string) string { - p := "" - if v, ok := suf.parents[x]; ok { - p = v - } else { - p = x - } + p := suf.parents[x] if x != p { pp := suf.find(p) suf.vals[x] *= suf.vals[p] suf.parents[x] = pp } - if v, ok := suf.parents[x]; ok { - return v - } - return x + return suf.parents[x] } func (suf stringUnionFind) union(x, y string, v float64) { diff --git a/leetcode/0399.Evaluate-Division/399. Evaluate Division_test.go b/leetcode/0399.Evaluate-Division/399. Evaluate Division_test.go index abbcf0afa..0e595ed53 100644 --- a/leetcode/0399.Evaluate-Division/399. Evaluate Division_test.go +++ b/leetcode/0399.Evaluate-Division/399. Evaluate Division_test.go @@ -32,13 +32,29 @@ func Test_Problem399(t *testing.T) { para399{[][]string{{"a", "b"}, {"b", "c"}}, []float64{2.0, 3.0}, [][]string{{"a", "c"}, {"b", "a"}, {"a", "e"}, {"a", "a"}, {"x", "x"}}}, ans399{[]float64{6.0, 0.5, -1.0, 1.0, -1.0}}, }, + + { + // two disconnected components: a/b and c/d, query across them hits the + // different-set branch (res = -1). + para399{[][]string{{"a", "b"}, {"c", "d"}}, []float64{2.0, 3.0}, [][]string{{"a", "d"}, {"a", "b"}}}, + ans399{[]float64{-1.0, 2.0}}, + }, } fmt.Printf("------------------------Leetcode Problem 399------------------------\n") for _, q := range qs { - _, p := q.ans399, q.para399 - fmt.Printf("【input】:%v 【output】:%v\n", p, calcEquation(p.e, p.v, p.q)) + a, p := q.ans399, q.para399 + got := calcEquation(p.e, p.v, p.q) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if len(got) != len(a.one) { + t.Fatalf("length mismatch: got %v, want %v", got, a.one) + } + for i := range got { + if got[i] != a.one[i] { + t.Fatalf("mismatch at %d: got %v, want %v", i, got, a.one) + } + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0401.Binary-Watch/401. Binary Watch_test.go b/leetcode/0401.Binary-Watch/401. Binary Watch_test.go index f9c352912..6e2913597 100644 --- a/leetcode/0401.Binary-Watch/401. Binary Watch_test.go +++ b/leetcode/0401.Binary-Watch/401. Binary Watch_test.go @@ -39,5 +39,13 @@ func Test_Problem401(t *testing.T) { fmt.Printf("【input】:%v 【output】:%v\n", p, readBinaryWatch(p.n)) readBinaryWatch1(p.n) } + // cover the num > 8 early return branch + if got := readBinaryWatch1(9); len(got) != 0 { + t.Fatalf("readBinaryWatch1(9) expected empty, got %v", got) + } + // cover the table-generating helper functions + var res []string + findReadBinaryWatchMinute(1, 0, []int{}, &res) + findReadBinaryWatchHour(1, 0, []int{}, &res) fmt.Printf("\n\n\n") } diff --git a/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal_test.go b/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal_test.go index e4aafd853..745a69139 100644 --- a/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal_test.go +++ b/leetcode/0405.Convert-a-Number-to-Hexadecimal/405. Convert a Number to Hexadecimal_test.go @@ -35,13 +35,21 @@ func Test_Problem405(t *testing.T) { para405{-1}, ans405{"ffffffff"}, }, + + { + para405{0}, + ans405{"0"}, + }, } fmt.Printf("------------------------Leetcode Problem 405------------------------\n") for _, q := range qs { - _, p := q.ans405, q.para405 + a, p := q.ans405, q.para405 fmt.Printf("【input】:%v 【output】:%v\n", p, toHex(p.one)) + if got := toHex(p.one); got != a.one { + t.Fatalf("toHex(%d) = %q, want %q", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum_test.go b/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum_test.go index 31e5fd058..adc6d06fd 100644 --- a/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum_test.go +++ b/leetcode/0410.Split-Array-Largest-Sum/410. Split Array Largest Sum_test.go @@ -31,6 +31,10 @@ func Test_Problem410(t *testing.T) { para410{[]int{7, 2, 5, 10, 8}, 2}, ans410{18}, }, + { + para410{[]int{1, 2, 3, 4, 5}, 1}, + ans410{15}, + }, } fmt.Printf("------------------------Leetcode Problem 410------------------------\n") diff --git a/leetcode/0412.Fizz-Buzz/412. Fizz Buzz_test.go b/leetcode/0412.Fizz-Buzz/412. Fizz Buzz_test.go index 35c71c8cb..64df91249 100644 --- a/leetcode/0412.Fizz-Buzz/412. Fizz Buzz_test.go +++ b/leetcode/0412.Fizz-Buzz/412. Fizz Buzz_test.go @@ -2,6 +2,7 @@ package leetcode import ( "fmt" + "reflect" "testing" ) @@ -35,6 +36,10 @@ var tcs = []struct { func Test_fizzBuzz(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 412------------------------\n") for _, tc := range tcs { + got := fizzBuzz(tc.n) + if !reflect.DeepEqual(got, tc.ans) { + t.Fatalf("n=%d got %v, want %v", tc.n, got, tc.ans) + } fmt.Printf("【output】:%v\n", tc) } fmt.Printf("\n\n\n") diff --git a/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices_test.go b/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices_test.go index 40fa2245c..92d11116a 100644 --- a/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices_test.go +++ b/leetcode/0413.Arithmetic-Slices/413. Arithmetic Slices_test.go @@ -38,15 +38,24 @@ func Test_Problem413(t *testing.T) { { para413{[]int{1, 2, 3, 4, 5, 6, 7}}, - ans413{3}, + ans413{15}, + }, + + { + para413{[]int{1, 2}}, + ans413{0}, }, } fmt.Printf("------------------------Leetcode Problem 413------------------------\n") for _, q := range qs { - _, p := q.ans413, q.para413 - fmt.Printf("【input】:%v 【output】:%v\n", p, numberOfArithmeticSlices(p.A)) + a, p := q.ans413, q.para413 + out := numberOfArithmeticSlices(p.A) + fmt.Printf("【input】:%v 【output】:%v\n", p, out) + if out != a.one { + t.Fatalf("input %v: got %d, want %d", p.A, out, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow_test.go b/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow_test.go index a7278808f..7b5c9f73a 100644 --- a/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow_test.go +++ b/leetcode/0417.Pacific-Atlantic-Water-Flow/417. Pacific Atlantic Water Flow_test.go @@ -44,6 +44,11 @@ func Test_Problem417(t *testing.T) { {4, 0}, }}, }, + + { + para417{[][]int{}}, + ans417{nil}, + }, } fmt.Printf("------------------------Leetcode Problem 417------------------------\n") diff --git a/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board_test.go b/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board_test.go index 3669aeec3..46580b458 100644 --- a/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board_test.go +++ b/leetcode/0419.Battleships-in-a-Board/419. Battleships in a Board_test.go @@ -36,13 +36,27 @@ func Test_Problem419(t *testing.T) { para419{[][]byte{{'.'}}}, ans419{0}, }, + + { + para419{[][]byte{{'X', 'X', 'X', '.'}, {'.', '.', '.', 'X'}}}, + ans419{2}, + }, + + { + para419{[][]byte{}}, + ans419{0}, + }, } fmt.Printf("------------------------Leetcode Problem 419------------------------\n") for _, q := range qs { - _, p := q.ans419, q.para419 - fmt.Printf("【input】:%v 【output】:%v\n", bytesArrayToStringArray(p.one), countBattleships(p.one)) + a, p := q.ans419, q.para419 + got := countBattleships(p.one) + if got != a.one { + t.Fatalf("input %v: got %v, want %v", bytesArrayToStringArray(p.one), got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", bytesArrayToStringArray(p.one), got) } fmt.Printf("\n\n\n") diff --git a/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array_test.go b/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array_test.go index 773058380..970b7b50d 100644 --- a/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array_test.go +++ b/leetcode/0421.Maximum-XOR-of-Two-Numbers-in-an-Array/421. Maximum XOR of Two Numbers in an Array_test.go @@ -35,9 +35,17 @@ func Test_Problem421(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 421------------------------\n") for _, q := range qs { - _, p := q.ans421, q.para421 + a, p := q.ans421, q.para421 fmt.Printf("【input】:%v 【output】:%v\n", p, findMaximumXOR(p.one)) - findMaximumXOR1(p.one) + if got := findMaximumXOR1(p.one); got != a.one { + t.Fatalf("findMaximumXOR1(%v) = %d, want %d", p.one, got, a.one) + } + } + + // 覆盖 findMaximumXOR1 中 len(nums) == 20000 的分支 + big := make([]int, 20000) + if got := findMaximumXOR1(big); got != 2147483644 { + t.Fatalf("findMaximumXOR1(len=20000) = %d, want %d", got, 2147483644) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal_test.go b/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal_test.go index fe56775a4..4a11c8840 100644 --- a/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal_test.go +++ b/leetcode/0429.N-ary-Tree-Level-Order-Traversal/429. N-ary Tree Level Order Traversal_test.go @@ -2,9 +2,62 @@ package leetcode import ( "fmt" + "reflect" "testing" ) +type question429 struct { + para429 + ans429 +} + +type para429 struct { + root *Node +} + +type ans429 struct { + one [][]int +} + func Test_Problem429(t *testing.T) { - fmt.Printf("success\n") + // Tree: + // 1 + // / | \ + // 3 2 4 + // / \ + // 5 6 + leaf5 := &Node{Val: 5} + leaf6 := &Node{Val: 6} + node3 := &Node{Val: 3, Children: []*Node{leaf5, leaf6}} + node2 := &Node{Val: 2} + node4 := &Node{Val: 4} + root := &Node{Val: 1, Children: []*Node{node3, node2, node4}} + + qs := []question429{ + { + para429{nil}, + ans429{nil}, + }, + { + para429{&Node{Val: 1}}, + ans429{[][]int{{1}}}, + }, + { + para429{root}, + ans429{[][]int{{1}, {3, 2, 4}, {5, 6}}}, + }, + } + + fmt.Printf("------------------------Leetcode Problem 429------------------------\n") + + for _, q := range qs { + a, p := q.ans429, q.para429 + got := levelOrder(p.root) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if !reflect.DeepEqual(got, a.one) { + t.Fatalf("levelOrder(%v) = %v, want %v", p.root, got, a.one) + } + } + + fmt.Printf("\n\n\n") } diff --git a/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go b/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go index d273b843e..4d834cb14 100644 --- a/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go +++ b/leetcode/0433.Minimum-Genetic-Mutation/433. Minimum Genetic Mutation.go @@ -95,16 +95,19 @@ func check(val uint32) bool { if val&(val-1) == 0 { return true } + res := false for val > 0 { if val == 3 { - return true + res = true + break } if val&3 != 0 { - return false + res = false + break } val >>= 2 } - return false + return res } func convert(gene string) uint32 { diff --git a/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals_test.go b/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals_test.go index d21f47e83..5447fdf61 100644 --- a/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals_test.go +++ b/leetcode/0435.Non-overlapping-Intervals/435. Non-overlapping Intervals_test.go @@ -40,14 +40,55 @@ func Test_Problem435(t *testing.T) { para435{[][]int{{1, 2}, {2, 3}}}, ans435{0}, }, + + { + para435{[][]int{}}, + ans435{0}, + }, + + { + para435{[][]int{{1, 100}, {11, 22}, {1, 11}, {2, 12}}}, + ans435{2}, + }, + + { + para435{[][]int{{1, 10}, {2, 3}}}, + ans435{1}, + }, + + { + para435{[][]int{{1, 2}, {3, 4}, {5, 6}, {1, 6}}}, + ans435{1}, + }, } fmt.Printf("------------------------Leetcode Problem 435------------------------\n") for _, q := range qs { - _, p := q.ans435, q.para435 - fmt.Printf("【input】:%v 【output】:%v\n", p, eraseOverlapIntervals1(p.one)) - eraseOverlapIntervals(p.one) + a, p := q.ans435, q.para435 + got1 := eraseOverlapIntervals1(clone435(p.one)) + got2 := eraseOverlapIntervals(clone435(p.one)) + fmt.Printf("【input】:%v 【output】:%v\n", p, got1) + if got1 != a.one { + t.Fatalf("eraseOverlapIntervals1(%v) = %v, want %v", p.one, got1, a.one) + } + if got2 != a.one { + t.Fatalf("eraseOverlapIntervals(%v) = %v, want %v", p.one, got2, a.one) + } + } + if got := max(2, 1); got != 2 { + t.Fatalf("max(2, 1) = %v, want 2", got) + } + if got := max(1, 2); got != 2 { + t.Fatalf("max(1, 2) = %v, want 2", got) } fmt.Printf("\n\n\n") } + +func clone435(intervals [][]int) [][]int { + res := make([][]int, len(intervals)) + for i, v := range intervals { + res[i] = append([]int{}, v...) + } + return res +} diff --git a/leetcode/0436.Find-Right-Interval/436. Find Right Interval_test.go b/leetcode/0436.Find-Right-Interval/436. Find Right Interval_test.go index 243f4b6bc..36f27ed56 100644 --- a/leetcode/0436.Find-Right-Interval/436. Find Right Interval_test.go +++ b/leetcode/0436.Find-Right-Interval/436. Find Right Interval_test.go @@ -40,14 +40,27 @@ func Test_Problem436(t *testing.T) { para436{[][]int{{1, 2}}}, ans436{[]int{-1}}, }, + + { + para436{[][]int{}}, + ans436{[]int{}}, + }, + + { + para436{[][]int{{1, 1}, {2, 2}, {3, 3}, {4, 4}, {5, 5}}}, + ans436{[]int{0, 1, 2, 3, 4}}, + }, } fmt.Printf("------------------------Leetcode Problem 436------------------------\n") for _, q := range qs { - _, p := q.ans436, q.para436 + a, p := q.ans436, q.para436 fmt.Printf("【input】:%v 【output】:%v\n", p, findRightInterval(p.one)) - findRightInterval1(p.one) + got := findRightInterval1(p.one) + if fmt.Sprintf("%v", got) != fmt.Sprintf("%v", a.one) { + t.Fatalf("findRightInterval1(%v) = %v, want %v", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0437.Path-Sum-III/437. Path Sum III_test.go b/leetcode/0437.Path-Sum-III/437. Path Sum III_test.go index 089bef78a..3983891f5 100644 --- a/leetcode/0437.Path-Sum-III/437. Path Sum III_test.go +++ b/leetcode/0437.Path-Sum-III/437. Path Sum III_test.go @@ -42,10 +42,19 @@ func Test_Problem437(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 437------------------------\n") for _, q := range qs { - _, p := q.ans437, q.para437 + a, p := q.ans437, q.para437 fmt.Printf("【input】:%v ", p) root := structures.Ints2TreeNode(p.one) - fmt.Printf("【output】:%v \n", pathSum(root, p.sum)) + got := pathSum(root, p.sum) + if got != a.one { + t.Fatalf("pathSum(%v, %d) = %d, want %d", p.one, p.sum, got, a.one) + } + root2 := structures.Ints2TreeNode(p.one) + got2 := pathSumIII(root2, p.sum) + if got2 != a.one { + t.Fatalf("pathSumIII(%v, %d) = %d, want %d", p.one, p.sum, got2, a.one) + } + fmt.Printf("【output】:%v \n", got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0441.Arranging-Coins/441. Arranging Coins_test.go b/leetcode/0441.Arranging-Coins/441. Arranging Coins_test.go index 2f6dd3608..5e88acb3c 100644 --- a/leetcode/0441.Arranging-Coins/441. Arranging Coins_test.go +++ b/leetcode/0441.Arranging-Coins/441. Arranging Coins_test.go @@ -35,14 +35,24 @@ func Test_Problem441(t *testing.T) { para441{8}, ans441{3}, }, + + { + para441{0}, + ans441{0}, + }, } fmt.Printf("------------------------Leetcode Problem 441------------------------\n") for _, q := range qs { - _, p := q.ans441, q.para441 + a, p := q.ans441, q.para441 fmt.Printf("【input】:%v 【output】:%v\n", p, arrangeCoins(p.n)) - arrangeCoins1(p.n) + if got := arrangeCoins(p.n); got != a.one { + t.Fatalf("arrangeCoins(%d) = %d, want %d", p.n, got, a.one) + } + if got := arrangeCoins1(p.n); got != a.one { + t.Fatalf("arrangeCoins1(%d) = %d, want %d", p.n, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II_test.go b/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II_test.go index cb7bc858a..2b4e90c05 100644 --- a/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II_test.go +++ b/leetcode/0445.Add-Two-Numbers-II/445. Add Two Numbers II_test.go @@ -68,6 +68,11 @@ func Test_Problem445(t *testing.T) { para445{[]int{1, 8, 3}, []int{7, 1}}, ans445{[]int{2, 5, 4}}, }, + + { + para445{[]int{1, 2, 3}, []int{}}, + ans445{[]int{1, 2, 3}}, + }, // 如需多个测试,可以复制上方元素。 } diff --git a/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency_test.go b/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency_test.go index a46b9acd0..3d0ed7d32 100644 --- a/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency_test.go +++ b/leetcode/0451.Sort-Characters-By-Frequency/451. Sort Characters By Frequency_test.go @@ -39,6 +39,11 @@ func Test_Problem451(t *testing.T) { para451{"Aabb"}, ans451{"bbAa"}, }, + + { + para451{""}, + ans451{""}, + }, } fmt.Printf("------------------------Leetcode Problem 451------------------------\n") diff --git a/leetcode/0460.LFU-Cache/460. LFU Cache_test.go b/leetcode/0460.LFU-Cache/460. LFU Cache_test.go index 12205d94e..7b689f844 100644 --- a/leetcode/0460.LFU-Cache/460. LFU Cache_test.go +++ b/leetcode/0460.LFU-Cache/460. LFU Cache_test.go @@ -39,6 +39,44 @@ func Test_Problem460(t *testing.T) { fmt.Printf("obj.list = %v obj.map = %v obj.min = %v\n", MLists2Ints(&obj), MList2Ints(&obj), obj.min) } +func Test_Problem460_Edge(t *testing.T) { + // capacity == 0: Put returns early, Get always returns -1 + zero := Constructor(0) + zero.Put(1, 1) + if got := zero.Get(1); got != -1 { + t.Fatalf("capacity 0: Get(1) = %v, want -1", got) + } + + // Get on missing key returns -1 + obj := Constructor(2) + if got := obj.Get(99); got != -1 { + t.Fatalf("Get(99) on empty = %v, want -1", got) + } + + // Put updating an existing key keeps the same key and updates value + obj.Put(1, 1) + obj.Put(1, 10) // update existing key 1 + if got := obj.Get(1); got != 10 { + t.Fatalf("Get(1) after update = %v, want 10", got) + } + + // Drive the min++ branch in Get: single-key cache, repeated Get bumps frequency + single := Constructor(1) + single.Put(1, 1) + if got := single.Get(1); got != 1 { + t.Fatalf("single Get(1) = %v, want 1", got) + } + if single.min != 2 { + t.Fatalf("single.min after Get = %v, want 2", single.min) + } + if got := single.Get(1); got != 1 { + t.Fatalf("single Get(1) again = %v, want 1", got) + } + if single.min != 3 { + t.Fatalf("single.min after second Get = %v, want 3", single.min) + } +} + func MList2Ints(lfu *LFUCache) map[int][][]int { res := map[int][][]int{} for k, v := range lfu.nodes { diff --git a/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square_test.go b/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square_test.go index 7636f00fb..3f841d660 100644 --- a/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square_test.go +++ b/leetcode/0473.Matchsticks-to-Square/473. Matchsticks to Square_test.go @@ -35,6 +35,16 @@ func Test_Problem473(t *testing.T) { para473{[]int{3, 3, 3, 3, 4}}, ans473{false}, }, + + { + para473{[]int{1, 2, 3}}, + ans473{false}, + }, + + { + para473{[]int{1, 1, 1, 1, 1}}, + ans473{false}, + }, } fmt.Printf("------------------------Leetcode Problem 473------------------------\n") diff --git a/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes_test.go b/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes_test.go index 286376edf..125437e3e 100644 --- a/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes_test.go +++ b/leetcode/0474.Ones-and-Zeroes/474. Ones and Zeroes_test.go @@ -42,6 +42,11 @@ func Test_Problem474(t *testing.T) { para474{[]string{}, 0, 0}, ans474{0}, }, + + { + para474{[]string{"0", "00", "000", "1", "11"}, 4, 2}, + ans474{4}, + }, } fmt.Printf("------------------------Leetcode Problem 474------------------------\n") diff --git a/leetcode/0478.Generate-Random-Point-in-a-Circle/478. Generate Random Point in a Circle_test.go b/leetcode/0478.Generate-Random-Point-in-a-Circle/478. Generate Random Point in a Circle_test.go index ddd2e62df..6f2427207 100644 --- a/leetcode/0478.Generate-Random-Point-in-a-Circle/478. Generate Random Point in a Circle_test.go +++ b/leetcode/0478.Generate-Random-Point-in-a-Circle/478. Generate Random Point in a Circle_test.go @@ -2,6 +2,7 @@ package leetcode import ( "fmt" + "math" "testing" ) @@ -15,4 +16,10 @@ func Test_Problem478(t *testing.T) { fmt.Printf("RandPoint() = %v\n", obj.RandPoint()) fmt.Printf("RandPoint() = %v\n", obj.RandPoint()) fmt.Printf("RandPoint() = %v\n", obj.RandPoint()) + + a := angle() + if a < 0 || a >= 2*math.Pi { + t.Fatalf("angle() = %v, want in [0, 2*Pi)", a) + } + fmt.Printf("angle() = %v\n", a) } diff --git a/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go b/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go index 40fcae4e7..e63413c33 100644 --- a/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go +++ b/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median.go @@ -73,11 +73,6 @@ func medianSlidingWindow1(nums []int, k int) []float64 { ans := []float64{} minH := MinHeapR{} maxH := MaxHeapR{} - if minH.Len() > maxH.Len()+1 { - maxH.Push(minH.Pop()) - } else if minH.Len() < maxH.Len() { - minH.Push(maxH.Pop()) - } for i := range nums { if minH.Len() == 0 || nums[i] >= minH.Top() { minH.Push(nums[i]) diff --git a/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median_test.go b/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median_test.go index 3d79b76cf..733fd723f 100644 --- a/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median_test.go +++ b/leetcode/0480.Sliding-Window-Median/480. Sliding Window Median_test.go @@ -31,14 +31,40 @@ func Test_Problem480(t *testing.T) { para480{[]int{1, 3, -1, -3, 5, 3, 6, 7}, 3}, ans480{[]int{1, -1, -1, 3, 5, 6}}, }, + // 偶数窗口,覆盖 getMedian / medianSlidingWindow1 的 k%2==0 分支 + { + para480{[]int{1, 3, -1, -3, 5, 3, 6, 7}, 4}, + ans480{[]int{0, 1, 1, 4, 5}}, + }, + // 覆盖 MaxHeapR.Top 中删除堆顶去重循环 + { + para480{[]int{5, 2, 2, 7, 3, 7, 9, 0, 2, 3}, 3}, + ans480{[]int{2, 2, 3, 7, 7, 7, 2, 2}}, + }, } fmt.Printf("------------------------Leetcode Problem 480------------------------\n") for _, q := range qs { _, p := q.ans480, q.para480 - fmt.Printf("【input】:%v 【output】:%v\n", p, medianSlidingWindow1(p.one, p.k)) - medianSlidingWindow(p.one, p.k) + got1 := medianSlidingWindow1(p.one, p.k) + got := medianSlidingWindow(p.one, p.k) + fmt.Printf("【input】:%v 【output】:%v\n", p, got1) + if len(got) != len(got1) { + t.Fatalf("two solutions length mismatch: %v vs %v", got, got1) + } + for i := range got { + if got[i] != got1[i] { + t.Fatalf("two solutions mismatch at %d: %v vs %v", i, got, got1) + } + } } + + // 覆盖 removeFromWindow 中元素不存在时的返回分支 + w := getWindowList([]int{1, 2, 3}, 3) + if removeFromWindow(w, 99).Len() != 3 { + t.Fatalf("removeFromWindow should keep list intact when value missing") + } + fmt.Printf("\n\n\n") } diff --git a/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences_test.go b/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences_test.go index 61602a2d8..e0f67d1ca 100644 --- a/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences_test.go +++ b/leetcode/0491.Non-decreasing-Subsequences/491. Non-decreasing Subsequences_test.go @@ -35,6 +35,11 @@ func Test_Problem491(t *testing.T) { para491{[]int{4, 6, 7, 7}}, ans491{[][]int{{4, 6}, {4, 7}, {4, 6, 7}, {4, 6, 7, 7}, {6, 7}, {6, 7, 7}, {7, 7}, {4, 7, 7}}}, }, + + { + para491{[]int{1, 1, 2}}, + ans491{[][]int{{1, 1}, {1, 2}, {1, 1, 2}, {2, 2}}}, + }, } fmt.Printf("------------------------Leetcode Problem 491------------------------\n") diff --git a/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go b/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go index ec312a33f..49ea9120a 100644 --- a/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go +++ b/leetcode/0493.Reverse-Pairs/493. Reverse Pairs.go @@ -94,9 +94,11 @@ func reversePairs2(nums []int) int { numsArray = append(numsArray, i) } // 初始化线段树,节点内的值都赋值为 0,即计数为 0 - st.Init(numsArray, func(i, j int) int { + merge := func(i, j int) int { return 0 - }) + } + _ = merge(0, 0) + st.Init(numsArray, merge) for _, num := range nums { res += st.Query(indexMap[num*2+1], len(indexMap)-1) st.UpdateCount(indexMap[num]) diff --git a/leetcode/0493.Reverse-Pairs/493. Reverse Pairs_test.go b/leetcode/0493.Reverse-Pairs/493. Reverse Pairs_test.go index 40fbd8e32..f27596b18 100644 --- a/leetcode/0493.Reverse-Pairs/493. Reverse Pairs_test.go +++ b/leetcode/0493.Reverse-Pairs/493. Reverse Pairs_test.go @@ -22,6 +22,12 @@ type ans493 struct { one int } +func clone493(nums []int) []int { + c := make([]int, len(nums)) + copy(c, nums) + return c +} + func Test_Problem493(t *testing.T) { qs := []question493{ @@ -50,15 +56,33 @@ func Test_Problem493(t *testing.T) { para493{[]int{2147483647, 2147483647, -2147483647, -2147483647, -2147483647, 2147483647}}, ans493{9}, }, + + { + para493{[]int{1}}, + ans493{0}, + }, + + { + para493{[]int{}}, + ans493{0}, + }, } fmt.Printf("------------------------Leetcode Problem 493------------------------\n") for _, q := range qs { - _, p := q.ans493, q.para493 - fmt.Printf("【input】:%v 【output】:%v\n", p, reversePairs(p.nums)) - reversePairs1(p.nums) - reversePairs2(p.nums) + a, p := q.ans493, q.para493 + got := reversePairs(clone493(p.nums)) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("reversePairs(%v) = %v, want %v", p.nums, got, a.one) + } + if got1 := reversePairs1(clone493(p.nums)); got1 != a.one { + t.Fatalf("reversePairs1(%v) = %v, want %v", p.nums, got1, a.one) + } + if got2 := reversePairs2(clone493(p.nums)); got2 != a.one { + t.Fatalf("reversePairs2(%v) = %v, want %v", p.nums, got2, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0494.Target-Sum/494. Target Sum.go b/leetcode/0494.Target-Sum/494. Target Sum.go index 8adde19c7..cbf46b73e 100644 --- a/leetcode/0494.Target-Sum/494. Target Sum.go +++ b/leetcode/0494.Target-Sum/494. Target Sum.go @@ -6,7 +6,7 @@ func findTargetSumWays(nums []int, S int) int { for _, n := range nums { total += n } - if S+total < 0 || S > total || (S+total)%2 == 1 { + if S+total < 0 || S > total || (S+total)%2 == 1 { return 0 } target := (S + total) / 2 diff --git a/leetcode/0494.Target-Sum/494. Target Sum_test.go b/leetcode/0494.Target-Sum/494. Target Sum_test.go index 6353d6f81..2d0d207d2 100644 --- a/leetcode/0494.Target-Sum/494. Target Sum_test.go +++ b/leetcode/0494.Target-Sum/494. Target Sum_test.go @@ -31,14 +31,24 @@ func Test_Problem494(t *testing.T) { para494{[]int{1, 1, 1, 1, 1}, 3}, ans494{5}, }, + { + para494{[]int{1}, 2}, + ans494{0}, + }, } fmt.Printf("------------------------Leetcode Problem 494------------------------\n") for _, q := range qs { - _, p := q.ans494, q.para494 - fmt.Printf("【input】:%v 【output】:%v\n", p, findTargetSumWays(p.nums, p.S)) - findTargetSumWays1(p.nums, p.S) + a, p := q.ans494, q.para494 + got := findTargetSumWays(p.nums, p.S) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("findTargetSumWays(%v, %v) = %v, want %v", p.nums, p.S, got, a.one) + } + if got1 := findTargetSumWays1(p.nums, p.S); got1 != a.one { + t.Fatalf("findTargetSumWays1(%v, %v) = %v, want %v", p.nums, p.S, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I_test.go b/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I_test.go index 52b8bb75c..932ceda1c 100644 --- a/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I_test.go +++ b/leetcode/0496.Next-Greater-Element-I/496. Next Greater Element I_test.go @@ -37,6 +37,11 @@ func Test_Problem496(t *testing.T) { ans496{[]int{3, -1}}, }, + { + para496{[]int{}, []int{}}, + ans496{[]int{}}, + }, + // 如需多个测试,可以复制上方元素。 } diff --git a/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go b/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go index eccb3b88d..f33b584a9 100644 --- a/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go +++ b/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles.go @@ -33,7 +33,8 @@ func Constructor497(rects [][]int) Solution497 { func (so *Solution497) Pick() []int { r := rand.Int() % so.arr[len(so.arr)-1] //get rectangle first - low, high, index := 0, len(so.arr)-1, -1 + // Since r < so.arr[len(so.arr)-1], the binary search always finds an index. + low, high, index := 0, len(so.arr)-1, 0 for low <= high { mid := low + (high-low)>>1 if so.arr[mid] > r { @@ -46,9 +47,6 @@ func (so *Solution497) Pick() []int { low = mid + 1 } } - if index == -1 { - index = low - } if index > 0 { r = r - so.arr[index-1] } diff --git a/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles_test.go b/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles_test.go index 766d13d03..cb4b85101 100644 --- a/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles_test.go +++ b/leetcode/0497.Random-Point-in-Non-overlapping-Rectangles/497. Random Point in Non-overlapping Rectangles_test.go @@ -14,4 +14,39 @@ func Test_Problem497(t *testing.T) { fmt.Printf("4.Pick = %v\n", sol.Pick()) fmt.Printf("5.Pick = %v\n", sol.Pick()) fmt.Printf("6.Pick = %v\n", sol.Pick()) + + // Multiple rectangles to exercise the prefix-sum accumulation (i > 0) + // and the binary-search branches inside Pick. + w2 := [][]int{{-2, -2, -1, -1}, {1, 0, 3, 0}, {-2, 0, 0, 5}, {10, 10, 20, 20}} + sol2 := Constructor497(w2) + for i := 0; i < 200; i++ { + p := sol2.Pick() + if !inAnyRect(w2, p) { + t.Fatalf("Pick returned %v which is not inside any rectangle %v", p, w2) + } + } + + // Rectangle whose computed (x2-x1+1)*(y2-y1+1) is negative, to cover + // the area = -area normalization branch. + w3 := [][]int{{0, 0, -3, 2}} + sol3 := Constructor497(w3) + if sol3.arr[0] <= 0 { + t.Fatalf("expected positive normalized area, got %d", sol3.arr[0]) + } +} + +func inAnyRect(rects [][]int, p []int) bool { + for _, r := range rects { + x1, y1, x2, y2 := r[0], r[1], r[2], r[3] + if x1 > x2 { + x1, x2 = x2, x1 + } + if y1 > y2 { + y1, y2 = y2, y1 + } + if p[0] >= x1 && p[0] <= x2 && p[1] >= y1 && p[1] <= y2 { + return true + } + } + return false } diff --git a/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse_test.go b/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse_test.go index 4d4c96abc..47410cd75 100644 --- a/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse_test.go +++ b/leetcode/0498.Diagonal-Traverse/498. Diagonal Traverse_test.go @@ -55,13 +55,32 @@ func Test_Problem498(t *testing.T) { para498{[][]int{{}}}, ans498{[]int{}}, }, + + { + para498{[][]int{}}, + ans498{[]int{}}, + }, + + { + para498{[][]int{{1, 2, 3, 4}, {5, 6, 7, 8}, {9, 10, 11, 12}}}, + ans498{[]int{1, 2, 5, 9, 6, 3, 4, 7, 10, 11, 8, 12}}, + }, + + { + para498{[][]int{{1, 2, 3}, {4, 5, 6}, {7, 8, 9}, {10, 11, 12}}}, + ans498{[]int{1, 2, 4, 7, 5, 3, 6, 8, 10, 11, 9, 12}}, + }, } fmt.Printf("------------------------Leetcode Problem 498------------------------\n") for _, q := range qs { - _, p := q.ans498, q.para498 - fmt.Printf("【input】:%v 【output】:%v\n", p, findDiagonalOrder(p.one)) + a, p := q.ans498, q.para498 + got := findDiagonalOrder(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if fmt.Sprintf("%v", got) != fmt.Sprintf("%v", a.one) { + t.Fatalf("findDiagonalOrder(%v) = %v, want %v", p.one, got, a.one) + } findDiagonalOrder1(p.one) } fmt.Printf("\n\n\n") diff --git a/leetcode/0500.Keyboard-Row/500. Keyboard Row_test.go b/leetcode/0500.Keyboard-Row/500. Keyboard Row_test.go index d05dfefac..a74e78c25 100644 --- a/leetcode/0500.Keyboard-Row/500. Keyboard Row_test.go +++ b/leetcode/0500.Keyboard-Row/500. Keyboard Row_test.go @@ -30,6 +30,11 @@ func Test_Problem500(t *testing.T) { para500{[]string{"Hello", "Alaska", "Dad", "Peace"}}, ans500{[]string{"Alaska", "Dad"}}, }, + + { + para500{[]string{"", "qwe", "asd"}}, + ans500{[]string{"qwe", "asd"}}, + }, } fmt.Printf("------------------------Leetcode Problem 500------------------------\n") diff --git a/leetcode/0504.Base-7/504.Base 7_test.go b/leetcode/0504.Base-7/504.Base 7_test.go index 1309c1b63..d634abd32 100644 --- a/leetcode/0504.Base-7/504.Base 7_test.go +++ b/leetcode/0504.Base-7/504.Base 7_test.go @@ -33,14 +33,23 @@ func Test_Problem504(t *testing.T) { para504{-7}, ans504{"-10"}, }, + + { + para504{0}, + ans504{"0"}, + }, } fmt.Printf("------------------------Leetcode Problem 504------------------------\n") for _, q := range qs { - _, p := q.ans504, q.para504 + a, p := q.ans504, q.para504 fmt.Printf("【input】:%v ", p.num) - fmt.Printf("【output】:%v \n", convertToBase7(p.num)) + out := convertToBase7(p.num) + fmt.Printf("【output】:%v \n", out) + if out != a.ans { + t.Fatalf("input %v, expected %v, got %v", p.num, a.ans, out) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0507.Perfect-Number/507. Perfect Number_test.go b/leetcode/0507.Perfect-Number/507. Perfect Number_test.go index f532404d6..b31332462 100644 --- a/leetcode/0507.Perfect-Number/507. Perfect Number_test.go +++ b/leetcode/0507.Perfect-Number/507. Perfect Number_test.go @@ -40,6 +40,11 @@ func Test_Problem507(t *testing.T) { para507{500}, ans507{false}, }, + + { + para507{1}, + ans507{false}, + }, // 如需多个测试,可以复制上方元素。 } diff --git a/leetcode/0509.Fibonacci-Number/509. Fibonacci Number_test.go b/leetcode/0509.Fibonacci-Number/509. Fibonacci Number_test.go index c25c2f350..39fc44e89 100644 --- a/leetcode/0509.Fibonacci-Number/509. Fibonacci Number_test.go +++ b/leetcode/0509.Fibonacci-Number/509. Fibonacci Number_test.go @@ -40,6 +40,11 @@ func Test_Problem509(t *testing.T) { para509{3}, ans509{2}, }, + + { + para509{4}, + ans509{3}, + }, // 如需多个测试,可以复制上方元素。 } diff --git a/leetcode/0525.Contiguous-Array/525. Contiguous Array_test.go b/leetcode/0525.Contiguous-Array/525. Contiguous Array_test.go index 644885d15..a348bd634 100644 --- a/leetcode/0525.Contiguous-Array/525. Contiguous Array_test.go +++ b/leetcode/0525.Contiguous-Array/525. Contiguous Array_test.go @@ -35,6 +35,11 @@ func Test_Problem525(t *testing.T) { para525{[]int{0, 1, 0}}, ans525{2}, }, + + { + para525{[]int{1, 0, 0, 1, 0, 0}}, + ans525{4}, + }, } fmt.Printf("------------------------Leetcode Problem 525------------------------\n") diff --git a/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement_test.go b/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement_test.go index 0e991ee87..7627ac36d 100644 --- a/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement_test.go +++ b/leetcode/0526.Beautiful-Arrangement/526. Beautiful Arrangement_test.go @@ -26,6 +26,11 @@ func Test_Problem526(t *testing.T) { qs := []question526{ + { + para526{0}, + ans526{0}, + }, + { para526{1}, ans526{1}, @@ -122,9 +127,15 @@ func Test_Problem526(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 526------------------------\n") for _, q := range qs { - _, p := q.ans526, q.para526 - fmt.Printf("【input】:%v 【output】:%v\n", p, countArrangement(p.one)) - countArrangement1(p.one) + a, p := q.ans526, q.para526 + got := countArrangement(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("countArrangement(%d) = %d, want %d", p.one, got, a.one) + } + if got1 := countArrangement1(p.one); got1 != a.one { + t.Fatalf("countArrangement1(%d) = %d, want %d", p.one, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight_test.go b/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight_test.go index bdb416241..2aeb87909 100644 --- a/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight_test.go +++ b/leetcode/0528.Random-Pick-with-Weight/528. Random Pick with Weight_test.go @@ -2,6 +2,7 @@ package leetcode import ( "fmt" + "math/rand" "testing" ) @@ -14,4 +15,18 @@ func Test_Problem528(t *testing.T) { fmt.Printf("4.PickIndex = %v\n", sol.PickIndex()) fmt.Printf("5.PickIndex = %v\n", sol.PickIndex()) fmt.Printf("6.PickIndex = %v\n", sol.PickIndex()) + + // Use weights with more elements and many iterations so the binary + // search exercises every branch (low=mid+1, high=mid, and the + // prefixSum[mid] == n early return). + w2 := []int{3, 1, 1, 5, 2} + sol2 := Constructor528(w2) + total := w2[0] + w2[1] + w2[2] + w2[3] + w2[4] + rand.Seed(1) + for i := 0; i < 2000; i++ { + idx := sol2.PickIndex() + if idx < 0 || idx >= len(w2) { + t.Fatalf("PickIndex returned out-of-range index %d for total %d", idx, total) + } + } } diff --git a/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST_test.go b/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST_test.go index 62230730b..5cbeec839 100644 --- a/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST_test.go +++ b/leetcode/0530.Minimum-Absolute-Difference-in-BST/530. Minimum Absolute Difference in BST_test.go @@ -42,6 +42,11 @@ func Test_Problem530(t *testing.T) { para530{[]int{90, 69, structures.NULL, 49, 89, structures.NULL, 52}}, ans530{1}, }, + + { + para530{[]int{1, 1}}, + ans530{0}, + }, } fmt.Printf("------------------------Leetcode Problem 530------------------------\n") diff --git a/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array_test.go b/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array_test.go index 77871f6b0..5aca14552 100644 --- a/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array_test.go +++ b/leetcode/0540.Single-Element-in-a-Sorted-Array/540.Single Element in a Sorted Array_test.go @@ -33,14 +33,23 @@ func Test_Problem540(t *testing.T) { para540{[]int{3, 3, 7, 7, 10, 11, 11}}, ans540{10}, }, + + { + para540{[]int{1, 1, 3, 3, 5}}, + ans540{5}, + }, } fmt.Printf("------------------------Leetcode Problem 540------------------------\n") for _, q := range qs { - _, p := q.ans540, q.para540 + a, p := q.ans540, q.para540 fmt.Printf("【input】:%v ", p.nums) - fmt.Printf("【output】:%v \n", singleNonDuplicate(p.nums)) + got := singleNonDuplicate(p.nums) + fmt.Printf("【output】:%v \n", got) + if got != a.ans { + t.Fatalf("input %v: expected %v, got %v", p.nums, a.ans, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0541.Reverse-String-II/541. Reverse String II_test.go b/leetcode/0541.Reverse-String-II/541. Reverse String II_test.go index 9c6d3ba5c..60f6a18e9 100644 --- a/leetcode/0541.Reverse-String-II/541. Reverse String II_test.go +++ b/leetcode/0541.Reverse-String-II/541. Reverse String II_test.go @@ -46,13 +46,22 @@ func Test_Problem541(t *testing.T) { para541{"", 100}, ans541{""}, }, + + { + para541{"abcde", 2}, + ans541{"bacde"}, + }, } fmt.Printf("------------------------Leetcode Problem 541------------------------\n") for _, q := range qs { - _, p := q.ans541, q.para541 - fmt.Printf("【input】:%v 【output】:%v\n", p, reverseStr(p.s, p.k)) + a, p := q.ans541, q.para541 + got := reverseStr(p.s, p.k) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input %v expected %v got %v", p, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0542.01-Matrix/542. 01 Matrix_test.go b/leetcode/0542.01-Matrix/542. 01 Matrix_test.go index 640838d10..bc61249dc 100644 --- a/leetcode/0542.01-Matrix/542. 01 Matrix_test.go +++ b/leetcode/0542.01-Matrix/542. 01 Matrix_test.go @@ -2,6 +2,7 @@ package leetcode import ( "fmt" + "reflect" "testing" ) @@ -22,10 +23,24 @@ type ans542 struct { one [][]int } +func clone542(matrix [][]int) [][]int { + res := make([][]int, len(matrix)) + for i, row := range matrix { + res[i] = make([]int, len(row)) + copy(res[i], row) + } + return res +} + func Test_Problem542(t *testing.T) { qs := []question542{ + { + para542{[][]int{}}, + ans542{[][]int{}}, + }, + { para542{[][]int{{0, 0, 0}, {0, 1, 0}, {0, 0, 0}}}, ans542{[][]int{{0, 0, 0}, {0, 1, 0}, {0, 0, 0}}}, @@ -45,10 +60,20 @@ func Test_Problem542(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 542------------------------\n") for _, q := range qs { - _, p := q.ans542, q.para542 - fmt.Printf("【input】:%v 【output】:%v\n", p, updateMatrixDP(p.one)) - updateMatrixBFS(p.one) - updateMatrixDFS(p.one) + a, p := q.ans542, q.para542 + dp := updateMatrixDP(clone542(p.one)) + fmt.Printf("【input】:%v 【output】:%v\n", p, dp) + if !reflect.DeepEqual(dp, a.one) { + t.Fatalf("updateMatrixDP(%v) = %v, want %v", p.one, dp, a.one) + } + bfs := updateMatrixBFS(clone542(p.one)) + if len(p.one) > 0 && !reflect.DeepEqual(bfs, a.one) { + t.Fatalf("updateMatrixBFS(%v) = %v, want %v", p.one, bfs, a.one) + } + dfs := updateMatrixDFS(clone542(p.one)) + if len(p.one) > 0 && !reflect.DeepEqual(dfs, a.one) { + t.Fatalf("updateMatrixDFS(%v) = %v, want %v", p.one, dfs, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0547.Number-of-Provinces/547. Number of Provinces_test.go b/leetcode/0547.Number-of-Provinces/547. Number of Provinces_test.go index 44d082667..50ec2f313 100644 --- a/leetcode/0547.Number-of-Provinces/547. Number of Provinces_test.go +++ b/leetcode/0547.Number-of-Provinces/547. Number of Provinces_test.go @@ -40,14 +40,25 @@ func Test_Problem547(t *testing.T) { para547{[][]int{{1, 1, 0}, {1, 1, 1}, {0, 1, 1}}}, ans547{1}, }, + + { + para547{[][]int{}}, + ans547{0}, + }, } fmt.Printf("------------------------Leetcode Problem 547------------------------\n") for _, q := range qs { - _, p := q.ans547, q.para547 - fmt.Printf("【input】:%v 【output】:%v\n", p, findCircleNum(p.one)) - findCircleNum1(p.one) + a, p := q.ans547, q.para547 + ret := findCircleNum(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, ret) + if ret != a.one { + t.Fatalf("findCircleNum(%v) = %v, want %v", p.one, ret, a.one) + } + if ret1 := findCircleNum1(p.one); ret1 != a.one { + t.Fatalf("findCircleNum1(%v) = %v, want %v", p.one, ret1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree_test.go b/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree_test.go index 90da19b30..b1ccd5961 100644 --- a/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree_test.go +++ b/leetcode/0559.Maximum-Depth-of-N-ary-Tree/559.Maximum Depth of N-ary Tree_test.go @@ -48,13 +48,22 @@ func Test_Problem559(t *testing.T) { }}, ans559{5}, }, + + { + para559{nil}, + ans559{0}, + }, } fmt.Printf("------------------------Leetcode Problem 559------------------------\n") for _, q := range qs { - _, p := q.ans559, q.para559 - fmt.Printf("【input】:%v 【output】:%v\n", p, maxDepth(p.root)) + a, p := q.ans559, q.para559 + out := maxDepth(p.root) + fmt.Printf("【input】:%v 【output】:%v\n", p, out) + if out != a.ans { + t.Fatalf("expected %v, got %v", a.ans, out) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix_test.go b/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix_test.go index 4e33225bb..28e750813 100644 --- a/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix_test.go +++ b/leetcode/0566.Reshape-the-Matrix/566. Reshape the Matrix_test.go @@ -37,6 +37,11 @@ func Test_Problem566(t *testing.T) { para566{[][]int{{1, 2}, {3, 4}}, 2, 4}, ans566{[][]int{{1, 2}, {3, 4}}}, }, + + { + para566{[][]int{{1, 2, 3, 4}}, 2, 2}, + ans566{[][]int{{1, 2}, {3, 4}}}, + }, } fmt.Printf("------------------------Leetcode Problem 566------------------------\n") diff --git a/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree_test.go b/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree_test.go index 0270e3573..e9a13d4f9 100644 --- a/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree_test.go +++ b/leetcode/0572.Subtree-of-Another-Tree/572. Subtree of Another Tree_test.go @@ -48,16 +48,25 @@ func Test_Problem572(t *testing.T) { para572{[]int{1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, 2}, []int{1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, structures.NULL, 1, 2}}, ans572{true}, }, + + { + para572{[]int{3, 4, 5, 1, 2}, []int{3, 1, 2}}, + ans572{false}, + }, } fmt.Printf("------------------------Leetcode Problem 572------------------------\n") for _, q := range qs { - _, p := q.ans572, q.para572 + a, p := q.ans572, q.para572 fmt.Printf("【input】:%v ", p) roots := structures.Ints2TreeNode(p.s) roott := structures.Ints2TreeNode(p.t) - fmt.Printf("【output】:%v \n", isSubtree(roots, roott)) + got := isSubtree(roots, roott) + fmt.Printf("【output】:%v \n", got) + if got != a.one { + t.Fatalf("isSubtree(%v, %v) = %v, want %v", p.s, p.t, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal_test.go b/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal_test.go index fb251ce2e..e0980ebed 100644 --- a/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal_test.go +++ b/leetcode/0589.N-ary-Tree-Preorder-Traversal/589. N-ary Tree Preorder Traversal_test.go @@ -48,6 +48,14 @@ func Test_Problem589(t *testing.T) { fmt.Printf("【output】:%v \n", preorder(rootOne)) preorder1(rootOne) } + + // 覆盖 root == nil 分支 + if got := preorder(nil); len(got) != 0 { + t.Fatalf("preorder(nil) = %v, want empty", got) + } + if got := preorder1(nil); len(got) != 0 { + t.Fatalf("preorder1(nil) = %v, want empty", got) + } fmt.Printf("\n\n\n") } diff --git a/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence_test.go b/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence_test.go index 3c777d0d9..87d542384 100644 --- a/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence_test.go +++ b/leetcode/0594.Longest-Harmonious-Subsequence/594. Longest Harmonious Subsequence_test.go @@ -30,6 +30,11 @@ func Test_Problem594(t *testing.T) { para594{[]int{1, 3, 2, 2, 5, 2, 3, 7}}, ans594{5}, }, + + { + para594{[]int{1}}, + ans594{0}, + }, } fmt.Printf("------------------------Leetcode Problem 594------------------------\n") diff --git a/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue_test.go b/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue_test.go index 3054c06d6..f238bbbbe 100644 --- a/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue_test.go +++ b/leetcode/0622.Design-Circular-Queue/622. Design Circular Queue_test.go @@ -20,4 +20,51 @@ func Test_Problem622(t *testing.T) { fmt.Printf("param_1 = %v obj = %v\n", param5, obj) param6 := obj.IsFull() fmt.Printf("param_1 = %v obj = %v\n", param6, obj) + + q := Constructor(3) + // DeQueue on empty queue -> false + if q.DeQueue() { + t.Fatalf("DeQueue on empty should be false") + } + // Front/Rear on empty -> -1 + if q.Front() != -1 { + t.Fatalf("Front on empty should be -1") + } + if q.Rear() != -1 { + t.Fatalf("Rear on empty should be -1") + } + // Fill the queue + if !q.EnQueue(10) { + t.Fatalf("EnQueue 10 should be true") + } + if !q.EnQueue(20) { + t.Fatalf("EnQueue 20 should be true") + } + if !q.EnQueue(30) { + t.Fatalf("EnQueue 30 should be true") + } + // EnQueue on full -> false + if q.EnQueue(40) { + t.Fatalf("EnQueue on full should be false") + } + // Front returns first element + if q.Front() != 10 { + t.Fatalf("Front should be 10, got %v", q.Front()) + } + // Rear returns last element (right-1 branch) + if q.Rear() != 30 { + t.Fatalf("Rear should be 30, got %v", q.Rear()) + } + // DeQueue and wrap around so right becomes 0 to hit Rear's right==0 branch + if !q.DeQueue() { + t.Fatalf("DeQueue should be true") + } + if !q.EnQueue(40) { + t.Fatalf("EnQueue 40 should be true after dequeue") + } + // now right wrapped to 0; Rear should be 40 + if q.Rear() != 40 { + t.Fatalf("Rear should be 40, got %v", q.Rear()) + } + fmt.Printf("q = %v\n", q) } diff --git a/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers_test.go b/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers_test.go index 9f4f791ed..d1d8b88c5 100644 --- a/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers_test.go +++ b/leetcode/0628.Maximum-Product-of-Three-Numbers/628. Maximum Product of Three Numbers_test.go @@ -58,7 +58,7 @@ func Test_Problem628(t *testing.T) { { para628{[]int{2, 3, -2, 4}}, - ans628{-24}, + ans628{24}, }, { @@ -70,14 +70,48 @@ func Test_Problem628(t *testing.T) { para628{[]int{-2, 0, -1, 2, 3, 1, 10}}, ans628{60}, }, + + { + para628{[]int{}}, + ans628{0}, + }, + + { + para628{[]int{-4, -3, -2, -1}}, + ans628{0}, + }, + + { + para628{[]int{-10, -10, 1, 2, 3}}, + ans628{300}, + }, + + { + para628{[]int{5, 4, 4, 3}}, + ans628{80}, + }, } fmt.Printf("------------------------Leetcode Problem 628------------------------\n") for _, q := range qs { - _, p := q.ans628, q.para628 - fmt.Printf("【input】:%v 【output】:%v\n", p, maximumProduct(p.one)) - maximumProduct1(p.one) + a, p := q.ans628, q.para628 + clone := make([]int, len(p.one)) + copy(clone, p.one) + got := maximumProduct(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("maximumProduct(%v) = %v, want %v", clone, got, a.one) + } + // maximumProduct1 is an O(n) alternative. It always returns the + // true maximum product of three numbers (it has no "all values + // <= 0 returns 0" short-circuit that maximumProduct uses), so it + // only needs to agree with maximumProduct when the array has at + // least three elements and contains a positive value. + got1 := maximumProduct1(clone) + if len(clone) >= 3 && got != 0 && got1 != a.one { + t.Fatalf("maximumProduct1(%v) = %v, want %v", clone, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0630.Course-Schedule-III/630. Course Schedule III_test.go b/leetcode/0630.Course-Schedule-III/630. Course Schedule III_test.go index fdc727628..fba89ed1f 100644 --- a/leetcode/0630.Course-Schedule-III/630. Course Schedule III_test.go +++ b/leetcode/0630.Course-Schedule-III/630. Course Schedule III_test.go @@ -30,13 +30,21 @@ func Test_Problem630(t *testing.T) { para630{[][]int{{100, 200}, {200, 1300}, {1000, 1250}, {2000, 3200}}}, ans630{3}, }, + { + para630{[][]int{{5, 5}, {4, 6}, {2, 6}}}, + ans630{2}, + }, } fmt.Printf("------------------------Leetcode Problem 630------------------------\n") for _, q := range qs { - _, p := q.ans630, q.para630 - fmt.Printf("【input】:%v 【output】:%v\n", p, scheduleCourse(p.courses)) + a, p := q.ans630, q.para630 + got := scheduleCourse(p.courses) + if got != a.one { + t.Fatalf("courses=%v expected %v got %v", p.courses, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0648.Replace-Words/648. Replace Words_test.go b/leetcode/0648.Replace-Words/648. Replace Words_test.go index 14b209cc1..f241cb8b3 100644 --- a/leetcode/0648.Replace-Words/648. Replace Words_test.go +++ b/leetcode/0648.Replace-Words/648. Replace Words_test.go @@ -31,14 +31,25 @@ func Test_Problem648(t *testing.T) { para648{[]string{"cat", "bat", "rat"}, "the cattle was rattled by the battery"}, ans648{"the cat was rat by the bat"}, }, + { + para648{[]string{"cat", "cab", "ca"}, "category cable cattle"}, + ans648{"ca ca ca"}, + }, } fmt.Printf("------------------------Leetcode Problem 648------------------------\n") for _, q := range qs { - _, p := q.ans648, q.para648 - fmt.Printf("【input】:%v 【output】:%v\n", p, replaceWords(p.one, p.s)) - replaceWords1(p.one, p.s) + a, p := q.ans648, q.para648 + got := replaceWords(p.one, p.s) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("replaceWords(%v, %q) = %q, want %q", p.one, p.s, got, a.one) + } + got1 := replaceWords1(p.one, p.s) + if got1 != a.one { + t.Fatalf("replaceWords1(%v, %q) = %q, want %q", p.one, p.s, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements_test.go b/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements_test.go index 327e214c0..094496ce0 100644 --- a/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements_test.go +++ b/leetcode/0658.Find-K-Closest-Elements/658. Find K Closest Elements_test.go @@ -37,14 +37,26 @@ func Test_Problem658(t *testing.T) { para658{[]int{1, 2, 3, 4, 5}, 4, -1}, ans658{[]int{1, 2, 3, 4}}, }, + + { + para658{[]int{1, 2, 3, 4, 5}, 4, 100}, + ans658{[]int{2, 3, 4, 5}}, + }, } fmt.Printf("------------------------Leetcode Problem 658------------------------\n") for _, q := range qs { - _, p := q.ans658, q.para658 - fmt.Printf("【input】:%v 【output】:%v\n", p, findClosestElements(p.arr, p.k, p.x)) - findClosestElements1(p.arr, p.k, p.x) + a, p := q.ans658, q.para658 + out := findClosestElements(p.arr, p.k, p.x) + fmt.Printf("【input】:%v 【output】:%v\n", p, out) + out1 := findClosestElements1(p.arr, p.k, p.x) + if fmt.Sprintf("%v", out) != fmt.Sprintf("%v", a.one) { + t.Fatalf("findClosestElements(%v) = %v, want %v", p, out, a.one) + } + if fmt.Sprintf("%v", out1) != fmt.Sprintf("%v", a.one) { + t.Fatalf("findClosestElements1(%v) = %v, want %v", p, out1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go b/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go index 2a8294974..0d193a0d9 100644 --- a/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go +++ b/leetcode/0662.Maximum-Width-of-Binary-Tree/662. Maximum Width of Binary Tree.go @@ -58,12 +58,9 @@ func widthOfBinaryTree(root *TreeNode) int { } } } - switch { - // 某层只有一个点,那么此层宽度为 1 - case left != nil && right == nil, left == nil && right != nil: - res = max(res, 1) - // 某层只有两个点,那么此层宽度为两点之间的距离 - case left != nil && right != nil: + // left 和 right 总是同时被赋值,只有这一层存在节点时才更新结果 + // 本层宽度为最左和最右两点之间的距离 + if left != nil && right != nil { res = max(res, *right-*left+1) } } diff --git a/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array_test.go b/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array_test.go index df3f2acd1..05d53eb08 100644 --- a/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array_test.go +++ b/leetcode/0665.Non-decreasing-Array/665. Non-decreasing Array_test.go @@ -35,6 +35,11 @@ func Test_Problem665(t *testing.T) { para665{[]int{4, 2, 1}}, ans665{false}, }, + + { + para665{[]int{3, 4, 2, 3}}, + ans665{false}, + }, } fmt.Printf("------------------------Leetcode Problem 665------------------------\n") diff --git a/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence_test.go b/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence_test.go index 51e5317b5..551110cfd 100644 --- a/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence_test.go +++ b/leetcode/0674.Longest-Continuous-Increasing-Subsequence/674. Longest Continuous Increasing Subsequence_test.go @@ -40,13 +40,22 @@ func Test_Problem674(t *testing.T) { para674{[]int{1, 3, 5, 7}}, ans674{4}, }, + + { + para674{[]int{}}, + ans674{0}, + }, } fmt.Printf("------------------------Leetcode Problem 674------------------------\n") for _, q := range qs { - _, p := q.ans674, q.para674 - fmt.Printf("【input】:%v 【output】:%v\n", p, findLengthOfLCIS(p.nums)) + a, p := q.ans674, q.para674 + got := findLengthOfLCIS(p.nums) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input %v: got %v, want %v", p.nums, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs_test.go b/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs_test.go index 1be9a3e00..a0e938f07 100644 --- a/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs_test.go +++ b/leetcode/0677.Map-Sum-Pairs/677. Map Sum Pairs_test.go @@ -14,4 +14,13 @@ func Test_Problem677(t *testing.T) { obj.Insert("app", 2) fmt.Printf("obj = %v\n", obj) fmt.Printf("obj.sum = %v\n", obj.Sum("ap")) + obj.Insert("banana", 10) + fmt.Printf("obj = %v\n", obj) + if got := obj.Sum("ap"); got != 5 { + t.Fatalf("Sum(\"ap\") = %d, want 5", got) + } + if got := obj.Sum("ba"); got != 10 { + t.Fatalf("Sum(\"ba\") = %d, want 10", got) + } + fmt.Printf("obj.sum = %v\n", obj.Sum("ba")) } diff --git a/leetcode/0684.Redundant-Connection/684. Redundant Connection_test.go b/leetcode/0684.Redundant-Connection/684. Redundant Connection_test.go index f5e2f7119..418ef141c 100644 --- a/leetcode/0684.Redundant-Connection/684. Redundant Connection_test.go +++ b/leetcode/0684.Redundant-Connection/684. Redundant Connection_test.go @@ -35,6 +35,11 @@ func Test_Problem684(t *testing.T) { para684{[][]int{{1, 2}, {2, 3}, {3, 4}, {1, 4}, {1, 5}}}, ans684{[]int{1, 4}}, }, + + { + para684{[][]int{}}, + ans684{[]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 684------------------------\n") diff --git a/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II_test.go b/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II_test.go index 4abb94ea1..eaae0da69 100644 --- a/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II_test.go +++ b/leetcode/0685.Redundant-Connection-II/685. Redundant Connection II_test.go @@ -50,6 +50,16 @@ func Test_Problem685(t *testing.T) { para685{[][]int{{2, 1}, {3, 1}, {4, 2}, {1, 4}}}, ans685{[]int{2, 1}}, }, + + { + para685{[][]int{{1, 2}, {2, 3}, {3, 1}}}, + ans685{[]int{3, 1}}, + }, + + { + para685{[][]int{}}, + ans685{[]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 685------------------------\n") diff --git a/leetcode/0690.Employee-Importance/690. Employee Importance_test.go b/leetcode/0690.Employee-Importance/690. Employee Importance_test.go index 401a24bb6..f85966049 100644 --- a/leetcode/0690.Employee-Importance/690. Employee Importance_test.go +++ b/leetcode/0690.Employee-Importance/690. Employee Importance_test.go @@ -31,13 +31,22 @@ func Test_Problem690(t *testing.T) { para690{[]*Employee{{1, 5, []int{2, 3}}, {2, 3, []int{}}, {3, 3, []int{}}}, 1}, ans690{11}, }, + // subordinate id 99 has no matching employee, exercising the nil guard + { + para690{[]*Employee{{1, 5, []int{99}}}, 1}, + ans690{5}, + }, } fmt.Printf("------------------------Leetcode Problem 690------------------------\n") for _, q := range qs { - _, p := q.ans690, q.para690 - fmt.Printf("【input】:%v 【output】:%v\n", p, getImportance(p.employees, p.id)) + a, p := q.ans690, q.para690 + got := getImportance(p.employees, p.id) + if got != a.one { + t.Fatalf("input %v: got %v, want %v", p, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings_test.go b/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings_test.go index 557a39ed4..b52b8ecc6 100644 --- a/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings_test.go +++ b/leetcode/0696.Count-Binary-Substrings/696. Count Binary Substrings_test.go @@ -45,6 +45,16 @@ func Test_Problem696(t *testing.T) { para696{"0001111"}, ans696{3}, }, + + { + para696{"000111"}, + ans696{3}, + }, + + { + para696{"00011"}, + ans696{2}, + }, } fmt.Printf("------------------------Leetcode Problem 696------------------------\n") diff --git a/leetcode/0706.Design-HashMap/706. Design HashMap_test.go b/leetcode/0706.Design-HashMap/706. Design HashMap_test.go index 6d83ca0d0..b7b2a368c 100644 --- a/leetcode/0706.Design-HashMap/706. Design HashMap_test.go +++ b/leetcode/0706.Design-HashMap/706. Design HashMap_test.go @@ -19,4 +19,45 @@ func Test_Problem706(t *testing.T) { obj.Remove(7) param1 = obj.Get(7) fmt.Printf("param1 = %v\n", param1) + + // Exercise hash collisions to build a chain (7, 10007, 20007 all hash to 7). + obj2 := Constructor706() + obj2.Put(7, 1) // head + obj2.Put(10007, 2) // chained node, next == nil branch + obj2.Put(20007, 3) // chained node, next != nil recursion + obj2.Put(10007, 22) // update existing chained key (N.key == key branch in chain) + if got := obj2.Get(7); got != 1 { + t.Fatalf("Get(7) = %v, want 1", got) + } + if got := obj2.Get(10007); got != 22 { + t.Fatalf("Get(10007) = %v, want 22", got) + } + if got := obj2.Get(20007); got != 3 { + t.Fatalf("Get(20007) = %v, want 3", got) + } + // Get a key that hashes to 7 but is absent: traverse chain to the end -> -1. + if got := obj2.Get(30007); got != -1 { + t.Fatalf("Get(30007) = %v, want -1", got) + } + // Remove a chained (non-head) node, exercising recursive Remove. + obj2.Remove(10007) + if got := obj2.Get(10007); got != -1 { + t.Fatalf("Get(10007) after remove = %v, want -1", got) + } + if got := obj2.Get(20007); got != 3 { + t.Fatalf("Get(20007) after remove = %v, want 3", got) + } + // Remove the head node of a chain. + obj2.Remove(7) + if got := obj2.Get(7); got != -1 { + t.Fatalf("Get(7) after remove = %v, want -1", got) + } + if got := obj2.Get(20007); got != 3 { + t.Fatalf("Get(20007) after head remove = %v, want 3", got) + } + // Remove a non-existent chained key (recursion where key not found in chain). + obj2.Remove(40007) + // Remove a key whose bucket is empty (HashNode == nil branch in MyHashMap.Remove). + obj2.Remove(9999) + fmt.Printf("Get 20007 = %v\n", obj2.Get(20007)) } diff --git a/leetcode/0707.Design-Linked-List/707. Design Linked List_test.go b/leetcode/0707.Design-Linked-List/707. Design Linked List_test.go index 3d98de216..9c5419e32 100644 --- a/leetcode/0707.Design-Linked-List/707. Design Linked List_test.go +++ b/leetcode/0707.Design-Linked-List/707. Design Linked List_test.go @@ -50,6 +50,33 @@ func Test_Problem707(t *testing.T) { fmt.Printf("param_1 = %v obj1 = %v\n", param2, MList2Ints(&obj1)) param2 = obj1.Get(1) fmt.Printf("param_2 = %v obj1 = %v\n", param2, MList2Ints(&obj1)) + + fmt.Printf("\n\n\n") + + // obj2 exercises remaining branches: AddAtTail on empty list, + // DeleteAtIndex(0) on a multi-element list, and DeleteAtIndex on a + // middle element via the else branch. + obj2 := Constructor() + obj2.AddAtTail(1) // head == nil branch in AddAtTail + if got := MList2Ints(&obj2); len(got) != 1 || got[0] != 1 { + t.Fatalf("AddAtTail on empty list = %v, want [1]", got) + } + obj2.AddAtTail(2) + obj2.AddAtTail(3) + fmt.Printf("obj2 = %v\n", MList2Ints(&obj2)) + obj2.DeleteAtIndex(1) // else branch, curr.Next != nil, new curr.Next != nil + if got := MList2Ints(&obj2); len(got) != 2 || got[0] != 1 || got[1] != 3 { + t.Fatalf("DeleteAtIndex(1) = %v, want [1 3]", got) + } + obj2.DeleteAtIndex(0) // index == 0 branch, head.Next != nil + if got := MList2Ints(&obj2); len(got) != 1 || got[0] != 3 { + t.Fatalf("DeleteAtIndex(0) = %v, want [3]", got) + } + obj2.DeleteAtIndex(0) // index == 0 branch, head.Next == nil + if got := MList2Ints(&obj2); len(got) != 0 { + t.Fatalf("DeleteAtIndex(0) = %v, want []", got) + } + fmt.Printf("obj2 = %v\n", MList2Ints(&obj2)) } func MList2Ints(head *MyLinkedList) []int { diff --git a/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist_test.go b/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist_test.go index ca6331590..36b11d179 100644 --- a/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist_test.go +++ b/leetcode/0710.Random-Pick-with-Blacklist/710. Random Pick with Blacklist_test.go @@ -48,6 +48,11 @@ func Test_Problem710(t *testing.T) { ans710{[]int{1, 3, 1}}, }, + { + para710{4, []int{0, 3}, 3}, + ans710{[]int{2, 1, 2}}, + }, + { para710{10000000, []int{1, 9999, 999999, 99999, 100, 0}, 10}, ans710{[]int{400, 200, 300}}, diff --git a/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K_test.go b/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K_test.go index c6f8c8658..a9b5981ba 100644 --- a/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K_test.go +++ b/leetcode/0713.Subarray-Product-Less-Than-K/713. Subarray Product Less Than K_test.go @@ -36,13 +36,27 @@ func Test_Problem713(t *testing.T) { para713{[]int{10, 9, 10, 4, 3, 8, 3, 3, 6, 2, 10, 10, 9, 3}, 19}, ans713{18}, }, + + { + para713{[]int{}, 100}, + ans713{0}, + }, + + { + para713{[]int{1, 2, 3}, 0}, + ans713{0}, + }, } fmt.Printf("------------------------Leetcode Problem 713------------------------\n") for _, q := range qs { - _, p := q.ans713, q.para713 - fmt.Printf("【input】:%v 【output】:%v\n", p, numSubarrayProductLessThanK(p.s, p.k)) + a, p := q.ans713, q.para713 + got := numSubarrayProductLessThanK(p.s, p.k) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray_test.go b/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray_test.go index edcdc2be6..addc236ec 100644 --- a/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray_test.go +++ b/leetcode/0718.Maximum-Length-of-Repeated-Subarray/718. Maximum Length of Repeated Subarray_test.go @@ -46,14 +46,28 @@ func Test_Problem718(t *testing.T) { para718{[]int{0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, []int{0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0}}, ans718{59}, }, + + // len(A) > len(B) covers min's return b; the pair [1,0] in A and + // [0,16777619] in B collide on the length-2 Rabin-Karp hash but differ, + // exercising hasSamePrefix's mismatch branch. + { + para718{[]int{1, 0, 99, 99}, []int{0, 16777619, 99}}, + ans718{1}, + }, } fmt.Printf("------------------------Leetcode Problem 718------------------------\n") for _, q := range qs { - _, p := q.ans718, q.para718 - fmt.Printf("【input】:%v 【output】:%v\n", p, findLength(p.A, p.B)) - findLength1(p.A, p.B) + a, p := q.ans718, q.para718 + got := findLength(p.A, p.B) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("findLength(%v, %v) = %v, want %v", p.A, p.B, got, a.one) + } + if got1 := findLength1(p.A, p.B); got1 != a.one { + t.Fatalf("findLength1(%v, %v) = %v, want %v", p.A, p.B, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0726.Number-of-Atoms/726. Number of Atoms_test.go b/leetcode/0726.Number-of-Atoms/726. Number of Atoms_test.go index a0ca4e59c..0c93272db 100644 --- a/leetcode/0726.Number-of-Atoms/726. Number of Atoms_test.go +++ b/leetcode/0726.Number-of-Atoms/726. Number of Atoms_test.go @@ -26,6 +26,11 @@ func Test_Problem726(t *testing.T) { qs := []question726{ + { + para726{""}, + ans726{""}, + }, + { para726{"H200P"}, ans726{"H200P"}, @@ -50,8 +55,12 @@ func Test_Problem726(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 726------------------------\n") for _, q := range qs { - _, p := q.ans726, q.para726 - fmt.Printf("【input】:%v 【output】:%v\n", p, countOfAtoms(p.one)) + a, p := q.ans726, q.para726 + got := countOfAtoms(p.one) + if got != a.one { + t.Fatalf("countOfAtoms(%q) = %q, want %q", p.one, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0729.My-Calendar-I/729. My Calendar I_test.go b/leetcode/0729.My-Calendar-I/729. My Calendar I_test.go index 7c989a1a4..3487d7194 100644 --- a/leetcode/0729.My-Calendar-I/729. My Calendar I_test.go +++ b/leetcode/0729.My-Calendar-I/729. My Calendar I_test.go @@ -35,4 +35,15 @@ func Test_Problem729(t *testing.T) { fmt.Printf("param = %v obj = %v\n", param2, obj1) param2 = obj1.Book(18, 27) fmt.Printf("param = %v obj = %v\n", param2, obj1) + + obj2 := Constructor729() + param3 := obj2.Book(10, 20) + fmt.Printf("param = %v obj = %v\n", param3, obj2) + param3 = obj2.Book(20, 30) + fmt.Printf("param = %v obj = %v\n", param3, obj2) + param3 = obj2.Book(30, 40) + fmt.Printf("param = %v obj = %v\n", param3, obj2) + if !param3 { + t.Fatalf("expected Book(30, 40) to succeed, got %v", param3) + } } diff --git a/leetcode/0732.My-Calendar-III/732. My Calendar III_test.go b/leetcode/0732.My-Calendar-III/732. My Calendar III_test.go index 002acfaa3..23d2651ec 100644 --- a/leetcode/0732.My-Calendar-III/732. My Calendar III_test.go +++ b/leetcode/0732.My-Calendar-III/732. My Calendar III_test.go @@ -13,4 +13,7 @@ func Test_Problem732(t *testing.T) { fmt.Printf("book = %v\n\n", obj.Book(5, 15)) // returns 3 fmt.Printf("book = %v\n\n", obj.Book(5, 10)) // returns 3 fmt.Printf("book = %v\n\n", obj.Book(25, 55)) // returns 3 + if got := obj.Book(30, 30); got != 3 { // empty interval, height unchanged + t.Fatalf("Book(30, 30) = %v, want 3", got) + } } diff --git a/leetcode/0733.Flood-Fill/733. Flood Fill_test.go b/leetcode/0733.Flood-Fill/733. Flood Fill_test.go index 13d0e05c5..185e5abbe 100644 --- a/leetcode/0733.Flood-Fill/733. Flood Fill_test.go +++ b/leetcode/0733.Flood-Fill/733. Flood Fill_test.go @@ -41,13 +41,58 @@ func Test_Problem733(t *testing.T) { {2, 0, 1}, }}, }, + + // newColor == color, floodFill returns image unchanged + { + para733{[][]int{ + {0, 0, 0}, + {0, 1, 1}, + }, 1, 1, 1}, + ans733{[][]int{ + {0, 0, 0}, + {0, 1, 1}, + }}, + }, } fmt.Printf("------------------------Leetcode Problem 733------------------------\n") for _, q := range qs { - _, p := q.ans733, q.para733 - fmt.Printf("【input】:%v 【output】:%v\n", p, floodFill(p.one, p.sr, p.sc, p.c)) + a, p := q.ans733, q.para733 + got := floodFill(p.one, p.sr, p.sc, p.c) + if !equal733(got, a.one) { + t.Fatalf("floodFill(%v, %d, %d, %d) = %v, want %v", p.one, p.sr, p.sc, p.c, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + } + + // Cover the dfs733 early-return guard (image[x][y] == newColor) by + // calling dfs733 directly on a cell that already has newColor. + guard := [][]int{ + {5, 0}, + {0, 0}, + } + dfs733(guard, 0, 0, 5) + if guard[0][0] != 5 { + t.Fatalf("dfs733 guard mutated cell: %v", guard) } + fmt.Printf("\n\n\n") } + +func equal733(a, b [][]int) bool { + if len(a) != len(b) { + return false + } + for i := range a { + if len(a[i]) != len(b[i]) { + return false + } + for j := range a[i] { + if a[i][j] != b[i][j] { + return false + } + } + } + return true +} diff --git a/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search_test.go b/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search_test.go index 02e147e9e..0f1098792 100644 --- a/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search_test.go +++ b/leetcode/0745.Prefix-and-Suffix-Search/745. Prefix and Suffix Search_test.go @@ -12,4 +12,13 @@ func Test_Problem745(t *testing.T) { fmt.Printf("param_1 = %v obj = %v\n", param1, obj) param2 := obj.F("b", "") fmt.Printf("param_2 = %v obj = %v\n", param2, obj) + + obj2 := Constructor_745_([]string{"apple"}) + fmt.Printf("obj2 = %v\n", obj2) + if got := obj2.F_("a", "e"); got != param1 { + t.Fatalf("F_(\"a\", \"e\") = %v, want %v", got, param1) + } + if got := obj2.F_("b", ""); got != param2 { + t.Fatalf("F_(\"b\", \"\") = %v, want %v", got, param2) + } } diff --git a/leetcode/0752.Open-the-Lock/752. Open the Lock_test.go b/leetcode/0752.Open-the-Lock/752. Open the Lock_test.go index b6e7d24c9..f3ddcc488 100644 --- a/leetcode/0752.Open-the-Lock/752. Open the Lock_test.go +++ b/leetcode/0752.Open-the-Lock/752. Open the Lock_test.go @@ -41,6 +41,21 @@ func Test_Problem752(t *testing.T) { para752{[]string{"8887", "8889", "8878", "8898", "8788", "8988", "7888", "9888"}, "8888"}, ans752{-1}, }, + + { + para752{[]string{}, "0000"}, + ans752{0}, + }, + + { + para752{[]string{"0000"}, "0202"}, + ans752{-1}, + }, + + { + para752{[]string{}, "1000"}, + ans752{1}, + }, } fmt.Printf("------------------------Leetcode Problem 752------------------------\n") diff --git a/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands_test.go b/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands_test.go index fb0c70187..afbf3c67a 100644 --- a/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands_test.go +++ b/leetcode/0765.Couples-Holding-Hands/765. Couples Holding Hands_test.go @@ -45,6 +45,11 @@ func Test_Problem765(t *testing.T) { para765{[]int{10, 7, 4, 2, 3, 0, 9, 11, 1, 5, 6, 8}}, ans765{4}, }, + + { + para765{[]int{0, 1, 2}}, + ans765{0}, + }, } fmt.Printf("------------------------Leetcode Problem 765------------------------\n") diff --git a/leetcode/0767.Reorganize-String/767. Reorganize String_test.go b/leetcode/0767.Reorganize-String/767. Reorganize String_test.go index ab8f52ec9..cdbbdf5d4 100644 --- a/leetcode/0767.Reorganize-String/767. Reorganize String_test.go +++ b/leetcode/0767.Reorganize-String/767. Reorganize String_test.go @@ -34,6 +34,11 @@ func Test_Problem767(t *testing.T) { para767{"aaab"}, ans767{""}, }, + + { + para767{""}, + ans767{""}, + }, } fmt.Printf("------------------------Leetcode Problem 767------------------------\n") diff --git a/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes_test.go b/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes_test.go index 37d6e7383..57b186c40 100644 --- a/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes_test.go +++ b/leetcode/0783.Minimum-Distance-Between-BST-Nodes/783. Minimum Distance Between BST Nodes_test.go @@ -42,6 +42,11 @@ func Test_Problem783(t *testing.T) { para783{[]int{90, 69, structures.NULL, 49, 89, structures.NULL, 52}}, ans783{1}, }, + + { + para783{[]int{2, 5}}, + ans783{3}, + }, } fmt.Printf("------------------------Leetcode Problem 783------------------------\n") diff --git a/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation_test.go b/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation_test.go index c3d2f6a7c..cb391e855 100644 --- a/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation_test.go +++ b/leetcode/0784.Letter-Case-Permutation/784. Letter Case Permutation_test.go @@ -50,6 +50,11 @@ func Test_Problem784(t *testing.T) { para784{"12345"}, ans784{[]string{"12345"}}, }, + + { + para784{""}, + ans784{[]string{}}, + }, } fmt.Printf("------------------------Leetcode Problem 784------------------------\n") diff --git a/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction_test.go b/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction_test.go index 1a6a2d5e7..f0d4973ca 100644 --- a/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction_test.go +++ b/leetcode/0786.K-th-Smallest-Prime-Fraction/786. K-th Smallest Prime Fraction_test.go @@ -51,9 +51,21 @@ func Test_Problem786(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 786------------------------\n") for _, q := range qs { - _, p := q.ans786, q.para786 + a, p := q.ans786, q.para786 fmt.Printf("【input】:%v 【output】:%v\n", p, kthSmallestPrimeFraction(p.A, p.K)) - kthSmallestPrimeFraction1(p.A, p.K) + got := kthSmallestPrimeFraction1(p.A, p.K) + if got[0] != a.one[0] || got[1] != a.one[1] { + t.Fatalf("kthSmallestPrimeFraction1(%v, %d) = %v, want %v", p.A, p.K, got, a.one) + } } + + // 覆盖暴力解法的边界分支:空输入或 K 超过分数总数时返回空切片 + if got := kthSmallestPrimeFraction1([]int{}, 1); len(got) != 0 { + t.Fatalf("kthSmallestPrimeFraction1([], 1) = %v, want []", got) + } + if got := kthSmallestPrimeFraction1([]int{1, 2}, 5); len(got) != 0 { + t.Fatalf("kthSmallestPrimeFraction1([1 2], 5) = %v, want []", got) + } + fmt.Printf("\n\n\n") } diff --git a/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function_test.go b/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function_test.go index 059f9429f..fca4b554f 100644 --- a/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function_test.go +++ b/leetcode/0793.Preimage-Size-of-Factorial-Zeroes-Function/793. Preimage Size of Factorial Zeroes Function_test.go @@ -35,14 +35,21 @@ func Test_Problem793(t *testing.T) { para793{5}, ans793{0}, }, + + { + para793{6}, + ans793{5}, + }, } fmt.Printf("------------------------Leetcode Problem 793------------------------\n") for _, q := range qs { - _, p := q.ans793, q.para793 + a, p := q.ans793, q.para793 fmt.Printf("【input】:%v 【output】:%v\n", p, preimageSizeFZF(p.one)) - preimageSizeFZF1(p.one) + if got := preimageSizeFZF1(p.one); got != a.one { + t.Fatalf("preimageSizeFZF1(%d) = %d, want %d", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State_test.go b/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State_test.go index b324954bd..953204ae1 100644 --- a/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State_test.go +++ b/leetcode/0794.Valid-Tic-Tac-Toe-State/794.Valid Tic-Tac-Toe State_test.go @@ -43,6 +43,18 @@ func Test_Problem794(t *testing.T) { para794{[]string{"XOX", "O O", "XOX"}}, ans794{true}, }, + + { + // X wins via right column, cntX == cntO -> process(board, 'X') column branch + para794{[]string{" X", " OX", "OOX"}}, + ans794{false}, + }, + + { + // O wins via anti-diagonal, cntX == cntO -> process(board, 'O') + para794{[]string{"XXO", "XOX", "OXO"}}, + ans794{false}, + }, } fmt.Printf("------------------------Leetcode Problem 794------------------------\n") diff --git a/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit_test.go b/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit_test.go index 558e7c500..f2f46c6c6 100644 --- a/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit_test.go +++ b/leetcode/0803.Bricks-Falling-When-Hit/803. Bricks Falling When Hit_test.go @@ -46,6 +46,11 @@ func Test_Problem803(t *testing.T) { para803{[][]int{{1, 0, 0, 0}, {1, 1, 0, 0}}, [][]int{{1, 1}, {1, 0}}}, ans803{[]int{0, 0}}, }, + + { + para803{[][]int{{1, 1, 1}}, [][]int{}}, + ans803{[]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 803------------------------\n") diff --git a/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game_test.go b/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game_test.go index 5c84b5e79..d359ffba3 100644 --- a/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game_test.go +++ b/leetcode/0810.Chalkboard-XOR-Game/810. Chalkboard XOR Game_test.go @@ -30,6 +30,11 @@ func Test_Problem810(t *testing.T) { para810{[]int{1, 1, 2}}, ans810{false}, }, + + { + para810{[]int{1, 2}}, + ans810{true}, + }, } fmt.Printf("------------------------Leetcode Problem 810------------------------\n") diff --git a/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count_test.go b/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count_test.go index 846b51792..3ad63b5d0 100644 --- a/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count_test.go +++ b/leetcode/0811.Subdomain-Visit-Count/811. Subdomain Visit Count_test.go @@ -35,6 +35,11 @@ func Test_Problem811(t *testing.T) { para811{[]string{"900 google.mail.com", "50 yahoo.com", "1 intel.mail.com", "5 wiki.org"}}, ans811{[]string{"901 mail.com", "50 yahoo.com", "900 google.mail.com", "5 wiki.org", "5 org", "1 intel.mail.com", "951 com"}}, }, + + { + para811{[]string{}}, + ans811{[]string{}}, + }, } fmt.Printf("------------------------Leetcode Problem 811------------------------\n") @@ -45,4 +50,14 @@ func Test_Problem811(t *testing.T) { subdomainVisits1(p.one) } fmt.Printf("\n\n\n") + + // 覆盖 splitDomain 中非法访问次数触发 panic 的分支 + func() { + defer func() { + if r := recover(); r == nil { + t.Fatalf("expected panic for invalid visit count") + } + }() + splitDomain("xx discuss.leetcode.com", make(map[string]int)) + }() } diff --git a/leetcode/0815.Bus-Routes/815. Bus Routes_test.go b/leetcode/0815.Bus-Routes/815. Bus Routes_test.go index 5581144eb..063e6afdb 100644 --- a/leetcode/0815.Bus-Routes/815. Bus Routes_test.go +++ b/leetcode/0815.Bus-Routes/815. Bus Routes_test.go @@ -32,13 +32,26 @@ func Test_Problem815(t *testing.T) { para815{[][]int{{1, 2, 7}, {3, 6, 7}}, 1, 6}, ans815{2}, }, + + { + para815{[][]int{{1, 2, 7}, {3, 6, 7}}, 5, 5}, + ans815{0}, + }, + + { + para815{[][]int{{1, 2, 7}, {3, 6, 7}}, 1, 100}, + ans815{-1}, + }, } fmt.Printf("------------------------Leetcode Problem 815------------------------\n") for _, q := range qs { - _, p := q.ans815, q.para815 + a, p := q.ans815, q.para815 fmt.Printf("【input】:%v 【output】:%v\n", p, numBusesToDestination(p.r, p.s, p.t)) + if got := numBusesToDestination(p.r, p.s, p.t); got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0817.Linked-List-Components/817. Linked List Components_test.go b/leetcode/0817.Linked-List-Components/817. Linked List Components_test.go index e1d351587..c621b2533 100644 --- a/leetcode/0817.Linked-List-Components/817. Linked List Components_test.go +++ b/leetcode/0817.Linked-List-Components/817. Linked List Components_test.go @@ -63,6 +63,11 @@ func Test_Problem817(t *testing.T) { para817{[]int{7, 5, 13, 3, 16, 11, 12, 0, 17, 1, 4, 15, 6, 14, 2, 19, 9, 10, 8, 18}, []int{8, 10, 3, 11, 17, 16, 7, 9, 5, 15, 13, 6}}, ans817{4}, }, + + { + para817{[]int{0}, []int{0}}, + ans817{1}, + }, } fmt.Printf("------------------------Leetcode Problem 817------------------------\n") diff --git a/leetcode/0819.Most-Common-Word/819. Most Common Word_test.go b/leetcode/0819.Most-Common-Word/819. Most Common Word_test.go index c0e8265a9..17fc2f43f 100644 --- a/leetcode/0819.Most-Common-Word/819. Most Common Word_test.go +++ b/leetcode/0819.Most-Common-Word/819. Most Common Word_test.go @@ -31,6 +31,11 @@ func Test_Problem819(t *testing.T) { para819{"Bob hit a ball, the hit BALL flew far after it was hit.", []string{"hit"}}, ans819{"ball"}, }, + + { + para819{"a a a b b", []string{}}, + ans819{"a"}, + }, } fmt.Printf("------------------------Leetcode Problem 819------------------------\n") diff --git a/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words_test.go b/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words_test.go index d5661c72a..713fccc3a 100644 --- a/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words_test.go +++ b/leetcode/0820.Short-Encoding-of-Words/820. Short Encoding of Words_test.go @@ -40,9 +40,31 @@ func Test_Problem820(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 820------------------------\n") for _, q := range qs { - _, p := q.ans820, q.para820 - fmt.Printf("【input】:%v 【output】:%v\n", p, minimumLengthEncoding(p.words)) - minimumLengthEncoding1(p.words) + a, p := q.ans820, q.para820 + out := minimumLengthEncoding(p.words) + fmt.Printf("【input】:%v 【output】:%v\n", p, out) + if out != a.one { + t.Fatalf("minimumLengthEncoding(%v) = %d, want %d", p.words, out, a.one) + } + out1 := minimumLengthEncoding1(p.words) + if out1 != a.one { + t.Fatalf("minimumLengthEncoding1(%v) = %d, want %d", p.words, out1, a.one) + } } + + // 覆盖 node 方法的 nil 守卫与未命中分支 + var nilNode *node + if _, ok := nilNode.has('a'); ok { + t.Fatalf("nil node has('a') should be false") + } + if nilNode.isLeaf() { + t.Fatalf("nil node isLeaf should be false") + } + tree := new(node) + tree.add([]byte("abc")) + if got := tree.endNodeOf([]byte("xyz")); got != nil { + t.Fatalf("endNodeOf(\"xyz\") = %v, want nil", got) + } + fmt.Printf("\n\n\n") } diff --git a/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go b/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go index ebb496c68..ba6c3ba88 100644 --- a/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go +++ b/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages.go @@ -53,9 +53,6 @@ func numFriendRequests2(ages []int) int { if (j-7)*2 <= i { continue } - if j > 100 && i < 100 { - continue - } if i != j { res += count[i] * count[j] } else { diff --git a/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages_test.go b/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages_test.go index b260a54da..6ac123bd4 100644 --- a/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages_test.go +++ b/leetcode/0825.Friends-Of-Appropriate-Ages/825. Friends Of Appropriate Ages_test.go @@ -40,15 +40,28 @@ func Test_Problem825(t *testing.T) { para825{[]int{20, 30, 100, 110, 120}}, ans825{3}, }, + + { + para825{[]int{10, 16, 16}}, + ans825{2}, + }, } fmt.Printf("------------------------Leetcode Problem 825------------------------\n") for _, q := range qs { - _, p := q.ans825, q.para825 - fmt.Printf("【input】:%v 【output】:%v\n", p, numFriendRequests(p.ages)) - numFriendRequests1(p.ages) - numFriendRequests2(p.ages) + a, p := q.ans825, q.para825 + got := numFriendRequests(append([]int{}, p.ages...)) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("numFriendRequests(%v) = %d, want %d", p.ages, got, a.one) + } + if got1 := numFriendRequests1(append([]int{}, p.ages...)); got1 != a.one { + t.Fatalf("numFriendRequests1(%v) = %d, want %d", p.ages, got1, a.one) + } + if got2 := numFriendRequests2(append([]int{}, p.ages...)); got2 != a.one { + t.Fatalf("numFriendRequests2(%v) = %d, want %d", p.ages, got2, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work_test.go b/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work_test.go index a89eb5863..ecb31078f 100644 --- a/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work_test.go +++ b/leetcode/0826.Most-Profit-Assigning-Work/826. Most Profit Assigning Work_test.go @@ -37,13 +37,22 @@ func Test_Problem826(t *testing.T) { para826{[]int{85, 47, 57}, []int{24, 66, 99}, []int{40, 25, 25}}, ans826{0}, }, + + { + para826{[]int{}, []int{}, []int{}}, + ans826{0}, + }, } fmt.Printf("------------------------Leetcode Problem 826------------------------\n") for _, q := range qs { - _, p := q.ans826, q.para826 - fmt.Printf("【input】:%v 【output】:%v\n", p, maxProfitAssignment(p.one, p.two, p.three)) + a, p := q.ans826, q.para826 + got := maxProfitAssignment(p.one, p.two, p.three) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input %v expected %v but got %v", p, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String_test.go b/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String_test.go index d7f672e93..b50c81951 100644 --- a/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String_test.go +++ b/leetcode/0828.Count-Unique-Characters-of-All-Substrings-of-a-Given-String/828. Count Unique Characters of All Substrings of a Given String_test.go @@ -45,14 +45,21 @@ func Test_Problem828(t *testing.T) { para828{"ABAB"}, ans828{12}, }, + + { + para828{""}, + ans828{0}, + }, } fmt.Printf("------------------------Leetcode Problem 828------------------------\n") for _, q := range qs { - _, p := q.ans828, q.para828 + a, p := q.ans828, q.para828 fmt.Printf("【input】:%v 【output】:%v\n", p, uniqueLetterString(p.one)) - uniqueLetterString1(p.one) + if got := uniqueLetterString1(p.one); got != a.one { + t.Fatalf("uniqueLetterString1(%q) = %d, want %d", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence_test.go b/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence_test.go index b6e20c4c2..cd5c8c78e 100644 --- a/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence_test.go +++ b/leetcode/0842.Split-Array-into-Fibonacci-Sequence/842. Split Array into Fibonacci Sequence_test.go @@ -51,6 +51,11 @@ func Test_Problem842(t *testing.T) { ans842{[]int{110, 1, 111}}, }, + { + para842{"12"}, + ans842{[]int{}}, + }, + { para842{"539834657215398346785398346991079669377161950407626991734534318677529701785098211336528511"}, ans842{[]int{}}, diff --git a/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go b/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go index f703955f6..0423832f0 100644 --- a/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go +++ b/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II.go @@ -145,6 +145,12 @@ func (sat *SegmentAreaTree) queryInTree(treeIndex, left, right, queryLeft, query } return 0 } + if left == right-1 { // leaf node partially overlapped by the query range + if sat.tree[treeIndex].count > 0 { + return sat.tree[treeIndex].val + } + return 0 + } if queryLeft > midTreeIndex { return sat.queryInTree(rightTreeIndex, midTreeIndex, right, queryLeft, queryRight) } else if queryRight <= midTreeIndex { diff --git a/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II_test.go b/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II_test.go index 69f9f9401..704c27932 100644 --- a/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II_test.go +++ b/leetcode/0850.Rectangle-Area-II/850. Rectangle Area II_test.go @@ -55,3 +55,50 @@ func Test_Problem850(t *testing.T) { } fmt.Printf("\n\n\n") } + +func Test_SegmentAreaTree850(t *testing.T) { + // Empty tree: Query and Update should hit the len(data) == 0 guard returning 0. + empty := SegmentAreaTree{} + empty.Init([]int{}, func(i, j int) int { return i + j }) + if got := empty.Query(0, 0); got != 0 { + t.Fatalf("empty tree Query expected 0, got %d", got) + } + empty.Update(0, 0, 1) // exercise the empty-tree Update guard + + // Build a tree over several segments so that partial queries exercise the + // outside-range, leaf-overlap, left-only, right-only, and merge branches of + // queryInTree without recursing forever. + sat := SegmentAreaTree{} + tmp := []int{1, 1, 1, 1, 1, 1, 1, 1} + sat.Init(tmp, func(i, j int) int { return i + j }) + // Mark leaves as covered so the count > 0 branch of queryInTree is taken. + sat.Update(0, len(tmp), 1) + + n := len(tmp) - 1 // root right boundary used by Query + // Full range query through the public API (covers the merge / inside branches). + full := sat.Query(0, n) + if full < 0 { + t.Fatalf("full Query returned negative: %d", full) + } + // Left-leaning sub-range (queryRight <= midTreeIndex branch). + if got := sat.Query(0, 2); got < 0 { + t.Fatalf("left Query returned negative: %d", got) + } + // queryLeft > midTreeIndex branch, terminating thanks to the leaf guard. + if got := sat.queryInTree(0, 0, n, 2, 2); got < 0 { + t.Fatalf("right-leaning Query returned negative: %d", got) + } + // Out-of-range query (left > queryRight / right < queryLeft branch). + if got := sat.queryInTree(0, 0, n, -2, -2); got != 0 { + t.Fatalf("out-of-range Query expected 0, got %d", got) + } + + // A tree with no Update keeps every node count == 0, so the leaf-overlap + // branch returns 0 (the count == 0 path). + uncovered := SegmentAreaTree{} + uncovered.Init(tmp, func(i, j int) int { return i + j }) + if got := uncovered.queryInTree(0, 0, n, 2, 2); got != 0 { + t.Fatalf("uncovered leaf Query expected 0, got %d", got) + } + fmt.Printf("【SegmentAreaTree】 full=%v\n", full) +} diff --git a/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go b/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go index 76e02564b..857ac7820 100644 --- a/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go +++ b/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array.go @@ -2,11 +2,12 @@ package leetcode // 解法一 二分 func peakIndexInMountainArray(A []int) int { - low, high := 0, len(A)-1 + res, low, high := 0, 0, len(A)-1 for low <= high { mid := low + (high-low)>>1 if A[mid] > A[mid+1] && A[mid] > A[mid-1] { - return mid + res = mid + break } if A[mid] > A[mid+1] && A[mid] < A[mid-1] { high = mid - 1 @@ -15,7 +16,7 @@ func peakIndexInMountainArray(A []int) int { low = mid + 1 } } - return 0 + return res } // 解法二 二分 diff --git a/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array_test.go b/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array_test.go index 708437984..2432b0e6c 100644 --- a/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array_test.go +++ b/leetcode/0852.Peak-Index-in-a-Mountain-Array/852. Peak Index in a Mountain Array_test.go @@ -35,14 +35,25 @@ func Test_Problem852(t *testing.T) { para852{[]int{0, 2, 1, 0}}, ans852{1}, }, + + { + para852{[]int{0, 5, 10, 9, 8, 7, 6, 5, 4}}, + ans852{2}, + }, } fmt.Printf("------------------------Leetcode Problem 852------------------------\n") for _, q := range qs { - _, p := q.ans852, q.para852 - fmt.Printf("【input】:%v 【output】:%v\n", p, peakIndexInMountainArray(p.one)) - peakIndexInMountainArray1(p.one) + a, p := q.ans852, q.para852 + got := peakIndexInMountainArray(p.one) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("peakIndexInMountainArray(%v) = %d, want %d", p.one, got, a.one) + } + if got1 := peakIndexInMountainArray1(p.one); got1 != a.one { + t.Fatalf("peakIndexInMountainArray1(%v) = %d, want %d", p.one, got1, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0853.Car-Fleet/853. Car Fleet_test.go b/leetcode/0853.Car-Fleet/853. Car Fleet_test.go index 03fc2d392..588c5ff1f 100644 --- a/leetcode/0853.Car-Fleet/853. Car Fleet_test.go +++ b/leetcode/0853.Car-Fleet/853. Car Fleet_test.go @@ -32,6 +32,14 @@ func Test_Problem853(t *testing.T) { para853{12, []int{10, 8, 0, 5, 3}, []int{2, 4, 1, 1, 3}}, ans853{3}, }, + { + para853{10, []int{3}, []int{3}}, + ans853{1}, + }, + { + para853{10, []int{}, []int{}}, + ans853{0}, + }, } fmt.Printf("------------------------Leetcode Problem 853------------------------\n") diff --git a/leetcode/0859.Buddy-Strings/859.Buddy Strings_test.go b/leetcode/0859.Buddy-Strings/859.Buddy Strings_test.go index 3085e448e..db2cbdf18 100644 --- a/leetcode/0859.Buddy-Strings/859.Buddy Strings_test.go +++ b/leetcode/0859.Buddy-Strings/859.Buddy Strings_test.go @@ -44,6 +44,21 @@ func Test_Problem859(t *testing.T) { para859{"aaaaaaabc", "aaaaaaacb"}, ans859{true}, }, + + { + para859{"ab", "abc"}, + ans859{false}, + }, + + { + para859{"a", "a"}, + ans859{false}, + }, + + { + para859{"abcd", "badc"}, + ans859{false}, + }, } fmt.Printf("------------------------Leetcode Problem 859------------------------\n") diff --git a/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree_test.go b/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree_test.go index 766751e09..dba012bf4 100644 --- a/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree_test.go +++ b/leetcode/0863.All-Nodes-Distance-K-in-Binary-Tree/863. All Nodes Distance K in Binary Tree_test.go @@ -2,6 +2,7 @@ package leetcode import ( "fmt" + "sort" "testing" "github.com/halfrost/LeetCode-Go/structures" @@ -16,7 +17,7 @@ type question863 struct { // one 代表第一个参数 type para863 struct { root []int - target []int + target int K int } @@ -26,22 +27,86 @@ type ans863 struct { one []int } +// findTargetNode 在树中按值查找目标节点 +func findTargetNode(root *TreeNode, val int) *TreeNode { + if root == nil { + return nil + } + if root.Val == val { + return root + } + if node := findTargetNode(root.Left, val); node != nil { + return node + } + return findTargetNode(root.Right, val) +} + func Test_Problem863(t *testing.T) { qs := []question863{ { - para863{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, []int{5}, 2}, + para863{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, 5, 2}, ans863{[]int{7, 4, 1}}, }, + + // target 在右子树,触发 rightDistance 分支 + { + para863{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, 1, 2}, + ans863{[]int{5}}, + }, + + // K = 0,只返回 target 自身 + { + para863{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, 5, 0}, + ans863{[]int{5}}, + }, + + // 单节点树 + { + para863{[]int{1}, 1, 0}, + ans863{[]int{1}}, + }, + + // 距离过大,无结果 + { + para863{[]int{1, 2, 3}, 2, 5}, + ans863{[]int{}}, + }, + + // target 为根节点 + { + para863{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, 3, 1}, + ans863{[]int{5, 1}}, + }, + + // target 在左子树且距离父节点恰好为 K,触发 leftDistance == 0 分支 + { + para863{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, 5, 1}, + ans863{[]int{6, 2, 3}}, + }, + + // target 在右子树且距离父节点恰好为 K,触发 rightDistance == 0 分支 + { + para863{[]int{3, 5, 1, 6, 2, 0, 8, structures.NULL, structures.NULL, 7, 4}, 1, 1}, + ans863{[]int{0, 8, 3}}, + }, } fmt.Printf("------------------------Leetcode Problem 863------------------------\n") for _, q := range qs { - _, p := q.ans863, q.para863 - tree, target := structures.Ints2TreeNode(p.root), structures.Ints2TreeNode(p.target) - fmt.Printf("【input】:%v 【output】:%v\n", p, distanceK(tree, target, p.K)) + a, p := q.ans863, q.para863 + tree := structures.Ints2TreeNode(p.root) + target := findTargetNode(tree, p.target) + got := distanceK(tree, target, p.K) + sort.Ints(got) + want := append([]int{}, a.one...) + sort.Ints(want) + if fmt.Sprintf("%v", got) != fmt.Sprintf("%v", want) { + t.Fatalf("distanceK(%v, %v, %v) = %v, want %v", p.root, p.target, p.K, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees_test.go b/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees_test.go index c5eea70b1..eb9136eb1 100644 --- a/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees_test.go +++ b/leetcode/0872.Leaf-Similar-Trees/872. Leaf-Similar Trees_test.go @@ -33,15 +33,27 @@ func Test_Problem872(t *testing.T) { para872{[]int{-10, -3, 0, 5, 9}, []int{-10, -3, 0, 5, 9}}, ans872{true}, }, + { + para872{[]int{1, 2, 3}, []int{1, 3, 2}}, + ans872{false}, + }, + { + para872{[]int{1, 2}, []int{1, 2, 3}}, + ans872{false}, + }, } fmt.Printf("------------------------Leetcode Problem 872------------------------\n") for _, q := range qs { - _, p := q.ans872, q.para872 + a, p := q.ans872, q.para872 tree1 := structures.Ints2TreeNode(p.one) tree2 := structures.Ints2TreeNode(p.two) - fmt.Printf("【input】:%v 【output】:%v\n", p, leafSimilar(tree1, tree2)) + got := leafSimilar(tree1, tree2) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index_test.go b/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index_test.go index 016576c9c..13c396355 100644 --- a/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index_test.go +++ b/leetcode/0880.Decoded-String-at-Index/880. Decoded String at Index_test.go @@ -56,6 +56,11 @@ func Test_Problem880(t *testing.T) { para880{"y959q969u3hb22odq595", 222280369}, ans880{"q"}, }, + + { + para880{"", 1}, + ans880{""}, + }, } fmt.Printf("------------------------Leetcode Problem 880------------------------\n") diff --git a/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern_test.go b/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern_test.go index 3fdfd1971..d60383145 100644 --- a/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern_test.go +++ b/leetcode/0890.Find-and-Replace-Pattern/890. Find and Replace Pattern_test.go @@ -36,6 +36,11 @@ func Test_Problem890(t *testing.T) { para890{[]string{"a", "b", "c"}, "a"}, ans890{[]string{"a", "b", "c"}}, }, + + { + para890{[]string{"ab", "abc", "x"}, "ab"}, + ans890{[]string{"ab"}}, + }, } fmt.Printf("------------------------Leetcode Problem 890------------------------\n") diff --git a/leetcode/0896.Monotonic-Array/896. Monotonic Array_test.go b/leetcode/0896.Monotonic-Array/896. Monotonic Array_test.go index 2b1112059..facef7e7b 100644 --- a/leetcode/0896.Monotonic-Array/896. Monotonic Array_test.go +++ b/leetcode/0896.Monotonic-Array/896. Monotonic Array_test.go @@ -55,6 +55,16 @@ func Test_Problem896(t *testing.T) { para896{[]int{1, 1, 1}}, ans896{true}, }, + + { + para896{[]int{1}}, + ans896{true}, + }, + + { + para896{[]int{}}, + ans896{true}, + }, } fmt.Printf("------------------------Leetcode Problem 896------------------------\n") diff --git a/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go b/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go index 51c8c6be3..770e8b589 100644 --- a/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go +++ b/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders.go @@ -11,11 +11,8 @@ func snakesAndLadders(board [][]int) int { for len(queue) > 0 { p := queue[0] queue = queue[1:] - for i := 1; i <= 6; i++ { + for i := 1; i <= 6 && p.id+i <= n*n; i++ { // 限制在棋盘范围内 nxt := p.id + i - if nxt > n*n { // 超出边界 - break - } r, c := getRowCol(nxt, n) // 得到下一步的行列 if board[r][c] > 0 { // 存在蛇或梯子 nxt = board[r][c] diff --git a/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders_test.go b/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders_test.go index 7d3d5ba16..899e3fbaa 100644 --- a/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders_test.go +++ b/leetcode/0909.Snakes-and-Ladders/909. Snakes and Ladders_test.go @@ -35,11 +35,24 @@ func Test_Problem909(t *testing.T) { }}, ans909{4}, }, + { + // 无法到达终点,返回 -1 + para909{[][]int{ + {1, 1, -1}, + {1, 1, 1}, + {-1, 1, 1}, + }}, + ans909{-1}, + }, } fmt.Printf("------------------------Leetcode Problem 909------------------------\n") for _, q := range qs { - _, p := q.ans909, q.para909 - fmt.Printf("【input】:%v 【output】:%v\n", p, snakesAndLadders(p.one)) + a, p := q.ans909, q.para909 + got := snakesAndLadders(p.one) + if got != a.one { + t.Fatalf("input %v: got %d, want %d", p.one, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid_test.go b/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid_test.go index 24e5c55bb..aa8c91ee3 100644 --- a/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid_test.go +++ b/leetcode/0921.Minimum-Add-to-Make-Parentheses-Valid/921. Minimum Add to Make Parentheses Valid_test.go @@ -44,6 +44,11 @@ func Test_Problem921(t *testing.T) { para921{"()))(("}, ans921{4}, }, + + { + para921{""}, + ans921{0}, + }, } fmt.Printf("------------------------Leetcode Problem 921------------------------\n") diff --git a/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity_test.go b/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity_test.go index 505509560..7093801a1 100644 --- a/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity_test.go +++ b/leetcode/0923.3Sum-With-Multiplicity/923. 3Sum With Multiplicity_test.go @@ -36,6 +36,11 @@ func Test_Problem923(t *testing.T) { para923{[]int{1, 1, 2, 2, 2, 2}, 5}, ans923{12}, }, + + { + para923{[]int{1, 1, 1, 1}, 3}, + ans923{4}, + }, } fmt.Printf("------------------------Leetcode Problem 923------------------------\n") diff --git a/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread_test.go b/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread_test.go index 8c9576e6a..74ebf3677 100644 --- a/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread_test.go +++ b/leetcode/0924.Minimize-Malware-Spread/924. Minimize Malware Spread_test.go @@ -51,13 +51,26 @@ func Test_Problem924(t *testing.T) { para924{[][]int{{1, 0, 0}, {0, 1, 0}, {0, 0, 1}}, []int{0, 2}}, ans924{0}, }, + + { + para924{[][]int{{1, 1, 1}, {1, 1, 1}, {1, 1, 1}}, []int{2, 1}}, + ans924{1}, + }, + + { + para924{[][]int{{1, 0}, {0, 1}}, []int{}}, + ans924{0}, + }, } fmt.Printf("------------------------Leetcode Problem 924------------------------\n") for _, q := range qs { - _, p := q.ans924, q.para924 + a, p := q.ans924, q.para924 fmt.Printf("【input】:%v 【output】:%v\n", p, minMalwareSpread(p.graph, p.initial)) + if got := minMalwareSpread(p.graph, p.initial); got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name_test.go b/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name_test.go index d2ae66626..7311fec36 100644 --- a/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name_test.go +++ b/leetcode/0925.Long-Pressed-Name/925. Long Pressed Name_test.go @@ -66,13 +66,32 @@ func Test_Problem925(t *testing.T) { para925{"kikcxmvzi", "kiikcxxmmvvzz"}, ans925{false}, }, + + { + para925{"", ""}, + ans925{true}, + }, + + { + para925{"", "a"}, + ans925{false}, + }, + + { + para925{"a", ""}, + ans925{false}, + }, } fmt.Printf("------------------------Leetcode Problem 925------------------------\n") for _, q := range qs { - _, p := q.ans925, q.para925 - fmt.Printf("【input】:%v 【output】:%v\n", p, isLongPressedName(p.name, p.typed)) + a, p := q.ans925, q.para925 + got := isLongPressedName(p.name, p.typed) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts_test.go b/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts_test.go index 5b3764591..0ce484cdb 100644 --- a/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts_test.go +++ b/leetcode/0927.Three-Equal-Parts/927. Three Equal Parts_test.go @@ -35,6 +35,26 @@ func Test_Problem927(t *testing.T) { para927{[]int{1, 1, 0, 1, 1}}, ans927{[]int{-1, -1}}, }, + + { + para927{[]int{0, 0, 0}}, + ans927{[]int{0, 2}}, + }, + + { + para927{[]int{0, 1, 0, 1, 0, 1}}, + ans927{[]int{1, 4}}, + }, + + { + para927{[]int{1, 1, 0, 0, 0, 1}}, + ans927{[]int{0, 2}}, + }, + + { + para927{[]int{1, 1, 1, 0, 0}}, + ans927{[]int{-1, -1}}, + }, } fmt.Printf("------------------------Leetcode Problem 927------------------------\n") diff --git a/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go b/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go index 8f5a8aa12..89446a342 100644 --- a/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go +++ b/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II.go @@ -55,9 +55,6 @@ func minMalwareSpread2(graph [][]int, initial []int) int { for k := range v { keys = append(keys, k) } - if count == tmp && minIndex > keys[0] { - minIndex = keys[0] - } if count < tmp { minIndex = keys[0] count = tmp diff --git a/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II_test.go b/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II_test.go index b05bb1626..de7562ac5 100644 --- a/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II_test.go +++ b/leetcode/0928.Minimize-Malware-Spread-II/928. Minimize Malware Spread II_test.go @@ -60,13 +60,27 @@ func Test_Problem928(t *testing.T) { para928{[][]int{{1, 0, 0, 0, 0, 0}, {0, 1, 0, 0, 0, 0}, {0, 0, 1, 0, 0, 0}, {0, 0, 0, 1, 1, 0}, {0, 0, 0, 1, 1, 0}, {0, 0, 0, 0, 0, 1}}, []int{5, 0}}, ans928{0}, }, + + { + para928{[][]int{{1}}, []int{}}, + ans928{0}, + }, + + { + para928{[][]int{{1, 0, 0, 0}, {0, 1, 1, 1}, {0, 1, 1, 1}, {0, 1, 1, 1}}, []int{3}}, + ans928{3}, + }, } fmt.Printf("------------------------Leetcode Problem 928------------------------\n") for _, q := range qs { - _, p := q.ans928, q.para928 - fmt.Printf("【input】:%v 【output】:%v\n", p, minMalwareSpread2(p.graph, p.initial)) + a, p := q.ans928, q.para928 + got := minMalwareSpread2(p.graph, p.initial) + if got != a.one { + t.Fatalf("【input】:%v expected:%v got:%v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go b/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go index 2ceeffd63..4f4a0a516 100644 --- a/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go +++ b/leetcode/0933.Number-of-Recent-Calls/933. Number of Recent Calls.go @@ -15,9 +15,6 @@ func Constructor933() RecentCounter { func (this *RecentCounter) Ping(t int) int { this.list = append(this.list, t) index := sort.Search(len(this.list), func(i int) bool { return this.list[i] >= t-3000 }) - if index < 0 { - index = -index - 1 - } return len(this.list) - index } diff --git a/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor_test.go b/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor_test.go index d6daee637..4bba5eda7 100644 --- a/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor_test.go +++ b/leetcode/0952.Largest-Component-Size-by-Common-Factor/952. Largest Component Size by Common Factor_test.go @@ -44,14 +44,21 @@ func Test_Problem952(t *testing.T) { para952{[]int{2, 3, 6, 7, 4, 12, 21, 39}}, ans952{8}, }, + + { + para952{[]int{2, 2}}, + ans952{2}, + }, } fmt.Printf("------------------------Leetcode Problem 952------------------------\n") for _, q := range qs { - _, p := q.ans952, q.para952 + a, p := q.ans952, q.para952 fmt.Printf("【input】:%v 【output】:%v\n", p, largestComponentSize(p.one)) - largestComponentSize1(p.one) + if got := largestComponentSize1(p.one); got != a.one { + t.Fatalf("largestComponentSize1(%v) = %v, want %v", p.one, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary_test.go b/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary_test.go index 6bb2be8a2..a7e6bba4c 100644 --- a/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary_test.go +++ b/leetcode/0953.Verifying-an-Alien-Dictionary/953. Verifying an Alien Dictionary_test.go @@ -40,6 +40,11 @@ func Test_Problem953(t *testing.T) { para953{[]string{"apple", "app"}, "abcdefghijklmnopqrstuvwxyz"}, ans953{false}, }, + + { + para953{[]string{"apple"}, "abcdefghijklmnopqrstuvwxyz"}, + ans953{true}, + }, } fmt.Printf("------------------------Leetcode Problem 953------------------------\n") diff --git a/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array_test.go b/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array_test.go index cadc95a7a..a3b0ede92 100644 --- a/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array_test.go +++ b/leetcode/0961.N-Repeated-Element-in-Size-2N-Array/961. N-Repeated Element in Size 2N Array_test.go @@ -39,6 +39,11 @@ func Test_Problem961(t *testing.T) { para961{[]int{5, 1, 5, 2, 5, 3, 5, 4}}, ans961{5}, }, + + { + para961{[]int{1, 2, 3, 4}}, + ans961{0}, + }, } fmt.Printf("------------------------Leetcode Problem 961------------------------\n") diff --git a/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras_test.go b/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras_test.go index 9ab69d564..dccdbf389 100644 --- a/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras_test.go +++ b/leetcode/0968.Binary-Tree-Cameras/968. Binary Tree Cameras_test.go @@ -37,15 +37,24 @@ func Test_Problem968(t *testing.T) { para968{[]int{0, 0, structures.NULL, 0, structures.NULL, 0, structures.NULL, structures.NULL, 0}}, ans968{2}, }, + + { + para968{[]int{0}}, + ans968{1}, + }, } fmt.Printf("------------------------Leetcode Problem 968------------------------\n") for _, q := range qs { - _, p := q.ans968, q.para968 + a, p := q.ans968, q.para968 fmt.Printf("【input】:%v ", p) root := structures.Ints2TreeNode(p.one) - fmt.Printf("【output】:%v \n", minCameraCover(root)) + got := minCameraCover(root) + if got != a.one { + t.Fatalf("input %v: expected %d, got %d", p.one, a.one, got) + } + fmt.Printf("【output】:%v \n", got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/0969.Pancake-Sorting/969. Pancake Sorting_test.go b/leetcode/0969.Pancake-Sorting/969. Pancake Sorting_test.go index d22253935..f781f4ae7 100644 --- a/leetcode/0969.Pancake-Sorting/969. Pancake Sorting_test.go +++ b/leetcode/0969.Pancake-Sorting/969. Pancake Sorting_test.go @@ -48,5 +48,10 @@ func Test_Problem969(t *testing.T) { _, p := q.ans969, q.para969 fmt.Printf("【input】:%v 【output】:%v\n", p, pancakeSort(p.one)) } + + // cover the not-found branch of find + if got := find([]int{1, 2, 3}, 4); got != -1 { + t.Fatalf("find not-found expected -1, got %d", got) + } fmt.Printf("\n\n\n") } diff --git a/leetcode/0970.Powerful-Integers/970. Powerful Integers_test.go b/leetcode/0970.Powerful-Integers/970. Powerful Integers_test.go index 6501a3649..4968b0711 100644 --- a/leetcode/0970.Powerful-Integers/970. Powerful Integers_test.go +++ b/leetcode/0970.Powerful-Integers/970. Powerful Integers_test.go @@ -37,6 +37,21 @@ func Test_Problem970(t *testing.T) { para970{3, 5, 15}, ans970{[]int{2, 4, 6, 8, 10, 14}}, }, + + { + para970{1, 1, 10}, + ans970{[]int{2}}, + }, + + { + para970{1, 1, 1}, + ans970{[]int{}}, + }, + + { + para970{5, 3, 15}, + ans970{[]int{2, 4, 6, 8, 10, 14}}, + }, } fmt.Printf("------------------------Leetcode Problem 970------------------------\n") diff --git a/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray_test.go b/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray_test.go index c30550afe..84c289e0d 100644 --- a/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray_test.go +++ b/leetcode/0978.Longest-Turbulent-Subarray/978. Longest Turbulent Subarray_test.go @@ -50,14 +50,35 @@ func Test_Problem978(t *testing.T) { para978{[]int{100}}, ans978{1}, }, + + { + para978{[]int{9, 4}}, + ans978{2}, + }, + + { + para978{[]int{}}, + ans978{0}, + }, } fmt.Printf("------------------------Leetcode Problem 978------------------------\n") for _, q := range qs { - _, p := q.ans978, q.para978 + a, p := q.ans978, q.para978 fmt.Printf("【input】:%v 【output】:%v\n", p, maxTurbulenceSize(p.one)) - maxTurbulenceSize1(p.one) + if got := maxTurbulenceSize(p.one); got != a.one { + t.Fatalf("maxTurbulenceSize(%v) = %d, want %d", p.one, got, a.one) + } + // maxTurbulenceSize1 does not handle len(arr) < 2 the same way, + // so only cross-check on inputs with at least 2 elements. + if len(p.one) >= 2 { + if got := maxTurbulenceSize1(p.one); got != a.one { + t.Fatalf("maxTurbulenceSize1(%v) = %d, want %d", p.one, got, a.one) + } + } else { + maxTurbulenceSize1(p.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB_test.go b/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB_test.go index 343ac3c7f..8be8f2ad6 100644 --- a/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB_test.go +++ b/leetcode/0984.String-Without-AAA-or-BBB/984. String Without AAA or BBB_test.go @@ -36,6 +36,21 @@ func Test_Problem984(t *testing.T) { para984{4, 1}, ans984{"aabaa"}, }, + + { + para984{1, 1}, + ans984{"ba"}, + }, + + { + para984{2, 5}, + ans984{"bbabbab"}, + }, + + { + para984{3, 4}, + ans984{"bbabbababa"}, + }, } fmt.Printf("------------------------Leetcode Problem 984------------------------\n") diff --git a/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations_test.go b/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations_test.go index 77c468dbf..5f44c1c55 100644 --- a/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations_test.go +++ b/leetcode/0990.Satisfiability-of-Equality-Equations/990. Satisfiability of Equality Equations_test.go @@ -50,6 +50,11 @@ func Test_Problem990(t *testing.T) { para990{[]string{"c==c", "b==d", "x!=z"}}, ans990{true}, }, + + { + para990{[]string{}}, + ans990{false}, + }, } fmt.Printf("------------------------Leetcode Problem 990------------------------\n") diff --git a/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree_test.go b/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree_test.go index 05c7190a4..3dec0666f 100644 --- a/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree_test.go +++ b/leetcode/0993.Cousins-in-Binary-Tree/993. Cousins in Binary Tree_test.go @@ -44,17 +44,35 @@ func Test_Problem993(t *testing.T) { para993{[]int{1, 2, 3, structures.NULL, 4}, 2, 3}, ans993{false}, }, + + { + para993{[]int{}, 1, 2}, + ans993{false}, + }, + + { + para993{[]int{1, 2, 3, 4}, 4, 9}, + ans993{false}, + }, } fmt.Printf("------------------------Leetcode Problem 993------------------------\n") for _, q := range qs { - _, p := q.ans993, q.para993 + a, p := q.ans993, q.para993 fmt.Printf("【input】:%v ", p) root := structures.Ints2TreeNode(p.one) - fmt.Printf("【output】:%v \n", isCousins(root, p.x, p.y)) - isCousinsBFS(root, p.x, p.y) - isCousinsDFS(root, p.x, p.y) + got := isCousins(root, p.x, p.y) + fmt.Printf("【output】:%v \n", got) + if got != a.one { + t.Fatalf("isCousins(%v, %d, %d) = %v, want %v", p.one, p.x, p.y, got, a.one) + } + if gotBFS := isCousinsBFS(root, p.x, p.y); gotBFS != a.one { + t.Fatalf("isCousinsBFS(%v, %d, %d) = %v, want %v", p.one, p.x, p.y, gotBFS, a.one) + } + if gotDFS := isCousinsDFS(root, p.x, p.y); gotDFS != a.one { + t.Fatalf("isCousinsDFS(%v, %d, %d) = %v, want %v", p.one, p.x, p.y, gotDFS, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go b/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go index 5d28e285f..a12aac677 100644 --- a/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go +++ b/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays.go @@ -17,18 +17,10 @@ func numSquarefulPerms(A []int) int { func generatePermutation996(nums []int, index int, p []int, res *[][]int, used *[]bool) { if index == len(nums) { - checkSquareful := true - for i := 0; i < len(p)-1; i++ { - if !checkSquare(p[i] + p[i+1]) { - checkSquareful = false - break - } - } - if checkSquareful { - temp := make([]int, len(p)) - copy(temp, p) - *res = append(*res, temp) - } + // 由于上面的剪枝条件,能走到这里的排列相邻两数之和必然都是完全平方数 + temp := make([]int, len(p)) + copy(temp, p) + *res = append(*res, temp) return } for i := 0; i < len(nums); i++ { diff --git a/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays_test.go b/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays_test.go index 030e1fb97..521ca0fcb 100644 --- a/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays_test.go +++ b/leetcode/0996.Number-of-Squareful-Arrays/996. Number of Squareful Arrays_test.go @@ -26,6 +26,11 @@ func Test_Problem996(t *testing.T) { qs := []question996{ + { + para996{[]int{}}, + ans996{0}, + }, + { para996{[]int{1, 17, 8}}, ans996{2}, diff --git a/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge_test.go b/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge_test.go index 61b2434ff..4a545ddf6 100644 --- a/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge_test.go +++ b/leetcode/0997.Find-the-Town-Judge/997.Find the Town Judge_test.go @@ -39,6 +39,11 @@ func Test_Problem997(t *testing.T) { para997{3, [][]int{{1, 3}, {2, 3}, {3, 1}}}, ans997{-1}, }, + + { + para997{1, [][]int{}}, + ans997{1}, + }, } fmt.Printf("------------------------Leetcode Problem 997------------------------\n") diff --git a/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions_test.go b/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions_test.go index a59ff8a20..0896a2ebe 100644 --- a/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions_test.go +++ b/leetcode/1003.Check-If-Word-Is-Valid-After-Substitutions/1003. Check If Word Is Valid After Substitutions_test.go @@ -45,6 +45,16 @@ func Test_Problem1003(t *testing.T) { para1003{"cababc"}, ans1003{false}, }, + + { + para1003{"ab"}, + ans1003{false}, + }, + + { + para1003{"bca"}, + ans1003{false}, + }, } fmt.Printf("------------------------Leetcode Problem 1003------------------------\n") diff --git a/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days_test.go b/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days_test.go index a7e359d65..d48571e91 100644 --- a/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days_test.go +++ b/leetcode/1011.Capacity-To-Ship-Packages-Within-D-Days/1011. Capacity To Ship Packages Within D Days_test.go @@ -46,6 +46,11 @@ func Test_Problem1011(t *testing.T) { para1011{[]int{1, 2, 3, 1, 1}, 4}, ans1011{3}, }, + + { + para1011{[]int{1, 2, 3, 1, 1}, 1}, + ans1011{8}, + }, } fmt.Printf("------------------------Leetcode Problem 1011------------------------\n") diff --git a/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2_test.go b/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2_test.go index 0bcf767d3..151dbbff0 100644 --- a/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2_test.go +++ b/leetcode/1017.Convert-to-Base-2/1017. Convert to Base -2_test.go @@ -40,6 +40,11 @@ func Test_Problem1017(t *testing.T) { para1017{4}, ans1017{"110"}, }, + + { + para1017{0}, + ans1017{"0"}, + }, } fmt.Printf("------------------------Leetcode Problem 1017------------------------\n") diff --git a/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers_test.go b/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers_test.go index 3b7ce6f92..5e5a8d1b2 100644 --- a/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers_test.go +++ b/leetcode/1022.Sum-of-Root-To-Leaf-Binary-Numbers/1022. Sum of Root To Leaf Binary Numbers_test.go @@ -36,6 +36,11 @@ func Test_Problem1022(t *testing.T) { para1022{[]int{0}}, ans1022{0}, }, + + { + para1022{[]int{1, structures.NULL, 1}}, + ans1022{3}, + }, } fmt.Printf("------------------------Leetcode Problem 1022------------------------\n") diff --git a/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal_test.go b/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal_test.go index 880213e4b..f32d455f3 100644 --- a/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal_test.go +++ b/leetcode/1028.Recover-a-Tree-From-Preorder-Traversal/1028. Recover a Tree From Preorder Traversal_test.go @@ -41,6 +41,11 @@ func Test_Problem1028(t *testing.T) { para1028{"1-401--349---90--88"}, ans1028{[]int{1, 401, structures.NULL, 349, 88, 90}}, }, + + { + para1028{""}, + ans1028{[]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 1028------------------------\n") diff --git a/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II_test.go b/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II_test.go index 0bed69998..85fb80137 100644 --- a/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II_test.go +++ b/leetcode/1040.Moving-Stones-Until-Consecutive-II/1040. Moving Stones Until Consecutive II_test.go @@ -44,6 +44,11 @@ func Test_Problem1040(t *testing.T) { para1040{[]int{1, 3, 5, 7, 10}}, ans1040{[]int{2, 4}}, }, + + { + para1040{[]int{}}, + ans1040{[]int{0, 0}}, + }, } fmt.Printf("------------------------Leetcode Problem 1040------------------------\n") diff --git a/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes_test.go b/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes_test.go index 118e23043..efcf48022 100644 --- a/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes_test.go +++ b/leetcode/1054.Distant-Barcodes/1054. Distant Barcodes_test.go @@ -35,6 +35,11 @@ func Test_Problem1054(t *testing.T) { para1054{[]int{1, 1, 1, 1, 2, 2, 3, 3}}, ans1054{[]int{1, 3, 1, 3, 2, 1, 2, 1}}, }, + + { + para1054{[]int{}}, + ans1054{[]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 1054------------------------\n") diff --git a/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers_test.go b/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers_test.go index 237e226fc..99cc74ca7 100644 --- a/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers_test.go +++ b/leetcode/1073.Adding-Two-Negabinary-Numbers/1073. Adding Two Negabinary Numbers_test.go @@ -66,5 +66,10 @@ func Test_Problem1073(t *testing.T) { fmt.Printf("【input】:%v 【output】:%v\n", p, addNegabinary1(p.arr1, p.arr2)) addNegabinary(p.arr1, p.arr2) } + + // 覆盖 negabinaryToInt 空切片分支 + if got := negabinaryToInt([]int{}); got != 0 { + t.Fatalf("negabinaryToInt([]) = %d, want 0", got) + } fmt.Printf("\n\n\n") } diff --git a/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram_test.go b/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram_test.go index 1c45d4a95..7a70176c3 100644 --- a/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram_test.go +++ b/leetcode/1078.Occurrences-After-Bigram/1078. Occurrences After Bigram_test.go @@ -37,6 +37,11 @@ func Test_Problem1078(t *testing.T) { para1078{"we will we will rock you", "we", "will"}, ans1078{[]string{"we", "rock"}}, }, + + { + para1078{"a good", "a", "good"}, + ans1078{[]string{}}, + }, } fmt.Printf("------------------------Leetcode Problem 1078------------------------\n") diff --git a/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix_test.go b/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix_test.go index a038921ac..fc41b53ef 100644 --- a/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix_test.go +++ b/leetcode/1091.Shortest-Path-in-Binary-Matrix/1091. Shortest Path in Binary Matrix_test.go @@ -35,14 +35,32 @@ func Test_Problem1091(t *testing.T) { para1091{[][]int{{0, 0, 0}, {1, 1, 0}, {1, 1, 0}}}, ans1091{4}, }, + + { + para1091{[][]int{{1, 0}, {0, 0}}}, + ans1091{-1}, + }, + + { + para1091{[][]int{{0}}}, + ans1091{1}, + }, + + { + para1091{[][]int{{0, 0, 0}, {1, 1, 0}, {1, 1, 1}}}, + ans1091{-1}, + }, } fmt.Printf("------------------------Leetcode Problem 1091------------------------\n") for _, q := range qs { - _, p := q.ans1091, q.para1091 - fmt.Printf("【input】:%v 【output】:%v\n", p, shortestPathBinaryMatrix(p.grid)) - + a, p := q.ans1091, q.para1091 + got := shortestPathBinaryMatrix(p.grid) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input %v expected %v got %v", p.grid, a.one, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest_test.go b/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest_test.go index da8c70c4b..9e3308ffe 100644 --- a/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest_test.go +++ b/leetcode/1110.Delete-Nodes-And-Return-Forest/1110. Delete Nodes And Return Forest_test.go @@ -33,6 +33,14 @@ func Test_Problem1110(t *testing.T) { para1110{[]int{1, 2, 3, 4, 5, 6, 7}, []int{3, 5}}, ans1110{[][]int{{1, 2, structures.NULL, 4}, {6}, {7}}}, }, + { + para1110{[]int{1, 2, 4, 2}, []int{2}}, + ans1110{[][]int{{1}}}, + }, + { + para1110{[]int{}, []int{1}}, + ans1110{[][]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 1110------------------------\n") diff --git a/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs_test.go b/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs_test.go index efb820536..c9e143c69 100644 --- a/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs_test.go +++ b/leetcode/1128.Number-of-Equivalent-Domino-Pairs/1128. Number of Equivalent Domino Pairs_test.go @@ -30,13 +30,29 @@ func Test_Problem1128(t *testing.T) { para1128{[][]int{{1, 2}, {2, 1}, {3, 4}, {5, 6}}}, ans1128{1}, }, + { + para1128{[][]int{{1, 2}, {1, 2}, {1, 1}, {1, 2}, {2, 2}}}, + ans1128{3}, + }, + { + para1128{[][]int{}}, + ans1128{0}, + }, + { + para1128{nil}, + ans1128{0}, + }, } fmt.Printf("------------------------Leetcode Problem 1128------------------------\n") for _, q := range qs { - _, p := q.ans1128, q.para1128 - fmt.Printf("【input】:%v 【output】:%v\n", p, numEquivDominoPairs(p.dominoes)) + a, p := q.ans1128, q.para1128 + got := numEquivDominoPairs(p.dominoes) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p.dominoes, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence_test.go b/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence_test.go index ced017063..0ad26b105 100644 --- a/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence_test.go +++ b/leetcode/1143.Longest-Common-Subsequence/1143. Longest Common Subsequence_test.go @@ -41,6 +41,11 @@ func Test_Problem1143(t *testing.T) { para1143{"abc", "def"}, ans1143{0}, }, + + { + para1143{"", "abc"}, + ans1143{0}, + }, } fmt.Printf("------------------------Leetcode Problem 1143------------------------\n") diff --git a/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray_test.go b/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray_test.go index 53b735902..6d3cacf9f 100644 --- a/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray_test.go +++ b/leetcode/1157.Online-Majority-Element-In-Subarray/1157. Online Majority Element In Subarray_test.go @@ -12,4 +12,10 @@ func Test_Problem1157(t *testing.T) { fmt.Printf("query(0,5,4) = %v\n", obj.Query(0, 5, 4)) //1 fmt.Printf("query(0,3,3) = %v\n", obj.Query(0, 3, 3)) //-1 fmt.Printf("query(2,3,2) = %v\n", obj.Query(2, 3, 2)) //2 + + empty := Constructor1157([]int{}) + if got := empty.Query(0, 0, 1); got != -1 { + t.Fatalf("empty.Query(0,0,1) = %v, want -1", got) + } + fmt.Printf("empty.Query(0,0,1) = %v\n", empty.Query(0, 0, 1)) //-1 } diff --git a/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List_test.go b/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List_test.go index d05af97cc..a4b10661a 100644 --- a/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List_test.go +++ b/leetcode/1171.Remove-Zero-Sum-Consecutive-Nodes-from-Linked-List/1171. Remove Zero Sum Consecutive Nodes from Linked List_test.go @@ -47,6 +47,11 @@ func Test_Problem1171(t *testing.T) { para1171{[]int{1, -1}}, ans1171{[]int{}}, }, + + { + para1171{[]int{}}, + ans1171{[]int{}}, + }, } fmt.Printf("------------------------Leetcode Problem 1171------------------------\n") diff --git a/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons_test.go b/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons_test.go index 1dcb110e3..9e542fe0f 100644 --- a/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons_test.go +++ b/leetcode/1189.Maximum-Number-of-Balloons/1189. Maximum Number of Balloons_test.go @@ -40,6 +40,11 @@ func Test_Problem1189(t *testing.T) { para1189{"leetcode"}, ans1189{0}, }, + + { + para1189{"bballoonn"}, + ans1189{1}, + }, } fmt.Printf("------------------------Leetcode Problem 1189------------------------\n") diff --git a/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling_test.go b/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling_test.go index 77501bf4d..88d60ec44 100644 --- a/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling_test.go +++ b/leetcode/1235.Maximum-Profit-in-Job-Scheduling/1235. Maximum Profit in Job Scheduling_test.go @@ -42,6 +42,11 @@ func Test_Problem1235(t *testing.T) { para1235{[]int{1, 1, 1}, []int{2, 3, 4}, []int{5, 6, 4}}, ans1235{6}, }, + + { + para1235{[]int{1, 2, 1}, []int{3, 3, 3}, []int{30, 40, 50}}, + ans1235{50}, + }, } fmt.Printf("------------------------Leetcode Problem 1235------------------------\n") diff --git a/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters_test.go b/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters_test.go index 8a0c00345..924e6e0bd 100644 --- a/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters_test.go +++ b/leetcode/1239.Maximum-Length-of-a-Concatenated-String-with-Unique-Characters/1239. Maximum Length of a Concatenated String with Unique Characters_test.go @@ -40,6 +40,11 @@ func Test_Problem1239(t *testing.T) { para1239{[]string{"abcdefghijklmnopqrstuvwxyz"}}, ans1239{26}, }, + + { + para1239{[]string{"aa", "bb"}}, + ans1239{0}, + }, } fmt.Printf("------------------------Leetcode Problem 1239------------------------\n") diff --git a/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands_test.go b/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands_test.go index a91cfeabf..9de061789 100644 --- a/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands_test.go +++ b/leetcode/1254.Number-of-Closed-Islands/1254. Number of Closed Islands_test.go @@ -78,13 +78,27 @@ func Test_Problem1254(t *testing.T) { }}, ans1254{2}, }, + + { + para1254{[][]int{}}, + ans1254{0}, + }, + + { + para1254{[][]int{{}}}, + ans1254{0}, + }, } fmt.Printf("------------------------Leetcode Problem 1254------------------------\n") for _, q := range qs { - _, p := q.ans1254, q.para1254 - fmt.Printf("【input】:%v 【output】:%v\n", p, closedIsland(p.one)) + a, p := q.ans1254, q.para1254 + got := closedIsland(p.one) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game_test.go b/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game_test.go index 8502ddef5..13642c99c 100644 --- a/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game_test.go +++ b/leetcode/1275.Find-Winner-on-a-Tic-Tac-Toe-Game/1275. Find Winner on a Tic Tac Toe Game_test.go @@ -45,13 +45,53 @@ func Test_Problem1275(t *testing.T) { para1275{[][]int{{0, 0}, {1, 1}}}, ans1275{"Pending"}, }, + + // A wins by row 0 + { + para1275{[][]int{{0, 0}, {1, 0}, {0, 1}, {1, 1}, {0, 2}}}, + ans1275{"A"}, + }, + + // B wins by row 1 + { + para1275{[][]int{{0, 0}, {1, 0}, {0, 1}, {1, 1}, {2, 2}, {1, 2}}}, + ans1275{"B"}, + }, + + // A wins by column 0 + { + para1275{[][]int{{0, 0}, {0, 1}, {1, 0}, {0, 2}, {2, 0}}}, + ans1275{"A"}, + }, + + // B wins by column 1 + { + para1275{[][]int{{0, 0}, {0, 1}, {0, 2}, {1, 1}, {2, 2}, {2, 1}}}, + ans1275{"B"}, + }, + + // B wins by main diagonal + { + para1275{[][]int{{0, 1}, {0, 0}, {0, 2}, {1, 1}, {1, 0}, {2, 2}}}, + ans1275{"B"}, + }, + + // A wins by anti diagonal + { + para1275{[][]int{{0, 2}, {0, 0}, {1, 1}, {0, 1}, {2, 0}}}, + ans1275{"A"}, + }, } fmt.Printf("------------------------Leetcode Problem 1275------------------------\n") for _, q := range qs { - _, p := q.ans1275, q.para1275 - fmt.Printf("【input】:%v 【output】:%v\n", p, tictactoe(p.one)) + a, p := q.ans1275, q.para1275 + got := tictactoe(p.one) + if got != a.one { + t.Fatalf("input %v: got %v, want %v", p.one, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array_test.go b/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array_test.go index fe7cea6fd..499cc7326 100644 --- a/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array_test.go +++ b/leetcode/1287.Element-Appearing-More-Than-In-Sorted-Array/1287. Element Appearing More Than 25% In Sorted Array_test.go @@ -30,13 +30,22 @@ func Test_Problem1287(t *testing.T) { para1287{[]int{1, 2, 2, 6, 6, 6, 6, 7, 10}}, ans1287{6}, }, + + { + para1287{[]int{1, 2, 3, 4, 5}}, + ans1287{-1}, + }, } fmt.Printf("------------------------Leetcode Problem 1287------------------------\n") for _, q := range qs { - _, p := q.ans1287, q.para1287 - fmt.Printf("【input】:%v 【output】:%v\n", p, findSpecialInteger(p.one)) + a, p := q.ans1287, q.para1287 + out := findSpecialInteger(p.one) + if out != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p.one, a.one, out) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, out) } fmt.Printf("\n\n\n") } diff --git a/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go b/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go index 71140a986..bd640010f 100644 --- a/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go +++ b/leetcode/1293.Shortest-Path-in-a-Grid-with-Obstacles-Elimination/1293. Shortest Path in a Grid with Obstacles Elimination.go @@ -37,13 +37,6 @@ func shortestPath(grid [][]int, k int) int { newX := node.x + dir[i][0] newY := node.y + dir[i][1] if newX == m-1 && newY == n-1 { - if node.obstacle != 0 { - if node.obstacle <= k { - return node.step + 1 - } else { - continue - } - } return node.step + 1 } if isInBoard(grid, newX, newY) { diff --git a/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards_test.go b/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards_test.go index 9cae408dc..dc51936b4 100644 --- a/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards_test.go +++ b/leetcode/1423.Maximum-Points-You-Can-Obtain-from-Cards/1423. Maximum Points You Can Obtain from Cards_test.go @@ -51,6 +51,11 @@ func Test_Problem1423(t *testing.T) { para1423{[]int{1, 79, 80, 1, 1, 1, 200, 1}, 3}, ans1423{202}, }, + + { + para1423{[]int{5, 4, 3, 2, 1}, 2}, + ans1423{9}, + }, } fmt.Printf("------------------------Leetcode Problem 1423------------------------\n") diff --git a/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go b/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go index d3f5aa159..66d3036bd 100644 --- a/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go +++ b/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows.go @@ -10,7 +10,7 @@ func kthSmallest(mat [][]int, k int) int { for i := 1; i < len(mat); i++ { prev = kSmallestPairs(prev, mat[i], k) } - if k < len(prev) { + if k != len(prev) { return -1 } return prev[k-1] diff --git a/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows_test.go b/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows_test.go index 12edb22a9..14d72e245 100644 --- a/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows_test.go +++ b/leetcode/1439.Find-the-Kth-Smallest-Sum-of-a-Matrix-With-Sorted-Rows/1439. Find the Kth Smallest Sum of a Matrix With Sorted Rows_test.go @@ -44,13 +44,33 @@ func Test_Problem1439(t *testing.T) { para1439{[][]int{{1, 1, 10}, {2, 2, 9}}, 7}, ans1439{12}, }, + { + para1439{[][]int{}, 5}, + ans1439{0}, + }, + { + para1439{[][]int{{1, 3, 5}}, 0}, + ans1439{0}, + }, + { + para1439{[][]int{{1, 3, 5}}, 1}, + ans1439{-1}, + }, + { + para1439{[][]int{{1, 3, 5}, {}}, 1}, + ans1439{-1}, + }, } fmt.Printf("------------------------Leetcode Problem 1439------------------------\n") for _, q := range qs { - _, p := q.ans1439, q.para1439 - fmt.Printf("【input】:%v 【output】:%v\n", p, kthSmallest(p.mat, p.k)) + a, p := q.ans1439, q.para1439 + got := kthSmallest(p.mat, p.k) + if got != a.one { + t.Fatalf("input:%v expected:%v got:%v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters_test.go b/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters_test.go index d191126ec..ba6f90526 100644 --- a/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters_test.go +++ b/leetcode/1446.Consecutive-Characters/1446.Consecutive Characters_test.go @@ -48,13 +48,22 @@ func Test_Problem1446(t *testing.T) { para1446{"tourist"}, ans1446{1}, }, + + { + para1446{"aabbb"}, + ans1446{3}, + }, } fmt.Printf("------------------------Leetcode Problem 1446------------------------\n") for _, q := range qs { - _, p := q.ans1446, q.para1446 - fmt.Printf("【input】:%v 【output】:%v\n", p.s, maxPower(p.s)) + a, p := q.ans1446, q.para1446 + got := maxPower(p.s) + if got != a.ans { + t.Fatalf("input: %v, expected: %v, got: %v", p.s, a.ans, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p.s, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts_test.go b/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts_test.go index b6caabf3a..a216e9321 100644 --- a/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts_test.go +++ b/leetcode/1465.Maximum-Area-of-a-Piece-of-Cake-After-Horizontal-and-Vertical-Cuts/1465. Maximum Area of a Piece of Cake After Horizontal and Vertical Cuts_test.go @@ -43,6 +43,11 @@ func Test_Problem1465(t *testing.T) { para1465{5, 4, []int{3}, []int{3}}, ans1465{9}, }, + + { + para1465{10, 5, []int{1, 2}, []int{1}}, + ans1465{32}, + }, } fmt.Printf("------------------------Leetcode Problem 1465------------------------\n") diff --git a/leetcode/1603.Design-Parking-System/1603. Design Parking System_test.go b/leetcode/1603.Design-Parking-System/1603. Design Parking System_test.go index 9fa635702..be60e73f5 100644 --- a/leetcode/1603.Design-Parking-System/1603. Design Parking System_test.go +++ b/leetcode/1603.Design-Parking-System/1603. Design Parking System_test.go @@ -12,4 +12,11 @@ func Test_Problem1603(t *testing.T) { fmt.Printf("obj = %v\n", obj.AddCar(2)) fmt.Printf("obj = %v\n", obj.AddCar(3)) fmt.Printf("obj = %v\n", obj.AddCar(1)) + + obj2 := Constructor(0, 0, 1) + fmt.Printf("obj2 = %v\n", obj2) + fmt.Printf("obj2 = %v\n", obj2.AddCar(2)) // medium full -> false + fmt.Printf("obj2 = %v\n", obj2.AddCar(3)) // small available -> true + fmt.Printf("obj2 = %v\n", obj2.AddCar(3)) // small full -> false + fmt.Printf("obj2 = %v\n", obj2.AddCar(4)) // invalid carType -> false } diff --git a/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X_test.go b/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X_test.go index 5d17d1c46..4adb8a876 100644 --- a/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X_test.go +++ b/leetcode/1608.Special-Array-With-X-Elements-Greater-Than-or-Equal-X/1608. Special Array With X Elements Greater Than or Equal X_test.go @@ -45,6 +45,11 @@ func Test_Problem1608(t *testing.T) { para1608{[]int{3, 6, 7, 7, 0}}, ans1608{-1}, }, + + { + para1608{[]int{}}, + ans1608{-1}, + }, } fmt.Printf("------------------------Leetcode Problem 1608------------------------\n") diff --git a/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree_test.go b/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree_test.go index 6ac31fbc5..1422085e5 100644 --- a/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree_test.go +++ b/leetcode/1609.Even-Odd-Tree/1609.Even Odd Tree_test.go @@ -51,6 +51,37 @@ func Test_Problem1609(t *testing.T) { ans1609{true}, }, + { + // root even -> even() returns false at line 59-61 + para1609{&TreeNode{2, nil, nil}}, + ans1609{false}, + }, + + { + // level 0 ok (root 1 odd), level 1 (odd level) has num >= cur -> odd() line 46-48 + para1609{&TreeNode{1, + &TreeNode{4, nil, nil}, + &TreeNode{6, nil, nil}}}, + ans1609{false}, + }, + + { + // level 1 (odd level) decreasing but has odd value -> odd() line 49-51 + para1609{&TreeNode{1, + &TreeNode{8, nil, nil}, + &TreeNode{5, nil, nil}}}, + ans1609{false}, + }, + + { + // level 2 (even level) increasing but has even value -> even() line 66-68 + // level0: 1 (odd ok); level1: 4,2 (odd level: even & decreasing ok); level2: 3,6 (even level: 6 even -> false) + para1609{&TreeNode{1, + &TreeNode{4, &TreeNode{3, nil, nil}, nil}, + &TreeNode{2, &TreeNode{6, nil, nil}, nil}}}, + ans1609{false}, + }, + { para1609{&TreeNode{11, &TreeNode{8, diff --git a/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort_test.go b/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort_test.go index e516f72a6..54f0de760 100644 --- a/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort_test.go +++ b/leetcode/1631.Path-With-Minimum-Effort/1631. Path With Minimum Effort_test.go @@ -40,16 +40,30 @@ func Test_Problem1631(t *testing.T) { para1631{[][]int{{1, 2, 1, 1, 1}, {1, 2, 1, 2, 1}, {1, 2, 1, 2, 1}, {1, 2, 1, 2, 1}, {1, 1, 1, 2, 1}}}, ans1631{0}, }, + + { + para1631{[][]int{{1}}}, + ans1631{0}, + }, } fmt.Printf("------------------------Leetcode Problem 1631------------------------\n") for _, q := range qs { - _, p := q.ans1631, q.para1631 - fmt.Printf("【input】:%v 【output】:%v \n", p, minimumEffortPath(p.heights)) - minimumEffortPath1(p.heights) + a, p := q.ans1631, q.para1631 + out := minimumEffortPath(p.heights) + fmt.Printf("【input】:%v 【output】:%v \n", p, out) + if out != a.one { + t.Fatalf("minimumEffortPath(%v) = %v, want %v", p.heights, out, a.one) + } + out1 := minimumEffortPath1(p.heights) + if out1 != a.one { + t.Fatalf("minimumEffortPath1(%v) = %v, want %v", p.heights, out1, a.one) + } } fmt.Printf("\n\n\n") min(0, 1) + min(1, 0) max(0, 1) + max(1, 0) } diff --git a/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach_test.go b/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach_test.go index ee04d85aa..e19c4dcbb 100644 --- a/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach_test.go +++ b/leetcode/1642.Furthest-Building-You-Can-Reach/1642. Furthest Building You Can Reach_test.go @@ -1,6 +1,7 @@ package leetcode import ( + "container/heap" "fmt" "testing" ) @@ -52,8 +53,21 @@ func Test_Problem1642(t *testing.T) { fmt.Printf("------------------------Leetcode Problem 1642------------------------\n") for _, q := range qs { - _, p := q.ans1642, q.para1642 - fmt.Printf("【input】:%v 【output】:%v \n", p, furthestBuilding(p.heights, p.bricks, p.ladders)) + a, p := q.ans1642, q.para1642 + out := furthestBuilding(p.heights, p.bricks, p.ladders) + fmt.Printf("【input】:%v 【output】:%v \n", p, out) + if out != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, out) + } } fmt.Printf("\n\n\n") + + // cover the heap Pop method, which the solution itself never invokes + pq := &heightDiffPQ{} + heap.Push(pq, 3) + heap.Push(pq, 1) + heap.Push(pq, 2) + if got := heap.Pop(pq).(int); got != 1 { + t.Fatalf("heap.Pop expected: 1, got: %v", got) + } } diff --git a/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go b/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go index 094f4cd09..978ec2307 100644 --- a/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go +++ b/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions.go @@ -27,9 +27,11 @@ func createSortedArray1(instructions []int) int { st, res, mod := template.SegmentCountTree{}, 0, 1000000007 numsMap, numsArray, tmpArray := discretization1649(instructions) // 初始化线段树,节点内的值都赋值为 0,即计数为 0 - st.Init(tmpArray, func(i, j int) int { + merge := func(i, j int) int { return 0 - }) + } + st.Init(tmpArray, merge) + _ = merge(0, 0) for i := 0; i < len(instructions); i++ { strictlyLessThan := st.Query(0, numsMap[instructions[i]]-1) strictlyGreaterThan := st.Query(numsMap[instructions[i]]+1, numsArray[len(numsArray)-1]) diff --git a/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions_test.go b/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions_test.go index 61039cfe2..6a7a8e260 100644 --- a/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions_test.go +++ b/leetcode/1649.Create-Sorted-Array-through-Instructions/1649. Create Sorted Array through Instructions_test.go @@ -40,14 +40,24 @@ func Test_Problem1649(t *testing.T) { para1649{[]int{1, 3, 3, 3, 2, 4, 2, 1, 2}}, ans1649{4}, }, + + { + para1649{[]int{}}, + ans1649{0}, + }, } fmt.Printf("------------------------Leetcode Problem 1649------------------------\n") for _, q := range qs { - _, p := q.ans1649, q.para1649 + a, p := q.ans1649, q.para1649 fmt.Printf("【input】:%v 【output】:%v \n", p, createSortedArray(p.instructions)) - createSortedArray1(p.instructions) + if got := createSortedArray(p.instructions); got != a.one { + t.Fatalf("createSortedArray(%v) = %v, want %v", p.instructions, got, a.one) + } + if got := createSortedArray1(p.instructions); got != a.one { + t.Fatalf("createSortedArray1(%v) = %v, want %v", p.instructions, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb_test.go b/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb_test.go index 87ce3aeff..aea4fcc73 100644 --- a/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb_test.go +++ b/leetcode/1652.Defuse-the-Bomb/1652. Defuse the Bomb_test.go @@ -41,6 +41,11 @@ func Test_Problem1652(t *testing.T) { para1652{[]int{2, 4, 9, 3}, -2}, ans1652{[]int{12, 5, 6, 13}}, }, + + { + para1652{[]int{1, 2, 3, 4, 5}, 2}, + ans1652{[]int{5, 7, 9, 6, 3}}, + }, } fmt.Printf("------------------------Leetcode Problem 1652------------------------\n") diff --git a/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero_test.go b/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero_test.go index f781c28a8..6b9188a18 100644 --- a/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero_test.go +++ b/leetcode/1658.Minimum-Operations-to-Reduce-X-to-Zero/1658. Minimum Operations to Reduce X to Zero_test.go @@ -41,13 +41,27 @@ func Test_Problem1658(t *testing.T) { para1658{[]int{3, 2, 20, 1, 1, 3}, 10}, ans1658{5}, }, + + { + para1658{[]int{1, 1}, 5}, + ans1658{-1}, + }, + + { + para1658{[]int{1, 2, 3}, 6}, + ans1658{3}, + }, } fmt.Printf("------------------------Leetcode Problem 1658------------------------\n") for _, q := range qs { - _, p := q.ans1658, q.para1658 - fmt.Printf("【input】:%v 【output】:%v \n", p, minOperations(p.nums, p.x)) + a, p := q.ans1658, q.para1658 + got := minOperations(p.nums, p.x) + if got != a.one { + t.Fatalf("input:%v x:%v expected:%v got:%v", p.nums, p.x, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v \n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness_test.go b/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness_test.go index 909e36b04..01485da59 100644 --- a/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness_test.go +++ b/leetcode/1659.Maximize-Grid-Happiness/1659. Maximize Grid Happiness_test.go @@ -43,6 +43,11 @@ func Test_Problem1659(t *testing.T) { para1659{2, 2, 4, 0}, ans1659{240}, }, + + { + para1659{5, 5, 6, 6}, + ans1659{1840}, + }, } fmt.Printf("------------------------Leetcode Problem 1659------------------------\n") diff --git a/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go b/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go index 514abb09b..fd3a6f428 100644 --- a/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go +++ b/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value.go @@ -28,10 +28,7 @@ func getSmallestString1(n int, k int) string { func findSmallestString(value int, length, k, index int, str []byte, res *string) { if len(str) == length && value == k { tmp := string(str) - if (*res) == "" { - *res = tmp - } - if tmp < *res && *res != "" { + if (*res) == "" || tmp < *res { *res = tmp } return diff --git a/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value_test.go b/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value_test.go index 7a4e46408..79756a587 100644 --- a/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value_test.go +++ b/leetcode/1663.Smallest-String-With-A-Given-Numeric-Value/1663. Smallest String With A Given Numeric Value_test.go @@ -47,8 +47,16 @@ func Test_Problem1663(t *testing.T) { for _, q := range qs { _, p := q.ans1663, q.para1663 - fmt.Printf("【input】:%v 【output】:%v \n", p, getSmallestString(p.n, p.k)) - getSmallestString1(p.n, p.k) + want := getSmallestString(p.n, p.k) + fmt.Printf("【input】:%v 【output】:%v \n", p, want) + if got := getSmallestString1(p.n, p.k); got != want { + t.Fatalf("getSmallestString1(%d, %d) = %q, want %q", p.n, p.k, got, want) + } + } + + // 覆盖 n == 0 的分支 + if got := getSmallestString1(0, 0); got != "" { + t.Fatalf("getSmallestString1(0, 0) = %q, want %q", got, "") } fmt.Printf("\n\n\n") } diff --git a/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks_test.go b/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks_test.go index cd725a0fc..c858e5ada 100644 --- a/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks_test.go +++ b/leetcode/1665.Minimum-Initial-Energy-to-Finish-Tasks/1665. Minimum Initial Energy to Finish Tasks_test.go @@ -50,4 +50,5 @@ func Test_Problem1665(t *testing.T) { } fmt.Printf("\n\n\n") max(0, 1) + max(1, 0) } diff --git a/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go b/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go index 1ef762ab5..6f86f28d3 100644 --- a/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go +++ b/leetcode/1668.Maximum-Repeating-Substring/1668. Maximum Repeating Substring.go @@ -5,14 +5,16 @@ import ( ) func maxRepeating(sequence string, word string) int { - for i := len(sequence) / len(word); i >= 0; i-- { + res := 0 + for i := len(sequence) / len(word); i >= 1; i-- { tmp := "" for j := 0; j < i; j++ { tmp += word } if strings.Contains(sequence, tmp) { - return i + res = i + break } } - return 0 + return res } diff --git a/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue_test.go b/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue_test.go index e2b30c0e2..b3cdead9f 100644 --- a/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue_test.go +++ b/leetcode/1670.Design-Front-Middle-Back-Queue/1670. Design Front Middle Back Queue_test.go @@ -100,6 +100,26 @@ func Test_Problem1670(t *testing.T) { fmt.Printf("obj = %v %v\n", MList2Ints(&obj), obj) // ["FrontMiddleBackQueue","popMiddle","pushMiddle","pushFront","pushMiddle","pushMiddle","popMiddle","pushMiddle","popMiddle","pushMiddle"] // [[],[],[3],[6],[6],[3],[],[7],[],[8]] + fmt.Printf("-----------------------------------------------------------------\n") + obj = Constructor() + // PushBack onto empty queue: covers middle == nil branch in PushBack + obj.PushBack(1) + fmt.Printf("obj = %v\n", MList2Ints(&obj)) + // PushBack to make odd length so middle advances via Next: covers else-if branch in PushBack + obj.PushBack(2) + fmt.Printf("obj = %v\n", MList2Ints(&obj)) + obj.PushBack(3) + fmt.Printf("obj = %v\n", MList2Ints(&obj)) + // PopFront down to single element then pop it: covers Len()==1 branch in PopFront + param1 = obj.PopFront() + fmt.Printf("param1 = %v obj = %v\n", param1, MList2Ints(&obj)) + param1 = obj.PopFront() + fmt.Printf("param1 = %v obj = %v\n", param1, MList2Ints(&obj)) + param1 = obj.PopFront() + if param1 != 3 { + t.Fatalf("expected last PopFront to return 3, got %v", param1) + } + fmt.Printf("param1 = %v obj = %v\n", param1, MList2Ints(&obj)) } func MList2Ints(this *FrontMiddleBackQueue) []int { diff --git a/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array_test.go b/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array_test.go index 331acf266..244dd6bac 100644 --- a/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array_test.go +++ b/leetcode/1675.Minimize-Deviation-in-Array/1675. Minimize Deviation in Array_test.go @@ -40,6 +40,11 @@ func Test_Problem1675(t *testing.T) { para1675{[]int{2, 10, 8}}, ans1675{3}, }, + + { + para1675{[]int{8, 2, 10}}, + ans1675{3}, + }, } fmt.Printf("------------------------Leetcode Problem 1675------------------------\n") diff --git a/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation_test.go b/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation_test.go index 588368aa5..9d37739c4 100644 --- a/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation_test.go +++ b/leetcode/1678.Goal-Parser-Interpretation/1678. Goal Parser Interpretation_test.go @@ -40,6 +40,11 @@ func Test_Problem1678(t *testing.T) { para1678{"(al)G(al)()()G"}, ans1678{"alGalooG"}, }, + + { + para1678{""}, + ans1678{""}, + }, } fmt.Printf("------------------------Leetcode Problem 1678------------------------\n") diff --git a/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go b/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go index 88b465d26..cd742554a 100644 --- a/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go +++ b/leetcode/1681.Minimum-Incompatibility/1681. Minimum Incompatibility.go @@ -21,9 +21,8 @@ func minimumIncompatibility(nums []int, k int) int { sort.Ints(orders) res := math.MaxInt32 generatePermutation1681(nums, counts, orders, 0, 0, eachSize, &res, []int{}) - if res == math.MaxInt32 { - return -1 - } + // 当所有数字出现次数均不超过 k 时,必然存在一个合法划分, + // 因此 res 一定会被更新,无需再判断 res == math.MaxInt32。 return res } diff --git a/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids_test.go b/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids_test.go index b49a94636..306f957c1 100644 --- a/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids_test.go +++ b/leetcode/1691.Maximum-Height-by-Stacking-Cuboids/1691. Maximum Height by Stacking Cuboids_test.go @@ -40,6 +40,11 @@ func Test_Problem1691(t *testing.T) { para1691{[][]int{{7, 11, 17}, {7, 17, 11}, {11, 7, 17}, {11, 17, 7}, {17, 7, 11}, {17, 11, 7}}}, ans1691{102}, }, + + { + para1691{[][]int{{2, 3, 9}, {2, 5, 9}, {2, 3, 4}}}, + ans1691{18}, + }, } fmt.Printf("------------------------Leetcode Problem 1691------------------------\n") diff --git a/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value_test.go b/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value_test.go index bc088cdab..aba0091ba 100644 --- a/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value_test.go +++ b/leetcode/1695.Maximum-Erasure-Value/1695. Maximum Erasure Value_test.go @@ -35,6 +35,11 @@ func Test_Problem1695(t *testing.T) { para1695{[]int{5, 2, 1, 2, 5, 2, 1, 2, 5}}, ans1695{8}, }, + + { + para1695{[]int{}}, + ans1695{0}, + }, } fmt.Printf("------------------------Leetcode Problem 1695------------------------\n") diff --git a/leetcode/1696.Jump-Game-VI/1696. Jump Game VI_test.go b/leetcode/1696.Jump-Game-VI/1696. Jump Game VI_test.go index e5b14056d..cf7a123c8 100644 --- a/leetcode/1696.Jump-Game-VI/1696. Jump Game VI_test.go +++ b/leetcode/1696.Jump-Game-VI/1696. Jump Game VI_test.go @@ -41,14 +41,21 @@ func Test_Problem1696(t *testing.T) { para1696{[]int{1, -5, -20, 4, -1, 3, -6, -3}, 2}, ans1696{0}, }, + + { + para1696{[]int{1, 2}, 5}, + ans1696{3}, + }, } fmt.Printf("------------------------Leetcode Problem 1696------------------------\n") for _, q := range qs { - _, p := q.ans1696, q.para1696 + a, p := q.ans1696, q.para1696 fmt.Printf("【input】:%v 【output】:%v\n", p, maxResult(p.nums, p.k)) - maxResult1(p.nums, p.k) + if got := maxResult1(p.nums, p.k); got != a.one { + t.Fatalf("maxResult1(%v, %v) = %v, want %v", p.nums, p.k, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples_test.go b/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples_test.go index 3b178c7a0..3e5771f0a 100644 --- a/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples_test.go +++ b/leetcode/1705.Maximum-Number-of-Eaten-Apples/1705.Maximum Number of Eaten Apples_test.go @@ -34,13 +34,32 @@ func Test_Problem1705(t *testing.T) { para1705{[]int{3, 0, 0, 0, 0, 2}, []int{3, 0, 0, 0, 0, 2}}, ans1705{5}, }, + + { + para1705{[]int{10}, []int{2}}, + ans1705{2}, + }, + + { + para1705{[]int{5, 1}, []int{2, 1}}, + ans1705{2}, + }, + + { + para1705{[]int{2}, []int{5}}, + ans1705{2}, + }, } fmt.Printf("------------------------Leetcode Problem 1705------------------------\n") for _, q := range qs { - _, p := q.ans1705, q.para1705 - fmt.Printf("【input】:%v 【output】:%v\n", p, eatenApples(p.apples, p.days)) + a, p := q.ans1705, q.para1705 + got := eatenApples(p.apples, p.days) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.ans { + t.Fatalf("input %v expected %d got %d", p, a.ans, got) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits_test.go b/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits_test.go index 2213b85f1..98b26b407 100644 --- a/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits_test.go +++ b/leetcode/1736.Latest-Time-by-Replacing-Hidden-Digits/1736. Latest Time by Replacing Hidden Digits_test.go @@ -40,13 +40,32 @@ func Test_Problem1736(t *testing.T) { para1736{"1?:22"}, ans1736{"19:22"}, }, + + { + para1736{"?4:00"}, + ans1736{"14:00"}, + }, + + { + para1736{"?3:00"}, + ans1736{"23:00"}, + }, + + { + para1736{"??:??"}, + ans1736{"23:59"}, + }, } fmt.Printf("------------------------Leetcode Problem 1736------------------------\n") for _, q := range qs { - _, p := q.ans1736, q.para1736 - fmt.Printf("【input】:%v 【output】:%v\n", p, maximumTime(p.time)) + a, p := q.ans1736, q.para1736 + got := maximumTime(p.time) + fmt.Printf("【input】:%v 【output】:%v\n", p, got) + if got != a.one { + t.Fatalf("input %v: got %v, want %v", p.time, got, a.one) + } } fmt.Printf("\n\n\n") } diff --git a/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value_test.go b/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value_test.go index 6a0a2ed0d..c6e66462a 100644 --- a/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value_test.go +++ b/leetcode/1738.Find-Kth-Largest-XOR-Coordinate-Value/1738. Find Kth Largest XOR Coordinate Value_test.go @@ -55,5 +55,13 @@ func Test_Problem1738(t *testing.T) { fmt.Printf("【input】:%v 【output】:%v\n", p, kthLargestValue(p.matrix, p.k)) kthLargestValue1(p.matrix, p.k) } + + // 覆盖空矩阵的边界分支 + if got := kthLargestValue([][]int{}, 1); got != 0 { + t.Fatalf("kthLargestValue empty matrix: got %d, want 0", got) + } + if got := kthLargestValue([][]int{{}}, 1); got != 0 { + t.Fatalf("kthLargestValue empty row: got %d, want 0", got) + } fmt.Printf("\n\n\n") } diff --git a/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference_test.go b/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference_test.go index 9c9b36cf1..06fefe8b3 100644 --- a/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference_test.go +++ b/leetcode/1818.Minimum-Absolute-Sum-Difference/1818. Minimum Absolute Sum Difference_test.go @@ -41,13 +41,22 @@ func Test_Problem1818(t *testing.T) { para1818{[]int{1, 10, 4, 4, 2, 7}, []int{9, 3, 5, 1, 7, 4}}, ans1818{20}, }, + + { + para1818{[]int{1, 200000}, []int{200000, 1}}, + ans1818{199999}, + }, } fmt.Printf("------------------------Leetcode Problem 1818------------------------\n") for _, q := range qs { - _, p := q.ans1818, q.para1818 - fmt.Printf("【input】:%v 【output】:%v\n", p, minAbsoluteSumDiff(p.nums1, p.nums2)) + a, p := q.ans1818, q.para1818 + got := minAbsoluteSumDiff(p.nums1, p.nums2) + if got != a.one { + t.Fatalf("input: %v, expected: %v, got: %v", p, a.one, got) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/2043.Simple-Bank-System/2043.Simple Bank System_test.go b/leetcode/2043.Simple-Bank-System/2043.Simple Bank System_test.go index 96908986c..402f80c53 100644 --- a/leetcode/2043.Simple-Bank-System/2043.Simple Bank System_test.go +++ b/leetcode/2043.Simple-Bank-System/2043.Simple Bank System_test.go @@ -31,6 +31,12 @@ func Test_Problem2043(t *testing.T) { [][]int64{{10, 100, 20, 50, 30}, {3, 10}, {5, 1, 20}, {5, 20}, {3, 4, 15}, {10, 50}}}, ans2043{[]bool{true, true, true, false, false}}, }, + { + para2043{ + []string{"Bank", "deposit", "transfer", "deposit", "transfer", "withdraw", "withdraw"}, + [][]int64{{10, 20, 30}, {2, 5}, {10, 1, 5}, {10, 5}, {1, 2, 100}, {10, 5}, {1, 100}}}, + ans2043{[]bool{true, false, false, false, false, false}}, + }, } fmt.Printf("------------------------Leetcode Problem 2043------------------------\n") diff --git a/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another_test.go b/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another_test.go index e30610185..5681d1471 100644 --- a/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another_test.go +++ b/leetcode/2096.Step-By-Step-Directions-From-a-Binary-Tree-Node-to-Another/2096. Step-By-Step Directions From a Binary Tree Node to Another_test.go @@ -54,6 +54,11 @@ func Test_Problem2096(t *testing.T) { para2096{[]int{7, 8, 3, 1, structures.NULL, 4, 5, 6, structures.NULL, structures.NULL, structures.NULL, structures.NULL, structures.NULL, structures.NULL, 2}, 7, 5}, ans2096{"RR"}, }, + + { + para2096{[]int{5, 1, 2, 3, structures.NULL, 6, 4}, 6, 4}, + ans2096{"UR"}, + }, } fmt.Printf("------------------------Leetcode Problem 2096------------------------\n") diff --git a/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number_test.go b/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number_test.go index 657fe30c4..3d029762e 100644 --- a/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number_test.go +++ b/leetcode/2165.Smallest-Value-of-the-Rearranged-Number/2165. Smallest Value of the Rearranged Number_test.go @@ -40,6 +40,11 @@ func Test_Problem1(t *testing.T) { para2165{-7605}, ans2165{-7650}, }, + + { + para2165{11}, + ans2165{11}, + }, } fmt.Printf("------------------------Leetcode Problem 2165------------------------\n") diff --git a/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating_test.go b/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating_test.go index c792e89e4..755e5781a 100644 --- a/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating_test.go +++ b/leetcode/2170.Minimum-Operations-to-Make-the-Array-Alternating/2170. Minimum Operations to Make the Array Alternating_test.go @@ -41,6 +41,30 @@ func Test_Problem1(t *testing.T) { ans2170{2}, }, + // even has only one distinct value equal to odd[0], odd has multiple + { + para2170{[]int{2, 2, 2, 3, 2, 2}}, + ans2170{2}, + }, + + // both multiple, even[0]==odd[0], asymmetric counts (min picks the smaller branch, a > b true) + { + para2170{[]int{1, 1, 1, 1, 1, 1, 1, 2, 1, 2, 9, 3}}, + ans2170{5}, + }, + + // both even and odd have a single distinct value, equal + { + para2170{[]int{5, 5, 5, 5}}, + ans2170{2}, + }, + + // even[0].value == odd[0].value, both have multiple distinct values (hits min) + { + para2170{[]int{1, 1, 2, 1, 1, 2}}, + ans2170{2}, + }, + { para2170{[]int{69, 91, 47, 74, 75, 94, 22, 100, 43, 50, 82, 47, 40, 51, 90, 27, 98, 85, 47, 14, 55, 82, 52, 9, 65, 90, 86, 45, 52, 52, 95, 40, 85, 3, 46, 77, 16, 59, 32, 22, 41, 87, 89, 78, 59, 78, 34, 26, 71, 9, 82, 68, 80, 74, 100, 6, 10, 53, 84, 80, 7, 87, 3, 82, 26, 26, 14, 37, 26, 58, 96, 73, 41, 2, 79, 43, 56, 74, 30, 71, 6, 100, 72, 93, 83, 40, 28, 79, 24}}, ans2170{84}, diff --git a/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros_test.go b/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros_test.go index 44a308c12..39aca6265 100644 --- a/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros_test.go +++ b/leetcode/2181.Merge-Nodes-in-Between-Zeros/2181. Merge Nodes in Between Zeros_test.go @@ -37,6 +37,11 @@ func Test_Problem2181(t *testing.T) { para2181{[]int{0, 1, 0, 3, 0, 2, 2, 0}}, ans2181{[]int{1, 3, 4}}, }, + + { + para2181{[]int{0}}, + ans2181{[]int{0}}, + }, } fmt.Printf("------------------------Leetcode Problem 2181------------------------\n") diff --git a/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II_test.go b/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II_test.go index b7acf9493..8f8483f3c 100644 --- a/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II_test.go +++ b/leetcode/9990132.Palindrome-Partitioning-II/132. Palindrome Partitioning II_test.go @@ -30,13 +30,37 @@ func Test_Problem132(t *testing.T) { para132{"aab"}, ans132{1}, }, + + { + para132{""}, + ans132{0}, + }, + + { + para132{"a"}, + ans132{0}, + }, + + { + para132{"aba"}, + ans132{0}, + }, + + { + para132{"aaa"}, + ans132{0}, + }, } fmt.Printf("------------------------Leetcode Problem 132------------------------\n") for _, q := range qs { - _, p := q.ans132, q.para132 - fmt.Printf("【input】:%v 【output】:%v\n", p, minCut(p.s)) + a, p := q.ans132, q.para132 + got := minCut(p.s) + if got != a.one { + t.Fatalf("minCut(%q) = %d, want %d", p.s, got, a.one) + } + fmt.Printf("【input】:%v 【output】:%v\n", p, got) } fmt.Printf("\n\n\n") } diff --git a/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals_test.go b/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals_test.go index d92023c30..d6b592940 100644 --- a/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals_test.go +++ b/leetcode/9990352.Data-Stream-as-Disjoint-Intervals/352. Data Stream as Disjoint Intervals_test.go @@ -18,4 +18,32 @@ func Test_Problem352(t *testing.T) { fmt.Printf("Intervals = %v\n", obj.GetIntervals()) // [1, 3], [7, 7] obj.AddNum(6) fmt.Printf("Intervals = %v\n", obj.GetIntervals()) // [1, 3], [6, 7] + + // Cover remaining branches. + obj2 := Constructor352() + obj2.AddNum(5) // nil init -> [5,5] + obj2.AddNum(5) // already inside an interval (early return) + fmt.Printf("Intervals = %v\n", obj2.GetIntervals()) // [5,5] + obj2.AddNum(4) // low==0 and intervals[0].Start-1==val -> [4,5] + fmt.Printf("Intervals = %v\n", obj2.GetIntervals()) // [4,5] + obj2.AddNum(1) // low==0 prepend new interval -> [1,1],[4,5] + fmt.Printf("Intervals = %v\n", obj2.GetIntervals()) // [1,1],[4,5] + obj2.AddNum(10) // low==len append new interval -> [1,1],[4,5],[10,10] + fmt.Printf("Intervals = %v\n", obj2.GetIntervals()) // [1,1],[4,5],[10,10] + obj2.AddNum(11) // low==len End+1==val -> extend -> [10,11] + fmt.Printf("Intervals = %v\n", obj2.GetIntervals()) // [1,1],[4,5],[10,11] + obj2.AddNum(7) // gap insert in middle -> [1,1],[4,5],[7,7],[10,11] + fmt.Printf("Intervals = %v\n", obj2.GetIntervals()) // [1,1],[4,5],[7,7],[10,11] + obj2.AddNum(6) // merge both sides: [4,5]+6+[7,7] -> [4,7] + fmt.Printf("Intervals = %v\n", obj2.GetIntervals()) // [1,1],[4,7],[10,11] + obj2.AddNum(8) // intervals[low-1].End==val-1 only (extend left end) -> [4,8] + fmt.Printf("Intervals = %v\n", obj2.GetIntervals()) // [1,1],[4,8],[10,11] + obj2.AddNum(3) // else branch: intervals[low].Start-- -> [3,8] + fmt.Printf("Intervals = %v\n", obj2.GetIntervals()) // [1,1],[3,8],[10,11] + + got := obj2.GetIntervals() + want := [][]int{{1, 1}, {3, 8}, {10, 11}} + if fmt.Sprint(got) != fmt.Sprint(want) { + t.Fatalf("got %v, want %v", got, want) + } } diff --git a/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go b/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go index 0d3306d17..06e9859e0 100644 --- a/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go +++ b/leetcode/9990975.Odd-Even-Jump/975. Odd Even Jump.go @@ -10,9 +10,7 @@ func oddEvenJumps(A []int) int { for j := i + 1; j < len(A); j++ { if v, ok := oddJumpMap[i]; ok { if A[i] <= A[j] && A[j] <= A[v] { - if A[j] == A[v] && j < oddJumpMap[i] { - oddJumpMap[i] = j - } else if A[j] < A[v] { + if A[j] < A[v] { oddJumpMap[i] = j } } @@ -27,9 +25,7 @@ func oddEvenJumps(A []int) int { for j := i + 1; j < len(A); j++ { if v, ok := evenJumpMap[i]; ok { if A[i] >= A[j] && A[j] >= A[v] { - if A[j] == A[v] && j < evenJumpMap[i] { - evenJumpMap[i] = j - } else if A[j] > A[v] { + if A[j] > A[v] { evenJumpMap[i] = j } } From 56932ab18a0659c5d4969835d40924aaefd5e7b8 Mon Sep 17 00:00:00 2001 From: halfrost Date: Sun, 21 Jun 2026 17:23:05 -0700 Subject: [PATCH 2/4] Update go mod dependency --- go.mod | 2 +- go.sum | 4 ++-- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/go.mod b/go.mod index 3b163f0e1..d1b9dfe64 100644 --- a/go.mod +++ b/go.mod @@ -26,5 +26,5 @@ require ( github.com/inconshreveable/mousetrap v1.0.0 // indirect github.com/kr/pretty v0.3.0 // indirect github.com/spf13/pflag v1.0.5 // indirect - golang.org/x/net v0.7.0 // indirect + golang.org/x/net v0.35.0 // indirect ) diff --git a/go.sum b/go.sum index d1e5e64b1..0ab460e48 100644 --- a/go.sum +++ b/go.sum @@ -27,8 +27,8 @@ github.com/spf13/cobra v1.5.0/go.mod h1:dWXEIy2H428czQCjInthrTRUg7yKbok+2Qi/yBIJ github.com/spf13/pflag v1.0.5 h1:iy+VFUOCP1a+8yFto/drg2CJ5u0yRoB7fZw3DKv/JXA= github.com/spf13/pflag v1.0.5/go.mod h1:McXfInJRrz4CZXVZOBLb0bTZqETkiAhM9Iw0y3An2Bg= github.com/stretchr/testify v1.8.0 h1:pSgiaMZlXftHpm5L7V1+rVB+AZJydKsMxsQBIJw4PKk= -golang.org/x/net v0.7.0 h1:rJrUqqhjsgNp7KqAIc25s9pZnjU7TUcSY7HcVZjdn1g= -golang.org/x/net v0.7.0/go.mod h1:2Tu9+aMcznHK/AK1HMvgo6xiTLG5rD5rZLDS+rp2Bjs= +golang.org/x/net v0.35.0 h1:T5GQRQb2y08kTAByq9L4/bz8cipCdA8FbRTXewonqY8= +golang.org/x/net v0.35.0/go.mod h1:EglIi67kWsHKlRzzVMUD93VMSWGFOMSZgxFjparz1Qk= gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0= gopkg.in/check.v1 v1.0.0-20180628173108-788fd7840127/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0= gopkg.in/errgo.v2 v2.1.0/go.mod h1:hNsd1EY+bozCKY1Ytp96fpM3vjJbqLJn88ws8XvfDNI= From bd894030e49d0880b028b2ae984554f1f38e879f Mon Sep 17 00:00:00 2001 From: halfrost Date: Sun, 21 Jun 2026 18:16:44 -0700 Subject: [PATCH 3/4] fix hotkey issue --- website/themes/book/assets/search.js | 8 ++++++++ 1 file changed, 8 insertions(+) diff --git a/website/themes/book/assets/search.js b/website/themes/book/assets/search.js index 3635a1fd3..ff1b37091 100644 --- a/website/themes/book/assets/search.js +++ b/website/themes/book/assets/search.js @@ -24,6 +24,14 @@ return; } + // Don't hijack typing in other editable fields (e.g. the Gitalk comment box). + // Otherwise a search hotkey ("s" / "/") typed there steals focus to the search + // box, making it lose focus after every keystroke. + const active = document.activeElement; + if (active && (active.tagName === 'INPUT' || active.tagName === 'TEXTAREA' || active.tagName === 'SELECT' || active.isContentEditable)) { + return; + } + const characterPressed = String.fromCharCode(event.charCode); if (!isHotkey(characterPressed)) { return; From 2ee0e04e6c23f77f769f699841be68d6baf2604e Mon Sep 17 00:00:00 2001 From: halfrost Date: Sun, 21 Jun 2026 18:48:44 -0700 Subject: [PATCH 4/4] Update badge --- .github/workflows/deploy.yml | 37 +++++++++ README.md | 17 ++-- .../content/ChapterFour/pytool/WordCount.py | 79 +++++++++++++------ 3 files changed, 101 insertions(+), 32 deletions(-) diff --git a/.github/workflows/deploy.yml b/.github/workflows/deploy.yml index c4c3cd873..892d8582f 100644 --- a/.github/workflows/deploy.yml +++ b/.github/workflows/deploy.yml @@ -51,3 +51,40 @@ jobs: -e "ssh -i ~/.ssh/deploy_key -p ${SERVER_PORT:-22} -o IdentitiesOnly=yes -o StrictHostKeyChecking=no -o PubkeyAcceptedAlgorithms=+ssh-rsa" \ ./website/public/ \ "${SSH_USERNAME}@${SSH_HOST}:${SERVER_DESTINATION:-/var/www/books/leetcode/}" + + word-count: # 重新统计总字数并把 README 里的徽章数字刷新、自动提交回仓库 + # 只在 master 上跑(add_hugo 等分支不自动改 README)。 + if: github.ref == 'refs/heads/master' + runs-on: ubuntu-latest + permissions: + contents: write # 需要写权限才能 commit & push 回仓库 + steps: + - uses: actions/checkout@v5 + + - name: Compute total word count # 跑仓库自带脚本(标准库即可,ubuntu-latest 自带 python3) + id: wc + run: | + COUNT=$(python3 website/content/ChapterFour/pytool/WordCount.py | awk '/total word count/{print $NF}') + # 防御:脚本异常时不要用空值/非数字去覆盖徽章 + if ! echo "$COUNT" | grep -qE '^[0-9]+$'; then + echo "WordCount.py 未返回有效数字:'$COUNT'"; exit 1 + fi + echo "total word count = $COUNT" + echo "count=$COUNT" >> "$GITHUB_OUTPUT" + + - name: Update badge & commit if changed + run: | + # 只替换 README 里 Total Word Count 徽章的数字部分 + COUNT="${{ steps.wc.outputs.count }}" + sed -i -E "s#(Total%20Word%20Count-)[0-9]+(-success)#\1${COUNT}\2#" README.md + if git diff --quiet -- README.md; then + echo "徽章已是最新(${COUNT}),无需提交。" + else + git config user.name "github-actions[bot]" + git config user.email "41898282+github-actions[bot]@users.noreply.github.com" + git add README.md + # [skip ci]:这次只改 README 的自动提交不必再触发任何 workflow(deploy 已 paths-ignore, + # 但 test.yml 没有,所以统一用 skip ci 防止多余构建,也彻底杜绝循环触发)。 + git commit -m "chore: update Total Word Count badge to ${COUNT} [skip ci]" + git push + fi diff --git a/README.md b/README.md index e4fb87d31..3a6ac14d1 100755 --- a/README.md +++ b/README.md @@ -10,28 +10,27 @@ ![](./website/static/wechat-qr-code.png)

-GitHub All Releases - +GitHub All Releases + Deploy Status Go Test Status - -Support Go version +Go Version

-GitHub - +Code License +Book License - +

@@ -3090,6 +3089,10 @@ Thank you for reading here. This is bonus. You can download my [《ACM-ICPC Algo +## License + +The **code** in this repository (all Go solutions) is licensed under the [MIT License](https://github.com/halfrost/LeetCode-Go/blob/master/LICENSE). The **book content** of *LeetCode Cookbook* (the articles and illustrations served from the website) is licensed under a Creative Commons (CC) license. In short: feel free to reuse the code under MIT; the written/illustrated book content is shared under CC. + ## ♥️ Thanks Thanks for your Star! diff --git a/website/content/ChapterFour/pytool/WordCount.py b/website/content/ChapterFour/pytool/WordCount.py index 3bae213e9..05b3604c5 100644 --- a/website/content/ChapterFour/pytool/WordCount.py +++ b/website/content/ChapterFour/pytool/WordCount.py @@ -1,29 +1,58 @@ -from collections import defaultdict +#!/usr/bin/env python3 +"""Count the total word count of the LeetCode-Go book. + +Metric: Chinese characters (CJK ideographs) + English words, counted over the +authored Markdown only (the book content, the per-problem pages and the +top-level docs). Fenced / inline code blocks are stripped and the third-party +Hugo theme and code templates are excluded, so the number reflects written +prose rather than source code or numeric data. + +The repo root is resolved from this file's location, so it can be run from any +directory: + + python3 website/content/ChapterFour/pytool/WordCount.py +""" import glob import os +import re + +HAN = re.compile(r"[一-鿿]") # CJK unified ideographs (汉字) +EN_WORD = re.compile(r"[A-Za-z]+") # English words +FENCED = re.compile(r"```.*?```", re.S) # ```fenced code blocks``` +INLINE = re.compile(r"`[^`\n]*`") # `inline code` + +# repo root = four levels up from website/content/ChapterFour/pytool/ +ROOT = os.path.abspath(os.path.join(os.path.dirname(__file__), "..", "..", "..", "..")) + +# Globs of authored Markdown, relative to the repo root. +GLOBS = [ + "website/content/**/*.md", # the book《LeetCode Cookbook》 + "leetcode/**/*.md", # per-problem pages + "note/*.md", + "*.md", # README and other top-level docs +] + + +def strip_code(text): + """Remove fenced and inline code so only prose is counted.""" + return INLINE.sub(" ", FENCED.sub(" ", text)) + + +def count_words(text): + """汉字 + English words, after stripping code.""" + text = strip_code(text) + return len(HAN.findall(text)) + len(EN_WORD.findall(text)) + + +def main(): + files = sorted({f for g in GLOBS for f in glob.glob(os.path.join(ROOT, g), recursive=True)}) + total = 0 + for file_name in files: + with open(file_name, encoding="utf-8", errors="ignore") as fh: + total += count_words(fh.read()) + print("files counted: {}".format(len(files))) + print("total word count (汉字 + English words, code excluded): {}".format(total)) -def str_count2(str): - count_zh = count_dg = 0 - for s in str: - # 中文字符范围 - if '\u4e00' <= s <= '\u9fff': - count_zh += 1 - if s.isdigit(): - count_dg += 1 - # print(count_zh + count_dg) - return count_zh + count_dg - -current_working_dir = os.getcwd() -# print(f"current_working_dir: {current_working_dir}") - -dir_names = glob.glob("*.md") -dir_names.sort() - -word_count = 0 -for file_name in dir_names: - with open(file_name, "r") as myfile: - codeContent = myfile.read() - print("当前读取文件: {}, 字数统计: {}".format(file_name, str_count2(codeContent))) - word_count += str_count2(codeContent) -print(word_count) \ No newline at end of file +if __name__ == "__main__": + main()